In vitro propagation of endangered Mammillaria

In Vitro Cellular & Developmental Biology - Plant (2018) 54:518–529 https://doi.org/10.1007/s11627-018-9908-z

MICROPROPAGATION

In vitro propagation of endangered Mammillaria genus (Cactaceae) species and genetic stability assessment using SSR markers Jesús Omar Lázaro-Castellanos 1 Frédérique Reverchon 4

&

Martín Mata-Rosas 1 & Dolores González 2 & Salvador Arias 3 &

Received: 24 January 2018 / Accepted: 14 May 2018 / Published online: 19 June 2018 / Editor: Ewen Mullins # The Society for In Vitro Biology 2018

Abstract In vitro propagation protocols were established for endangered species of cacti Mammillaria hernandezii, M. dixanthocentron, and M. lanata. In vitro-germinated seedlings were used as the explant source. Three explant types were evaluated as apical, basal, and lateral stem sections. Shoot multiplication was achieved using Murashige and Skoog (MS) medium supplemented with benzyladenine, kinetin, meta-topolin, and thidiazuron in equimolar concentrations (0.0, 0.4, 1.1, 2.2, 4.4, and 8.9 μM). Shoot regeneration was obtained primarily in the lateral stem section explants. In M. hernandezii, an average of 7.4 shoots was regenerated in MS medium with 2.2 μM meta-topolin. M. dixanthocentron and M. lanata averaged 16.7 and 17.9 shoots/explant, respectively, in MS medium supplemented with 1.1 μM meta-topolin. Rooting occurred in MS medium without growth regulators. Three in vitro culture cycles were performed to validate the propagation protocols and to verify genetic stability. Shoots were collected in each cycle and genomic DNA was extracted. Amplified microsatellites were used to compare each genotype with its respective donor plant. Polymorphic information content analysis showed low levels of intra-clonal polymorphisms—M. hernandezii 0.04 and M. dixanthocentron and M. lanata both 0.12. More than 95% of the plants were successfully acclimatized in the greenhouse. After 12 months, plants of M. hernandezii reached the flowering stage; M. dixanthocentron and M. lanata flowered at 24 mo. Keywords Axillary meristem activation . Cacti . Microsatellites . Plant growth regulator

Introduction Jesús Omar Lázaro-Castellanos and Martín Mata-Rosas contributed equally to this work. * Jesús Omar Lázaro-Castellanos [email protected] 1

Laboratorio de Cultivo de Tejidos Vegetales, Manejo Biotecnológico de Recursos, Instituto de Ecología A.C., Carretera antigua a Coatepec 351, El Haya, 91070 Xalapa, Veracruz, Mexico

2

Laboratorio de Sistemática Molecular, Biodiversidad y Sistemática, Instituto de Ecología A.C., Carretera antigua a Coatepec 351, El Haya, 91070 Xalapa, Veracruz, Mexico

3

Jardín Botánico, Instituto de Biología, Universidad Nacional Autónoma de México, Circuito Exterior s/n, UNAM, 04510 Mexico, Distrito Federal, Mexico

4

Microbiología Ambiental, Estudios Moleculares Avanzados, Instituto de Ecología A.C., Carretera antigua a Coatepec 351, El Haya, 91070 Xalapa, Veracruz, Mexico

México contains the greatest diversity of the Cactaceae, and the majority of the species are endemic (Ortega-Baes and GodínezAlvarez 2006). The most diverse genus in the family is Mammillaria; most of the known species occur in México. These plants are small, low-growing globular cacti with distinctly tubercular stems. Areolas are dimorphic: the vegetative (spinebearing) areola occurs at the tubercle apex, and flowering areolas occur in the tubercle axils (Butterworth and Wallace 2004). Most species have restricted distribution; environmental disturbances and anthropogenic activities are some of the main factors that place populations at the risk of extinction; this has been particularly recognized in endemic species (Martorell and Peters 2005). Tehuacán-Cuicatlán Valley, in central México, is a semiarid region with a high diversity of cacti (81 species), mainly of the Mammillaria genus (25 species: Arias et al. 2012). Unfortunately, most of these species are endangered or threatened by habitat destruction and illegal collection. Such is the

IN VITRO PROPAGATION OF MAMMILLARIA

case for Mammillaria hernandezii Glass & R.A. Foster, Mammillaria dixanthocentron Backeb. ex Mottram, and Mammillaria lanata (Britton & Rose) Orcutt, populations of which are restricted to limited fragments within this region (Ureta and Martorell 2009). Currently, M. hernandezii and M. dixanthocentron are protected by the Mexican Federal Government (NOM-059-SEMARNAT-2010) and are included in the International Union for the Conservation of Nature and Natural Resources (IUCN) Red List of Threatened Species (IUCN 2016). M. lanata has been considered synonymous with Mammillaria supertexta; however, there are enough characteristics to consider it as a different species (Arias et al. 2012). Currently, only one population is known and there are few studies on this species. In vitro propagation is a useful tool to maintain plant biodiversity, particularly for species that are difficult to reproduce and for those that are rare or endangered (Engelmann 2011). In the last two decades, at least 300 species of cacti have been propagated in vitro (Lema-Rumińska and Kulus 2014), primarily for ornamental (Rubluo 1997; Civatti et al. 2017), agricultural (Zoghlami et al. 2012), and industrial uses (De Medeiros et al. 2006). With this technique, germplasm banks have also been created (Giusti et al. 2002) and used to reestablish species in their natural habitat (García-Rubio and Malda-Barrera 2010). At least 33 species of Mammillaria have been propagated in vitro (Ramírez-Malagon et al. 2007); specific cytokininsauxins ratios have been used to control morphogenetic responses on micropropagation. The most common response is axillary meristem activation (Clayton et al. 1990; PérezMolphe-Balch et al. 1998; Rubluo et al. 2002; RamírezMalagon et al. 2007). In the different reports on in vitro propagation of cacti, the cytokinins most commonly used are zeatin (ZEA), benzyladenine (BA), and kinetin (KIN), while the most used auxins include 3-indole acetic acid (IAA) and 1naphthalene acetic acid (NAA) (Pérez-Molphe-Balch et al. 2015). In several plants with horticultural potential and on endangered species, successful propagation protocols have been reported using topolins, mainly meta-topolin (mT) (Bairu et al. 2007; Amoo et al. 2011; Aremu et al. 2012; Moyo et al. 2012) and thidiazuron (TDZ) (Guo et al. 2011) as alternative cytokinins. The use of these cytokinins in the propagation of cacti has been little reported, so comparative studies of their efficacy as plant growth regulators (PGR) would be useful. Cytokinins usually induce high multiplication rates; however, their use, particularly over long periods, has also been linked to the development of morpho-physiological disorders (Hazarika 2006), somaclonal variation, and/or genetic instability (Aversano et al. 2011; Akdemir et al. 2016). Therefore, it is necessary to perform genetic stability analyses on in vitropropagated plants, especially those destined for the germplasm collections, to guarantee the production of true-to-type

519

plants (Larkin and Scowcroft 1981; Nayak et al. 2011). This can be accomplished using simple sequence repeats (SSRs)— molecular markers composed of short DNA sequences found in the genome of eukaryotic organisms (Li et al. 2004). They are one of the best methods to detect genetic mutations and to analyze genetic stability of plants propagated in vitro (Lopes et al. 2009; Marum et al. 2009; Hazubska-Przybył et al. 2012; Kasthurirengan et al. 2013; Singh et al. 2013; Tiwari et al. 2013). SSR markers can be easily and affordably amplified using polymerase chain reaction (PCR). Despite the increasing number of in vitro propagation protocols available for cacti, information on genetic stability of the plants obtained is largely lacking. Therefore, the objective of this study was to establish the conditions for in vitro propagation of M. hernandezii, M. dixanthocentron, and M. lanata from seeds, with particular emphasis on comparing the regeneration potential of widely used cytokinins (BA and KIN) to that of alternative ones (mT and TDZ). In tandem with these experiments, the genetic stability of regenerated plants after successive cultivation cycles was analyzed using SSRs as molecular markers.

