Increased DNA methyltransferase expression in leukaemia - Nature

Leukemia (1998) 12, 311–316  1998 Stockton Press All rights reserved 0887-6924/98 $12.00

Increased DNA methyltransferase expression in leukaemia JR Melki1, P Warnecke1, PC Vincent1 and SJ Clark1,2 1

Kanematsu Laboratories, Royal Prince Alfred Hospital, Camperdown; and 2CSIRO, Division of Biomolecular Engineering, Sydney Laboratory, North Ryde, NSW, Australia

Aberrant DNA methylation has been observed consistently in many human tumours, in particular in the CpG islands of tumour suppressor genes, but the underlying mechanism of these changes remains unclear. To determine whether DNA methyltransferase expression is increased in leukaemia, we developed a standarised competitive RT-PCR assay to measure the level of DNA methyltransferase transcripts. Using this assay on bone marrow RNA samples from 12 patients with acute leukaemia, we observed a 4.4-fold mean increase in the level of DNA methyltransferase mRNA compared with normal bone marrow. These results support but do not prove the hypothesis that an increase in DNA methyltransferase activity is associated with malignant haematological diseases and may constitute a key step in carcinogenesis. Keywords: DNA methyltransferase; leukaemia; competitive RTPCR; DNA methylation

Introduction Tissue-specific methylation patterns are established early in development by a combination of demethylation and de novo methylation of cytosine residues, predominantly at CpG dinucleotides. The methylation pattern is stably maintained through subsequent cell divisions by the action of a DNA methyltransferase (DNA MTase) enzyme.1 The DNA MTase gene has been cloned and characterised but it still is unclear whether there is only a single enzyme responsible for both de novo and maintenance methylation activities in the cell.2 In vitro studies have shown that the intact DNA MTase enzyme favours maintenance methylation activities because of its strong substrate preference for hemimethylated DNA.3 However, in vitro cleavage of the N-terminal domain greatly increases the de novo activity of DNA MTase.4 In cancer cells, the DNA methylation pattern undergoes widespread alterations with both generalised hypomethylation and regional hypermethylation (reviewed in Refs 5–7). In particular, aberrant methylation has been noted in the CpGrich promoter regions of many tumour suppressor genes in cancer cells and is often associated with inactivation of these genes.8–12 The mechanism responsible for aberrent methylation patterns is unknown, but there is mounting evidence to support a fundamental role for the increased activity of the DNA MTase enzyme in the initiation and progression of cancer. In immortalised or malignant cells in culture the activity of DNA MTase is substantially higher than nontransformed cells.13 In addition, overexpression of DNA MTase in NIH 3T3 cells and IMR90/SV40 fibroblasts results in cellular transformation and substantial de novo methylation of CpG islands respectively,14,15 whereas tumorigenesis of adrenocortical Y1 cells is inhibited by antisense oligonucleotides to DNA MTase mRNA.16 Moreover, lowering DNA MTase activity in mice that are genetically predisposed to formation of colonic adenCorrespondence: SJ Clark, CSIRO Division of Biomolecular Engineering, Sydney Laboratory, PO Box 184, North Ryde, NSW 2113, Australia; Fax: 612 94905005 Received 10 June 1997; accepted 20 November 1997

omas has been shown to markedly decrease the frequency of colon tumours.17 The overproduction of DNA MTase may also be linked with an increased rate of C to T mutations often found in tumour genes.18,19 Expression of DNA MTase has been extensively studied in colon cancer and it has been proposed that increased expression may be associated with altered DNA methylation patterns.20 DNA MTase activity has been shown to increase progressively with advancing stages of both human colon and lung cancer.21,22 Elevated levels of DNA MTase mRNA transcripts have been reported in colon cancer when compared to normal colon mucosa. Using non-quantitative reverse transcription RT-PCR assay, a 200-fold increase in DNA MTase mRNA levels was reported comparing colon cancers to normal mucosa,20 whereas increases of 3.7- and 2.5-fold were found in later studies using quantitative RT-PCR23 and RNAase protection assays,24 respectively. DNA methylation patterns are known to be altered in a large number of genes in haematological malignancies.25–28 Perhaps the best studied gene is the calcitonin gene which becomes hypermethylated during the progression of chronic myeloid leukaemia (CML)29 and is methylated extensively in acute lymphomas, chronic lymphoblastic leukaemias (CLL),30,31 and in myelodysplastic syndrome (MDS).32,33 Aberrant methylation of the CpG island spanning the promoter of the p15 tumour suppressor gene is linked with p15 inactivation in at least half of the acute lymphoblastic leukaemias (ALL) and acute myeloid leukaemias (AML).12 The oestrogen receptor gene is also extensively methylated in acute leukaemias, CMLs and lymphomas, whereas the gene is essentially unmethylated in normal haematopoietic cells.34 In contrast, the Bcl-2 gene is hypomethylated in essentially all B cell CLL patients and is associated with an increase in Bcl-2 protein expression.35 Despite the abundance of evidence indicating an important role of methylation in leukaemia, mRNA expression levels of the DNA MTase gene have not previously been measured. In this study we have developed a standardised competitive RT-PCR to determine whether DNA MTase expression is increased in leukaemia and linked to methylation changes in leukaemia. We compared DNA MTase mRNA levels in bone marrow samples from 12 leukaemic patients to levels in normal bone marrow and found elevated DNA MTase expression in all leukaemic samples.