Materials and Methods Plant material Seeds of M. hernandezii (N = 80), M. dixanthocentron (N = 80), and M. lanata (N = 82) were obtained from the Botanical Garden of the National Autonomous University of México. First, they were washed for 20 min with liquid detergent diluted with distilled water, then surface disinfected with 3% (v/v) hydrogen peroxide (ZUUM® Puebla, México) for 10 min. This was followed by immersion in 70% (v/v) ethanol for 1 min, then 30% (v/v) Clorox® (5.25% sodium hypochlorite, Clorox Co., Oakland, CA) containing 0.1 (v/v) Tween 80® for 20 min (SigmaAldrich Chemical Company, St Louis, MO). Finally, the seeds were rinsed three times with sterile distilled water, for 5 min each time. All steps were performed with continuous stirring. Five seeds were sown in a 125-mL baby food jar containing 30 mL of Murashige and Skoog (MS) basal medium (Murashige and Skoog 1962) augmented with 2 mg L−1 glycine, 100 mg L−1 myo-inositol (Sigma-Aldrich), and 30 g L−1 sucrose. The pH was adjusted to 5.7 ± 0.1 with 0.5 N NaOH and 0.5 N HCl before adding 0.8% agar (Plant Tissue Culture Grade Agar A111, PhytoTechnology Labs, Shawnee Mission, KS). The medium was autoclaved at 120°C for 20 min. All cultures were maintained in a growth chamber at 25 ± 1°C with a 16-h photoperiod provided by T8 24W LED tube lights (LED Luxor ™, Hong Kong, China) (approx. 55 μmol m−2 s−1). The total number of in vitro-germinated seedlings was not sufficient for all desired morphogenetic induction treatments; therefore, shoot multiplication was performed to overcome

520

LÁZARO-CASTELLANOS ET AL.

this limitation. Four treatments for morphogenetic induction were used: MS medium supplemented with either 0.4 μM BA, 4.4 μM KIN, 1.1 μM mT, or 1.1 μM TDZ. Plantlets with a height ≈ 10 mm (12-mo-old M. hernandezii, 8-mo-old M. dixanthocentron, and 6-mo-old M. lanata) were dissected to produce three types of explants (as illustrated in Fig. 1): (1) apical section (≈ 4 mm in length), (2) basal section, and (3) two lateral sections of the stem (≈ 6 mm in length). Each explant was placed into one of the induction media for 4 wk. They were then transferred to MS medium supplemented with activated charcoal 1 g L−1 to assess subsequent responses. After 8 weeks, in all three species, the treatment with the highest morphogenetic response was 1.1 μM mT. Shoots that developed in this media were transferred to MS medium without growth regulators for rooting; those plantlets became the stock population for all subsequent induction experiments. Shoot induction Plants from the stock population with a height ≈ 10 mm were dissected to obtain apical, basal, and lateral explants. Induction treatments consisted of MS medium supplemented with BA, KIN, mT, or TDZ in equimolar concentrations 0.0, 0.46, 1.1, 2.2, 4.4, and 8.9 μM (all acquired from Sigma-Aldrich). Two explants of each type were grown in a jar with 30 mL of each induction treatment medium. For the apical and basal explants, four replicates were tested by induction treatment; for the lateral explants, eight replicates were tested. The explants were exposed to the induction treatments for 4 wk, then subcultured into MS medium supplemented with activated charcoal 1 g L−1 for another 4 wk. They were then transferred to fresh MS medium for 8 wk. All the treatments were evaluated for (1) percentage of explants without oxidation or senescent (survival), (2) average number of shoots per explant, (3) average height of the shoots (millimeter), and (4) percentage of explants that developed a callus. Rooting of shoots and development in the greenhouse Four shoots with a height ≈ 6 mm were harvested and cultured in MS medium for 12 wk to allow roots to develop. There were 20 replications. Fifteen rooted shoots of each species (shoot height ≈ 10 mm) were removed from the culture jars, washed with tap water to remove the adhering medium, and transferred to propagation trays (Hummert International, Earth City, MO) that was filled with pasteurized garden soil:pumice (1:1). Trays were maintained in a greenhouse with an average temperature of 30°C. For the first 30 d, a high relative humidity (80 to 90%) was maintained by keeping the trays covered with plastic, translucent lids (Hummert International). Three grams per liter of Captan 50 PH (Carbamine; Rhone-Poulenc Agro S. A., Cuernavaca, México) solution was applied to avoid fungal diseases. The relative humidity was then reduced to between 50 and 60%, and plant survival (%) was recorded monthly for 1 yr.

Figure 1. Sectioning of in vitro-germinated seedlings for preparation of different types of explants.

Statistical analyses Determination of the best induction treatment was done using multiple variance analysis (MANOVA); variables assessed were explant survival, an average number of shoots per explant, shoot height, and callus production. Explant survival and callus production rates were transformed using arcsin [(%)∙0.01] 0.5 to meet assumptions of normality. After initial analysis, nonsignificant variables (ANOVA P > 0.05) were eliminated to simplify the model (Crawley 2007). Analyses were performed using R 3.1.1 (R Core Team 2017). The induction treatment that was found to provide the greatest shoot multiplication was used to carry out three consecutive cycles of in vitro regeneration, for 2 years, and to verify the genetic stability of the plants obtained after each cycle. Analysis of genetic stability Ten plants (12 to 15 mm length) from in vitro-germinated seedlings of each species were used as mother plants. The apical section (≈ 5 mm length), of each plant, was dissected and transferred to MS medium to promote regeneration and rooting. An 80-mg (fresh weight) sample of this tissue was preserved at − 80°C to allow analysis of the donor plant genotype. The basal section was discarded, and lateral sections were used for shoot


multiplication. The induction treatment to propagate M. hernandezii was MS medium supplemented with 2.2 μM mT; the treatment used for both M. dixanthocentron and M. lanata was MS medium supplemented with 1.1 μM mT. Regenerated shoots were separated from the explants and subcultured in MS medium for root development. Ten rooted shoots of each plant were selected to start the second cycle of cultivation and rooting. These, in turn, were the basis for the third cycle. In each cycle, ten shoots were randomly collected (≈ 70 mg each) for DNA extraction to compare the genotype of each regeneration cycle with that of the genotype of the donor plant. DNA isolation, SSR amplification, and product analysis Total genomic DNA from all tissue samples was isolated with DNeasy® Plant Mini Kit (QIAGEN Group, Hilden, Germany); quality of the DNA was verified on 0.8% (w/v) agarose gels (Sigma-Aldrich). In all species, nine pairs of SSR primers (Custom TaqMan™ Primer, Applied Biosystems, Foster City, CA) initially designed for M. crucigera (Solórzano et al. 2009) were applied (Table 1). Each forward primer was fluorescently labeled to allow detection of the PCR products. Amplification was performed in a final volume of 15 μL with 5× My Taq Reaction Buffer® (Bioline, Taunton, MA) (5 mM dNTPs, 15 mM MgCl 2), 1 U GoTaq® Flexi DNA polymerase (Promega Co. Madison, WI), 0.5 μM of each primer (forward and reverse), and 40–50 ng template DNA. PCR conditions at each SSR locus were evaluated until a reproducible path was found to obtain amplified DNA fragments. PCR was carried Table 1.

521

out in a C1000 Touch™ Thermal Cycler (BIO-RAD, Hercules, CA), with an initial denaturation at 94°C for 3 min, followed by 35 cycles of 10 s at 94°C, 10 s with a specific alignment temperature for each pair of primers, an extension of 10 s to 72°C, and a final extension of 5 min at 72°C. The products obtained from the PCR were first verified in 2% (w/v) agarose gels prior separation by capillary electrophoresis in an automated sequencer ABI PRISM® 310 Genetic Analyzer (Applied Biosystems, Foster City, CA) with GeneScan™ 500 ROX as size standard (Applied Biosystems, Foster City, CA). The number and size of the amplified alleles determined each individual genotype. A binary matrix of presence (1) or absence (0) of alleles was constructed for calculating polymorphic information content (PIC) at each locus for each cycle of regeneration. PIC values were calculated according to Smith et al. (1997) where values oscillate in a range of 0 (monomorphic) and 1 (polymorphic—very highly discriminative). Genetic similarities between donor plants and their regenerants were calculated using Jaccard’s similarity coefficient and grouped using the Unweighted Pair Group Method with Averages (UPGMA) in NTSYS pc V.2.0 software (Rohlf 1998).

Results In vitro propagation The surface disinfection treatment was successful; there was no contamination observed. The germination percentages were high: in M. hernandezii, 94.1% of the seeds germinated. However, the development was slow, and

Characterization of SSR markers used to estimate the genetic stability of in vitro-propagated plants

Locus

MamVTC1 MamVTC2 MamVTC5 MamVTC8 MamVTC9 MamVTC10

MamVTC11 MamVTC12 MamVTC14

Primer sequence

F: CGATCATTAACCATTACCGTCA R: CCGACTGCACAATTTTATGA F: TCTCACTGCCCGTTTTCTCT R: ACGGTGATGGTGGGTGTTAT F: TACAGACGCCATAGGCAAAG R: GGTGGAGATGAGGGACTGAA F: TCGATTATCTGCTGCTTCCA R: CCGAGAAAGCCCTAAAACCT F: TGGATACGTGGCTCTTCGAT R: CCAAATGCCAATCCTCCTAA F: CATTCTAGACATCATATCGC TCT R: TGAGACTCCACTCTATTTCC TCT F: CAGGGGTAAGGGAGACAACA R: CTTCAGTGCCCCCTTTGAAT F: TGGGGAATGGGCTATGATTA R: CGGCGTTTATTAGCCAATCT F: TTTGATTGGGAAGTGCAGTG R: TCTCACTCTGACGCTTGGAA

Repeat motif

Dye label

Annealing temperature (°C) M. hernandezii

M. dixanthocentron

M. lanata

(GAA)14

NED

58

55

55

(CTTCTTCAT)2 CTT (CT)2 C(T)14 (GA)5CA(GA)7 AA(GA)12

6-FAM

60

60

60

HEX

50

59

55

(GA)15GGG(GAA)5

NED

60

60

60

(GT)3G(GT)3

6-FAM

60

60

60

(CT)8(CA)6

NED

50

50

55

(GA)24

6-FAM

60

52

59

(TC)4 AT(TC)10 (C)4 TC(TG)4

ROX

58

56

56

(TC)4TTCTT(TC)4

ROX

57

56

56

522


Figure 2. Shoot regeneration from stem lateral explants of M. hernandezii (a), M. dixanthocentron (b), and M. lanata (c). Rooting in MS medium: M. hernandezii (d), M. dixanthocentron (e), and M. lanata

( f ). Initiation of the reproductive stage: M. hernandezii 12 mo (g), M. dixanthocentron 24 mo (h), and M. lanata 24 mo (i). Bars 1 cm.

the plants did not reach a height of ≈ 10 mm for 12 mo. M. dixanthocentron and M. lanata achieved similar germination percentages (89.8 and 91.4%, respectively), but M. dixanthocentron reached a height of ≈ 10 mm after 8 months, while M. lanata required only 6 mo. In all species, shoot formation was observed only in apical and lateral explants. Shoot proliferation explant types were mainly axillary (Fig. 2a–c). In M. hernandezii, average shoot number, height, and callus production for both apical and lateral explants were greatest in the mT 2.2 and 4.4 μM treatments (Table 2). Similar results were observed in the 1.1 and 8.9 μM mT treatments in M. dixanthocentron (Table 3) but only for lateral explants. In the apical explants of this species, the highest values for average shoot number, height, and callus production were found in the 4.4 μM TDZ treatment (Table 3). The survival rate of explants in both species was at least 50% in both types, and there were no significant differences among induction treatments.

In M. lanata, apical explant survival rate and shoot height were largely unaffected by treatment. On the other hand, the average shoot number and callus formation were greatest in the 2.2, 4.4, and 8.9 μM TDZ treatments (Table 4). For lateral explants of M. lanata, all the tested variables were significantly higher in the mT 1.1 and 4.4 μM treatments (Table 4). Formation of green, loosely packed callus was observed in all species and explant types but was particularly noticeable in those treatments containing TDZ (Tables 2, 3, and 4). Rooting of shoots and development in the greenhouse Plants of M. hernandezii developed roots after 8 wk (98.4%). In M. dixanthocentron, most of the plants (94%) rooted at 12 wk; in M. lanata (94.6%), 10 wk were required. Mortality was observed only in the first month in the greenhouse; the 12-mo plant survival for all species was greater than 95%. At this time, M. hernandezii plants had an average stem diameter of 10.7 mm, and 80% reached the flowering

IN VITRO PROPAGATION OF MAMMILLARIA Table 2.

523

Morphogenetic responses of apical and lateral explants of M. hernandezii, after 12 wk in induction treatments

Treatment/μM

Shoots per explant

Shoot height (mm)

Callus (%)

Apical

Lateral

Apical

Lateral

Apical

Lateral

Apical

Lateral

BA 04 BA 1.1

0±0 0.1 ± 0.7

1.6 ± 0.5 1.8 ± 0.6

0±0 0±0

5.7 ± 0.3 4.9 ± 0.8

0±0 0±0

0±0 18.7 ± 6

100 ± 0 100 ± 0

100 ± 0 100 ± 0

BA 2.2

0.1 ± 0.7

3.2 ± 0.8

1.7 ± 2.6

4.8 ± 0.6

0±0

12.5 ± 6.5

100 ± 0

100 ± 0

BA 4.4 BA 8.9

0±0 2.8 ± 1

2.1 ± 0.5 5.4 ± 1.1*

0±0 5.6 ± 0.8

6.3 ± 0.7 5.4 ± 0.8*

0±0 12.5 ± 7.1

18.7 ± 8.6 25 ± 5.3*

100 ± 0 100 ± 0

100 ± 0 100 ± 0

KIN 0.4 KIN 1.1

0±0 0±0

2.8 ± 1.2 2.1 ± 0.6

0±0 0±0

4.1 ± 0.7 4.3 ± 0.9

0±0 0±0

6.2 ± 7.1 18.7 ± 6

100 ± 0 87.5 ± 2.7

100 ± 0 100 ± 0

KIN 2.2

0.3 ± 1

1.8 ± 0.6

0.8 ± 1.7

5.1 ± 0.6

0±0

0±0

100 ± 0

100 ± 0

KIN 4.4 KIN 8.9

0.1 ± 0.7 0.1 ± 0.7

4.3 ± 1.2 3.2 ± 0.6

0.1 ± 1 0±0

4.2 ± 1.2 4.5 ± 0.5

0±0 0±0

6.2 ± 7.1 0±0

87.5 ± 2.7 100 ± 0

100 ± 0 100 ± 0

mT 0.4 mT 1.1

1 ± 1.4 2.8 ± 0.8

4 ± 0.9 3.9 ± 0.7

2 ± 2.1 2.5 ± 0.7

4.3 ± 0.7 4 ± 0.8

25 ± 5.8 0±0

18.7 ± 6 37.5 ± 5.8

100 ± 0 100 ± 0

100 ± 0 100 ± 0

mT 2.2 mT 4.4

5 ± 0.7** 3.5 ± 0.6*

7.4 ± 1.1*** 4.7 ± 1.2*

2.9 ± 1.2** 4 ± 0.4*

7 ± 0.5*** 6.1 ± 0.8*

25 ± 5.8** 25 ± 5.8*

12.5 ± 6.5*** 37.5 ± 5.8*

100 ± 0 100 ± 0

100 ± 0 87.5 ± 2.5

mT 8.9 TDZ 0.4

4.2 ± 1.5** 3 ± 1.4

3.7 ± 1.4 4.1 ± 1.6

2.2 ± 1.1** 2.1 ± 1.8

4.1 ± 1.3 3.6 ± 1.1

0 ± 0** 12.5 ± 7.1

56.2 ± 4.3 62.5 ± 5.6

75 ± 5.8 100 ± 0

93.7 ± 1.8 100 ± 0

TDZ 1.1 TDZ 2.2

1.5 ± 1.5 3.3 ± 0.8*

5.2 ± 1.1* 4.3 ± 1.4

2.5 ± 1.9 2.2 ± 1.1*

4.9 ± 0.8* 6.6 ± 0.8

37.5 ± 4.1 62.5 ± 3.2*

62.5 ± 4.5* 75 ± 3.1

100 ± 0 100 ± 0

100 ± 0 100 ± 0

TDZ 4.4 TDZ 8.9 Without PGR

1.8 ± 0.8 0.6 ± 0.6 0.3 ± 1.2

2.3 ± 1 2.6 ± 1.4 2.5 ± 0.9

3.3 ± 0.8 1.4 ± 1.5 1.8 ± 2.6

4.4 ± 1.6 6.8 ± 2 5.4 ± 0.5

62.5 ± 3.2 37.5 ± 7.8 0±0

93.7 ± 1.8 81.2 ± 4.1 6.2 ± 7.1

100 ± 0 100 ± 0 100 ± 0

100 ± 0 87.5 ± 3.8 100 ± 0

± standard error. Analysis of variance of minimal adequate model: apical F significance: *P < 0.05, **P < 0.01, ***P < 0.001

stage (Fig. 2g). Manual cross-pollinations were performed, and fruit and seed production occurred (average of 1.2 fruits per plant [n = 35] and 29.1 seeds per fruit [n = 21]). In M. dixanthocentron, 24-mo-old plants reached an average height of 35 mm and diameter of 32 mm, and 56% began flowering (Fig. 2h). M. lanata also started flowering at same age (80%); at this time, they had attained an average size and diameter of 41.2 and 30.7 mm, respectively (Fig. 2i). Genetic stability Shoot proliferation remained constant throughout the three consecutive cultivation cycles in all species (Table 5). Seven SSR loci gave positive and reproducible amplifications for M. hernandezii, and 42 alleles were recorded with 93 to 248 base pairs (bp) (Table 6). MamVTC10 was the locus with the greatest number of polymorphic alleles, and the PIC value was less than 0.05 throughout the three culture cycles. In M. dixanthocentron, eight SSR loci were amplified and 35 alleles were quantified with 92–252 bp. The lowest PIC value was recorded in the first in vitro culture cycle (0.10) and the highest in the second cycle (0.15); MamVTC10 and MamVTC8 loci showed the highest intra-clonal polymorphism. In M. lanata, 35 alleles were quantified with 134– 242 bp. The first two regeneration cycles had the highest

(20, 63) = 5.2,

Survival (%)

R2 = 0.50; lateral F

(20, 147) = 14.5

R2 = 0.62. Level of

polymorphism values. The MamVTC8, MamVTC10, and MamVTC11 loci gave the highest polymorphism values (Table 6). Genetic similarity between the donor plant and most of the somaclones was greater than 0.86 in all three species. Dendrograms based on Jaccard’s similarity coefficient revealed that in M. hernandezii all individuals were grouped in a similarity range of 0.90 to 1.00. A range of 0.82 to 0.96 was seen for M. dixanthocentron. For M. lanata, a genetic similarity range of 0.83 to 1.00 was found with most individuals having values greater than 0.89 (Fig. 3).

Discussion In vitro propagation The high percentages of in vitro germination registered in the three species studied are in agreement with those reported for other species of cacti (70–100%) (Pérez-Molphe-Balch et al. 2015). Likewise, a high survival of apical and lateral explants and rapid development of shoots was registered, mainly in the axillary areolas. This multiplication method is also the most reported for in vitro propagation of species of the Cactaceae family (Lema-Rumińska and Kulus 2014).

524 Table 3.

LÁZARO-CASTELLANOS ET AL. Morphogenetic responses of apical and lateral explants of M. dixanthocentron, after 12 wk in induction treatments

Treatment/μM

Shoots per explant

Shoot height (mm)

Callus (%)

Apical

Lateral

Apical

Lateral

Apical

Lateral

Apical

Lateral

BA 04 BA 1.1

0.3 ± 1 0.5 ± 1.2

2.6 ± 1.3 11.3 ± 1.0***

2.5 ± 2.7 0.6 ± 1.3

11 ± 2.2 11 ± 0.9***

16.7 ± 7.1 16.7 ± 7.1

30 ± 8.2 0 ± 0***

100 ± 0 100 ± 0

100 ± 0 90 ± 2.4

BA 2.2

0.3 ± 1

2.1 ± 1.3

0.5 ± 1.2

5.6 ± 2.3

33.3 ± 10

40 ± 8.7

100 ± 0

80 ± 3.1

BA 4.4 BA 8.9

0±0 5.2 ± 1.6

9.9 ± 2.0 10.4 ± 1.3

0±0 2.2 ± 0.4

10.4 ± 1.3 11 ± 0.6

0±0 0±0

10 ± 7.1 20 ± 6.1

100 ± 0 100 ± 0

100 ± 0 100 ± 0

KIN 0.4 KIN 1.1

0±0 0±0

4.2 ± 1.0 6.8 ± 1.1

0±0 0±0

13.6 ± 0.8 11.4 ± 1.2

0±0 0±0

20 ± 6.1 20 ± 10

100 ± 0 100 ± 0

100 ± 0 100 ± 0

KIN 2.2

1 ± 0.9

4.8 ± 1.4

3.3 ± 1.6

15.8 ± 1.7

0±0

20 ± 6.1

66.7 ± 7

80 ± 3.1

KIN 4.4 KIN 8.9

1.2 ± 1.9 0±0

6.2 ± 0.9 4.6 ± 1.8

0.5 ± 1.3 0±0

10.8 ± 0.6 6.6 ± 2.1

0±0 0±0

10 ± 7.1 50 ± 5

66.7 ± 7 100 ± 0

100 ± 0 100 ± 0

mT 0.4 mT 1.1

0.5 ± 1.2 3.8 ± 0.6

7 ± 0.9 16.7 ± 0.4***

0.6 ± 1.3 5.7 ± 2

11 ± 1.7 10.8 ± 0.8***

16.7 ± 7.1 33.3 ± 5

10 ± 7.1 80 ± 3.1***

100 ± 0 100 ± 0

100 ± 0 90 ± 2.4

mT 2.2 mT 4.4

0.3 ± 1 3.5 ± 1.6

6.5 ± 1.2 8.3 ± 2.8

1.5 ± 2.1 2 ± 1.3

13.8 ± 0.5 16.8 ± 1.2

0±0 16.7 ± 7.1

60 ± 5.4 20 ± 6.1

100 ± 0 100 ± 0

100 ± 0 80 ± 3.1

mT 8.9 TDZ 0.4

2.3 ± 1.3 1.2 ± 1.9

15.8 ± 1.1 *** 11.1 ± 0.8

2.2 ± 1.3 1.3 ± 2

8.6 ± 0.4*** 8.8 ± 0.4

0±0 50 ± 7.1

80 ± 3.1*** 50 ± 5

100 ± 0 100 ± 0

100 ± 0 100 ± 0

TDZ 1.1 TDZ 2.2

0.3 ± 1 10.1 ± 2.7**

10.2 ± 1.1 4.8 ± 1.6

1.7 ± 2.2 3.7 ± 0.6**

7.8 ± 0.3 5 ± 1.3

16.7 ± 7.1 100 ± 0**

80 ± 3.1 100 ± 0

100 ± 0 100 ± 0

90 ± 2.4 100 ± 0


14 ± 3.1*** 9.2 ± 0.5* 0.3 ± 1

5.5 ± 1.2 0.6 ± 1.7 14.2 ± 2.1***

4.6 ± 0.3*** 1.3 ± 2* 0±0

7 ± 0.5 1 ± 2.2 11 ± 0.3**

50 ± 7.1*** 100 ± 0* 16.7 ± 7.1

100 ± 0 100 ± 0 10 ± 7.1***

83.3 ± 3 50 ± 0 100 ± 0

100 ± 0 100 ± 0 100 ± 0


The in vitro propagation of species of the genus Mammillaria requires similar concentrations of cytokinin to induce the greatest shoot numbers (Ramírez-Malagon et al. 2007). However, in the present study, the morphogenetic responses varied with explant origin. The highest shoot proliferation in apical explants of M. hernandezii and M. lanata resulted from exposure to mT or TDZ, whereas M. dixanthocentron only responded to mT. Lateral explants, however, developed a significant number of shoots in treatments supplemented with different cytokinins: M. hernandezii with mT, BA, and TDZ; M. dixanthocentron with mT, medium without PGR, and BA; and M. lanata with mT. This may be caused by endogenous phytohormone interaction with the cytokinins supplied in the treatment media (Sriskandarajah et al. 2006; Pérez-Molphe-Balch et al. 2015). Explant source causes a clear morphogenetic response; those derived from the stem have the highest shoot proliferation. Bairu et al. (2011) claimed that the cytokinin concentration of plants propagated in vitro decreases acropetally from the basal to the apical section and that high or low cytokinin concentration is related to a low multiplication of shoots. The regeneration rates that we observed fit into this scenario. A similar result was found in Mammillaria pectinifera: the

(20, 42) = 3.9,

Survival (%)


(20, 84) = 17.7,

R2 = 0.76. Level of

highest regeneration of shoots was recorded for stem explants, while the apical explants showed only shoot regeneration and callus production when they were exposed to TDZ (Giusti et al. 2002). The most widely used cytokinins for cactus in vitro propagation are BA and KIN (Pérez-Molphe-Balch et al. 2015); however, in this study, the use of BA was successful in M. hernandezii and M. dixanthocentron only for lateral explants at specific concentrations, and no significant effect of KIN was observed in any species or explant type. In contrast, the best treatments for shoot proliferation were those supplemented with mT in low concentrations. This is novel since the use of this cytokinin for in vitro propagation of Mammillaria has not been reported previously. The mode of action of mT involves activation of endogenous cytokinins which, in turn, promotes in vitro multiplication (Bairu et al. 2011). In the last 20 years, this compound has been used to micropropagate at least 60 ornamental, forestry, and threatened plant species (Aremu et al. 2012). Moyo et al. (2012) consider mT as a viable alternative to traditional cytokinins such as BA and KIN; our results support this proposal and we suggest expanding its use to other species of cacti.

IN VITRO PROPAGATION OF MAMMILLARIA Table 4.

525

Morphogenetic responses of apical and lateral explants of M. lanata, after 12 wk of culture in induction treatments

Treatment/μM

Shoots per explant

Shoot height (mm)

Callus (%)

Apical

Apical

Lateral

Apical

8.3 ± 2.6 9.8 ± 2

1.8 ± 2.3 0.5 ± 1.3

8.8 ± 2.4 12.7 ± 0.8

16.7 ± 7.1 16.7 ± 7.1 33.3 ± 10

Lateral

Survival (%) Lateral

Lateral

100 ± 0 100 ± 0

58.3 ± 6.4 100 ± 0

BA 04 BA 1.1

0.2 ± 0.7 0.5 ± 0

BA 2.2

1 ± 1.7

6.3 ± 1.7

1.3 ± 2

11.7 ± 0.9

25 ± 5.5

100 ± 0

91.7 ± 2.1

BA 4.4 BA 8.9

0±0 1.3 ± 0.9

11.2 ± 1.5 6.5 ± 1.4

0±0 3.3 ± 0.8

12.1 ± 0.4 12.1 ± 0.5

0±0 0±0

41.7 ± 5.8 41.7 ± 5.8

100 ± 0 100 ± 0

100 ± 0 100 ± 0

KIN 0.4 KIN 1.1

0±0 0±0

4.9 ± 1.5 12.4 ± 1.2

0±0 0±0

12.1 ± 2 13.2 ± 0.5

0±0 0±0

0±0 33.3 ± 8.9

100 ± 0 100 ± 0

91.7 ± 2.1 100 ± 0

KIN 2.2

0.8 ± 0.8

8.1 ± 0.3

3.2 ± 1.8

13.1 ± 0.3

0±0

66.7 ± 5

100 ± 0

100 ± 0

KIN 4.4 KIN 8.9

0.2 ± 0.7 0.3 ± 1

10.2 ± 0.3 7.2 ± 0.9

0.8 ± 1.5 1 ± 1.7

14 ± 0.3 14.8 ± 0.4

0±0 0±0

25 ± 5.5 33.3 ± 7.1

100 ± 0 100 ± 0

100 ± 0 100 ± 0

mT 0.4 mT 1.1

0.5 ± 1.2 2.7 ± 0.5

9.6 ± 0.5 17.9 ± 1***

1.2 ± 1.9 3.3 ± 0.6

13.3 ± 0.5 7.5 ± 0.8***

16.7 ± 7.1 33.3 ± 5

100 ± 0 100 ± 0

100 ± 0 100 ± 0***

mT 2.2 mT 4.4

0.7 ± 0.7 5.8 ± 2.6*

11.2 ± 0.7 15.7 ± 0.8**

2.5 ± 1.5 1.3 ± 1.1

10.3 ± 0.6 9.7 ± 0.6**

0±0 16.7 ± 7.1*

83.3 ± 4.5 100 ± 0**

100 ± 0 100 ± 0

91.7 ± 2.1 100 ± 0**

mT 8.9 TDZ 0.4

3.7 ± 1.4 1.8 ± 1.3

12.8 ± 2.5 10 ± 1

3.1 ± 1.5 2.2 ± 1.4

9.1 ± 1 11.3 ± 0.4

0±0 50 ± 7.1

83.3 ± 2.8 100 ± 0

100 ± 0 100 ± 0

100 ± 0 100 ± 0

TDZ 1.1 TDZ 2.2

0.3 ± 1 7.5 ± 4**

4.2 ± 2.9 3.1 ± 1.8

1.2 ± 2.2 2.4 ± 1.5

4.1 ± 2.4 5.7 ± 1.9

16.7 ± 7.1 100 ± 0**

100 ± 0 100 ± 0

100 ± 0 100 ± 0

100 ± 0 100 ± 0


7.2 ± 1.9** 8.5 ± 0.2** 0±0

4.5 ± 2.2 0±0 5.6 ± 0.9

2.7 ± 0.6 2.3 ± 1.2 0±0

6.1 ± 1.5 0±0 15.6 ± 0.7

50 ± 7.1** 100 ± 0** 16.7 ± 7.1

100 ± 0 100 ± 0 33.3 ± 4.5

83.3 ± 3.2 83.3 ± 3.2 100 ± 0

100 ± 0 100 ± 0 100 ± 0


TDZ has also become a more commonly used PGR in the last two decades, both for its cytokinin- and auxin-like effects (Guo et al. 2011). Its potential for use in the in vitro propagation of cacti has been little explored (Lema-Rumińska and Kulus 2014). In the present study, TDZ significantly increased the shoot proliferation; however, callus production and hyperhydricity were also observed. A similar effect has been reported in other cacti such as Escobaria minima, M. pectinifera, Pelecyphora aselliformis (Giusti et al. 2002), P. strobiliformis, and P. aselliformis (Pérez-Molphe-Balch and Dávila-Figueroa 2002).

(20, 42) = 2.96,

8.3 ± 7.1 8.3 ± 7.1

Apical

25 ± 8.4 75 ± 4.8***


(20, 105) = 21.3,

R2 = 0.76. Level of

Our results show that the use of different cytokinins and explants allows the best option for the development of successful in vitro propagation protocols. mT and TDZ provide viable options for the rapid multiplication of Mammillaria species, and we suggest expanding their use in more species of this genus, as well as exploring their effects on other cacti. The wild plants of M. hernandezii, M. dixanthocentron, and M. lanata are potentially reproductive when they are 2 or 3 yr old (Mandujano-Sánchez 2003; Rodríguez-Ortega et al. 2006; Ureta and Martorell 2009; Arias et al. 2012).

Table 5. Shoot regeneration from lateral explants during consecutive cycles of propagation in vitro, from the best induction treatments of each species of Mammillaria Treatment

M. hernandezii M. dixanthocentron M. lanata ± standard error

mT 2.2 μM mT 1.1 μM mT 1.1 μM

Cycle 1

Cycle 2

Cycle 3

Shoots per explant

Callus (%)

Shoots per explant

Callus (%)

Shoots per explant

Callus (%)

4.4 ± 1.5 15 ± 2.3 17 ± 1.7

20 ± 16 10 ± 1.1 30 ± 5.2

7.1 ± 0.7 13.2 ± 2.5 15.1 ± 4.1

10 ± 6 20 ± 10 40 ± 15

10.1 ± 2.6 12.5 ± 1.7 16.8 ± 2.5

40 ± 17 50 ± 15 50 ± 5.5

bp base pairs, N/A no amplification

M. lanata

M. dixanthocentron

MamVTC1 MamVTC2 MamVTC5 MamVTC8 MamVTC9 MamVTC10 MamVTC11 MamVTC12 MamVTC14 Total Mean MamVTC1 MamVTC2 MamVTC5 MamVTC8 MamVTC9 MamVTC10 MamVTC11 MamVTC12 MamVTC14 Total Mean MamVTC1 MamVTC2 MamVTC5 MamVTC8 MamVTC9 MamVTC10 MamVTC11 MamVTC12 MamVTC14 Total Mean

Locus

N/A 185–197 162–171 171–180 171 134–158 222–230 229–242 175 134–242

N/A 187–189 223–231 170–228 92–170 123–157 228–244 233–252 175 92–252

N/A 196–201 107–232 164–175 171 93–159 N/A 244–248 175 93–248

Allele size range (bp)

5 2 6 1 10 5 5 1 35

2 1 4 0 2 4 2 0 15

0 1 1 0 5 1 1 0 9

0 0 4

3 1 42

2 5 5 3 10 5 4 1 35

0 1 1 0 2

6 15 5 1 11

0.15

0.12 0.15 0.32 0.00 0.11 0.29 0.17 0.00

0.10

0.00 0.11 0.06 0.00 0.32 0.11 0.19 0.00

0.04

0.00 0.00

0.00 0.04 0.11 0.00 0.12

5 2 6 1 10 5 5 1 35

2 5 5 3 10 5 4 1 35

3 1 42

6 15 5 1 11

Number of alleles

PIC

Number of alleles

Polymorphic alleles

Cycle 2

Cycle 1

2 1 2 0 2 3 1 0 12

0 1 2 2 5 1 1 0 12

0 0 4

0 1 1 0 2

Polymorphic alleles

0.12

0.26 0.23 0.18 0.00 0.06 0.18 0.06 0.00

0.15

0.00 0.17 0.26 0.20 0.31 0.15 0.14 0.00

0.02

0.00 0.00

0.00 0.05 0.06 0.00 0.06

PIC

5 2 6 1 10 5 5 1 35

2 5 5 3 10 5 4 1 35

3 1 42

6 15 5 1 11

Number of alleles

Cycle 3

0 1 1 0 4 3 0 0 9

0 1 2 0 5 1 1 0 10

0 0 6

0 2 1 0 3

Polymorphic alleles

0.08

0.00 0.24 0.04 0.00 0.12 0.20 0.00 0.00

0.13

0.00 0.10 0.37 0.00 0.39 0.05 0.12 0.00

0.04

0.00 0.00

0.00 0.08 0.10 0.00 0.13

PIC

Genetic stability of the in vitro-propagated material during consecutive culture cycles in the best induction treatments: M. hernandezii 2.2 μM mT and M. dixanthocentron and M. lanata 1.1 μM

M. hernandezii

Table 6. mT

526 LÁZARO-CASTELLANOS ET AL.


527

Figure 3. UPGMA dendrogram of intra-clonal genetic similarity based on Jaccard’s coefficient. Donor plant of M. hernandezii (HT), plants of the first culture cycle (H11–15), plants of the second cycle (H21–25), and plants of the third cycle (H31–36). Donor plant of M. dixanthocentron

(DT), first culture cycle (D11–15), second cycle (D21–25), and third cycle (D31–36). Donor plant of M. lanata (LT), first cultivation cycle (L11–15), second cycle (L21–25), and third cycle (L31–36).

The accelerated development of plants propagated in vitro observed in these experiments allowed the plants to begin the reproductive stage significantly sooner. In wild populations of M. hernandezii and M. dixanthocentron, young and potentially reproductive plants have higher mortality rates; Ureta and Martorell (2009) suggested implementing measures that target the survival of this cohort, to avoid loss of genetic variation over time. The protocols reported here allowed us to obtain a large number of reproductive plants in a short period and as such can be implemented for the production of germplasm in future management plans and conservation of these species.

periods of cultivation (Zoghlami et al. 2012). Likewise, Huang et al. (2009) reported genetic similarity levels of 92 to 100% in in vitro-propagated plants of Platanus acerifolia, allowing the maintenance of a genetically stable production line. In M. dixanthocentron and M. lanata, a maximum PIC value of 0.15 was obtained. According to Botstein et al. (1980), PIC values < 0.25 are considered only Bslightly informative,^ and as such are inadequate for the detection of potential genetic instability. Values in the range of 0.25– 0.50 are viewed as Bacceptable polymorphism^; with them, it is possible to detect intra-clonal genetic variation. For example, in Pistacia vera plants propagated in vitro for 7 yr, PIC values between 0.20 and 0.36 were recorded, so the germplasm was determined to be genetically unstable (Akdemir et al. 2016). The greatest PIC values obtained in this study were seen in the MamVTC8, MamVTC9, MamVTC10, and MamVTC11 loci, which are composed of repeated units of two nucleotides. This characteristic has been shown to be related to increases in polymorphism, compared with loci of three or four repeated nucleotides (Smith et al. 1997). Therefore, it is likely that this contributed to the observed increase in polymorphism.

Genetic stability The use of exogenous PGRs for regeneration of plant tissue has been shown to be correlated with the loss of morphogenetic potential over successive regeneration cycles (Chaturvedi and Jain 1994). In contrast, we observed high shoot multiplication rates throughout all regeneration cycles, particularly for treatments containing mT. In addition, M. hernandezii plants had low intra-clonal polymorphism rates, and genetic similarity analysis revealed a relationship greater than 95% among all individuals tested. Similar genetic stability values have been reported in Opuntia ficus-indica after long

528


Genetic similarity values for M. dixanthocentron and M. lanata (86 to 100%) showed a greater range of variation than that for M. hernandezii; however, Skirvin et al. (1994) concluded that plants propagated in vitro with genetic similarity values of 80 to 100% are genetically stable. We suggest that the genetic variation found in M. dixanthocentron and M. lanata reflects the adaptation to the stress of in vitro conditions, as proposed by Marum et al. (2009) with Pinus pinaster somatic embryogenesis systems.

Conclusions The protocols for in vitro propagation that we report here constitute an alternative and viable system for rapid clonal multiplication of these species, while maintaining a high degree of genetic stability and reproductive potential. In addition, they represent a starting point for the generation of germplasm banks, which could be used to support conservation and management efforts of these endangered and endemic species. These techniques can also be used to help satisfy commercial demands, which will reduce some of the pressure on wild populations of Mammillaria. Cytokinins mT and TDZ are alternative options for the rapid multiplication of Mammillaria species. Acknowledgements The authors would like to thank Jerónimo Reyes (UNAM) for providing the seeds of M. hernandezii and to Pamela Moon (TREC, University of Florida) and Victor Steinman (Rancho Santa Ana Botanic Garden) for their constructive comments and language corrections. The authors also express their gratitude to two anonymous reviewers for their valuable comments and corrections to improve the original manuscript. This study was supported by the Consejo Nacional de Ciencia y Tecnología (CONACYT, 280455) and Instituto de Ecología A.C. (INECOL, 2003010806 MMR).

References Akdemir H, Suzerer V, Tilkat E, Onay A, Ozden Y (2016) Detection of variation in long-term micro propagated mature pistachio via DNAbased molecular markers. Appl Biochem Biotechnol 180:1301– 1312 Amoo SO, Finnie JF, Van Staden J (2011) The role of meta-topolins in alleviating micropropagation problems. Plant Growth Regul 63: 197–206 Aremu A, Bairu M, Dolezal K, Finnie JF, Van Staden J (2012) Topolins: a panacea to plant tissue culture challenges? Plant Cell Tissue Organ Cult 108:1–16 Arias S, Gama-López S, Guzmán-Cruz U, Vázquez-Benítez B (2012) Flora del Valle de Tehuacán-Cuicatlán. Fascículo 95. Instituto de Biología UNAM, México ISBN 978-607-02-3079-0 Aversano R, Di Dato F, Di Matteo A, Frusciante L, Carputo D (2011) AFLP analysis to assess genomic stability in Solanum regenerants derived from wild and cultivated species. Plant Biotech Rep 5:265– 271 Bairu M, Novak O, Dolezal K, Van Staden J (2011) Changes in endogenous cytokinin profiles in micropropagated Harpagophytum

procumbens in relation to shoot-tip necrosis and cytokinin treatments. Plant Growth Regul 63:105–114 Bairu M, Stirk W, Dolezal K, Van Staden J (2007) Optimizing the micropropagation protocol for the endangered Aloe polyphylla: can meta-topolin and its derivatives serve as replacement for benzyladenine and zeatin? Plant Cell Tissue Organ Cult 90:15–23 Botstein D, White R, Skolnick M, Davis R (1980) Construction of a genetic linkage map using restriction fragment length polymorphisms. Am J Hum Genet 32:314–331 Butterworth C, Wallace R (2004) Phylogenetic studies of Mammillaria (Cactaceae)—insights from chloroplast sequence variation and hypothesis testing using the parametric bootstrap. Am J Bot 91(7): 1086–1098 Chaturvedi H, Jain M (1994) Restoration of regeneration potentially in prolonged culture of Digitalis purpurea. Plant Cell Tissue Organ Cult 38:73–75 Civatti L, Marchi M, Schnadelbach A, Bellintani M (2017) In vitro multiplication and genetic stability of two species of Micranthocereus Backeb. (Cactaceae) endemic to Bahia, Brazil. Plant Cell Tissue Organ Cult 131:537–545 Clayton P, Hubstenberger J, Phillips G (1990) Micropropagation of members of the Cactaceae subtribe Cactinae. J Am Soc Hortic Sc 115: 337–343 Crawley J (2007) The R book. John Wiley & Sons Ltd, England De Medeiros L, De Ribeiro R, Gallo L, De Oliveira E, Dematte M (2006) In vitro propagation of Notocactus magnificus. Plant Cell Tissue Organ Cult 84:165–169 Engelmann F (2011) Use of biotechnologies for the conservation of plant biodiversity. In Vitro Cell Dev Plant 47:5–16 García-Rubio O, Malda-Barrera G (2010) Micropropagation and reintroduction of the endemic Mammillaria mathildae (Cactaceae) to its natural habitat. Hortscience 45:934–938 Giusti P, Vitti D, Fiocchetti F, Colla G, Saccardo F, Tucci M (2002) In vitro propagation of three endangered cactus species. Sci Hortic 95:319–332 Guo B, Abbasi B, Zeb A, Xu L, Wei Y (2011) Thidiazuron: a multidimensional plant growth regulator. Afr J Biotechnol 10:8984–9000 Hazarika B (2006) Morpho-physiological disorders in in vitro culture of plants. Sci Hortic 108:105–120 Hazubska-Przybył T, Chmielarz P, Michalak M, Dering M, Bojarczuk K (2012) Survival and genetic stability of Picea abies embryogenic cultures after cryopreservation using a pregrowth-dehydration method. Plant Cell Tissue Organ Cult 113:303–313 Huang W, Ning G, Liu G, Bao M (2009) Determination of genetic stability of long-term micropropagated plantlets of Platanus acerifolia using ISSR markers. Biol Plant 53:159–163 IUCN (2016) Red list of threatened species version 2016-1. www. iucnredlist.org. Downloaded on 21 May 2016 Kasthurirengan S, Xie L, Li C, Fong Y, Hong Y (2013) In vitro propagation and assessment of genetic stability of micropropagated Samanea saman (rain tree) using microsatellite markers. Acta Physiol Plant 35:2467–2474 Larkin P, Scowcroft N (1981) Somaclonal variation—a novel source of variability from cell for plant improvement. Theor Appl Genet 60: 197–214 Lema-Rumińska J, Kulus D (2014) Micropropagation of cacti—a review. Haseltonia 19:46–63 Li Y, Korol A, Fahina T, Nevo E (2004) Microsatellites within genes: structure, function, and evolution. Mol Biol Evol 21:991–1007 Lopes T, Capelo A, Brito G, Loureiro J, Santos C (2009) Genetic variability analyses of the somatic embryogenesis induction process in Olea spp. using nuclear microsatellites. Trees 23:29–36 Mandujano-Sánchez MC (2003) Mammillaria hernandezii. Clasificación de tres especies endémicas de Mammillaria. PROY-NOM-ECOL059-2000. Departamento de Ecología Evolutiva, Instituto de Ecología, Universidad Nacional Autónoma de México. Bases de

IN VITRO PROPAGATION OF MAMMILLARIA datos SNIBCONABIO. ProyectoW031. México. D.F. http://www. conabio.gob.mx/conocimiento/ise/fichasnom/ Mammillariahernandezii00.pdf Martorell C, Peters E (2005) The measurement of chronic disturbance and its effects on the threatened cactus Mammillaria pectinifera. Biol Conserv 124:199–207 Marum L, Rocheta M, Maroco J, Oliveira M, Miguel C (2009) Analysis of genetic stability at SSR loci during somatic embryogenesis in maritime pine (Pinus pinaster). Plant Cell Rep 28:673–682 Moyo M, Finnie JF, Van Staden J (2012) Topolins in Pelargonium sidoides micropropagation: do the new brooms really sweep cleaner? Plant Cell Tissue Organ Cult 110:319–327 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plant 15:473–497 Nayak S, Kaur S, Mohanty G, Ghosh R, Choudhury L, Acharya, Subudhi E (2011) In vitro and ex vitro evaluation of long-term micropropagated turmeric as analyzed through cytophotometry, phytoconstituents, biochemical and molecular markers. Plant Growth Regul 64:91–98 Ortega-Baes P, Godínez-Alvarez H (2006) Global diversity and conservation priorities in the Cactaceae. Biol Conserv 15:817–827 Pérez-Molphe-Balch E, Dávila-Figueroa C (2002) In vitro propagation of Pelecyphora aselliformis Ehrenberg and P. strobiliformis Werdermann (Cactaceae). In Vitro Cell Dev Plant 38:73–78 Pérez-Molphe-Balch E, Reyes M, Amador E, Rangel E, Ruiz L, Viramontes H (1998) Micropropagation of 21 species of Mexican cacti by axillary proliferation. In Vitro Cell Dev Plant 34:131–135 Pérez-Molphe-Balch E, Santos-Díaz M, Ramírez-Malagón R, OchoaAlejo N (2015) Tissue culture of ornamental cacti. Sci Agric 72: 540–561 Ramírez-Malagon R, Aguilar-Ramírez I, Borodanenko A, Pérez-Moreno L, Barrera-Guerra J, Nuñez-Palenius H, Ochoa-Alejo N (2007) In vitro propagation of ten threatened species of Mammillaria (Cactaceae). In Vitro Cell Dev Plant 43:660–665 R Core Team (2017) R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org Rodríguez-Ortega C, Franco M, Mandujano M (2006) Serotiny and seed germination in three threatened species of Mammillaria (Cactaceae). Basic App Eco 7:533–544

529

Rohlf FJ (1998) NTSYS-pc-numerical taxonomy and multivariate analysis system. Exeter Software, Setauket Rubluo A (1997) Micropropagation in Mammillaria. In: Bajaj YPS (ed) Biotechnology in agriculture and forestry. High techniques and micropropagation, vol. VI. Springer, Berlin, pp 193–205 Rubluo A, Marín-Hernández T, Duvala K, Vargas A, Márquez-Guzmán J (2002) Auxin-induced morphogenetic responses in long-term in vitro subcultured Mammillaria san-angelensis Sánchez-Mejorada (Cactaceae). Sci Hortic 95:341–349 Singh S, Dalal S, Singh R, Dhawan A, Rajwant K (2013) Evaluation of genetic fidelity of in vitro raised plants of Dendrocalamus asper (Schult & Schult) Backer ex K. Heyne using DNA-based markers. Acta Physiol Plant 35:419–430 Skirvin R, McPheeters K, Norton M (1994) Sources and frequency of somaclonal variation. Hortic Sci 29:1232–1237 Smith J, Chin E, Shu H, Smith O, Wall S, Senior M, Mitchell S, Kresovich S, Ziegle J (1997) An evaluation of the utility of SSR loci as molecular markers in maize (Zea mays L.): comparisons with data from RFLPs and pedigree. Theor Appl Genet 95:163–173 Solórzano S, Cortés-Palomec A, Ibarra A, Dávila P, Oyama K (2009) Isolation, characterization and cross-amplification of polymorphic microsatellite loci in the threatened endemic Mammillaria crucigera (Cactaceae). Mol Ecol Resour 9:156–158 Sriskandarajah S, Prinsen E, Motyka V, Dobrev P, Serek M (2006) Regenerative capacity of cacti Schlumbergera and Rhipsalidopsis in relation to endogenous phytohormones, cytokinin oxidase/dehydrogenase, and peroxidase activities. Plant Growth Regul 25:79–88 Tiwari J, Chandel P, Gupta S, Gopal J, Singh B, Bhardwaj V (2013) Analysis of genetic stability of in vitro propagated potato microtubers using DNA markers. Physiol Mol Biol Plants 19:587– 595 Ureta C, Martorell C (2009) Identifying the impacts of chronic anthropogenic disturbance on two threatened cacti to provide guidelines for population-dynamics restoration. Biol Conserv 142:1992–2001 Zoghlami N, Bouamama B, Khammassi M, Ghorbel A (2012) Genetic stability of long-term micropropagated Opuntia ficus-indica (L.) Mill. plantlets as assessed by molecular tools: perspectives for in vitro conservation. Ind Crop Prod 36:59–56