Materials and methods

Leukaemic samples Bone marrow aspirates from 12 patients with leukaemia (nine males, three females) were assayed for DNA MTase expression (Table 1). Control samples of normal bone marrow were aspirated from the sternal cavity from six patients who were undergoing cardiac surgery and who had given prior

DNA methyltransferase in leukaemia JR Melki et al

312

Table 1

Profile of leukaemic and normal patients

Sample No. 14 28 36 37 38 39 60 61 62 94 99 105 N33 N34 N35 N40 N46 N47

Age/Sex

Leukaemia (FAB)

36/M 44/F 80/M 24/M 46/F 71/M 30/F 41/M 73/M 40/M 59/M 54/M 69/M 70/M 74/M 62/M 19/M 63/M

AML M4 Eo ALL AML M2 AML M4E0 AML MDS RAEB-T AML M3 ALL L3a AML M3 AML M2b AML AML Normal Normal Normal Normal Normal Normal

Sample No. indicates laboratory reference number, FAB defines the sub-type of leukaemia. a Burkitt’s lymphoma. b Transformed from a CML.

informed consent. The study was approved by the Ethics Committee of RPAH (Protocol number X93-0073).

RNA and DNA isolation RNA and DNA were isolated using TriZOL Reagent (GibcoBRL from Life Technologies, Gaithersburg, MD, USA) from bone marrow cells which had been lysed in hypotonic lysis buffer.

Reverse transcription cDNA was reverse transcribed from 2 ␮g of total RNA in a 25 ␮l reaction containing 40 mM Tris-HCl pH 8.0, 75 mM KCl, 10 mM MgCl2, 2 mM DTT, 500 ␮M dNTPs and 300 ng random hexamers (Boehringer Mannheim, Mannheim, Germany), by heating to 75°C for 2 min, chilling, adding 40 U RNasin (Promega, Madison, WI, USA) and 50 U AMV reverse transcriptase (Promega) and incubating at 44°C for 1 h.

Standardised competitive RT-PCR The primers and competitor DNAs used in the amplification are listed in Table 2. The actin competitive plasmid was preTable 2

Gene Actin MTase

pared by cloning the 71 bp Sau3A pBluescript SK fragment into the BglII site of a 231 bp aortic smooth muscle actin PCR product amplified from K562 cell line DNA (Table 2), previously cloned into a pXT vector.36 The DNA MTase competitor was prepared by cloning a 125 bp HindIII fragment from lambda DNA into the HindIII site of the 335 bp DNA MTase PCR fragment amplified from K562 cell line DNA (Table 2), previously cloned into a pXT vector. Final conditions for competitive PCR reactions, performed in 25 ␮l volumes were 200 ␮M dNTPs, 100 ng primers, 1.5 mM MgCl2, 1.0 ␮Ci 32P␣ dATP, and 1 unit AmpliTaq DNA polymerase (Perkin-Elmer, Norwalk, CT, USA) with the appropriate amount of competitor DNA and 1 ␮l cDNA. Reactions were performed in a Hybaid DNA thermal cycler (Hybaid, Teddington, UK) under the following conditions: 96°C/4 min × 1; 95°C/45 s, 60°C/90 s, 72°C/90 s × 5; 95°C/30 s, 61°C/55 s, 72°C/55 s × 22 cycles. Products were electrophoresed on a 6% polyacrylamide gel, dried, and exposed to a phosphorimager (Molecular Dynamics, Sunnyvale, CA, USA) and quantitated using ImageQuant Software version 3.3 (Molecular Dynamics). To standardise reaction conditions for each sample and between samples, a competitive RT-PCR assay was developed in which all competitor dilutions were determined exactly by weight and all reactions were aliquoted from a bulk pre-mix as follows: a bulk pre-mix sufficient for 600 reactions was prepared which contained reaction buffer, nucleotides and Taq polymerase. This pre-mix was split into two, actin primers added to one half and DNA MTase primers to the other. Each of these primer-specific pre-mixes was further split into six aliquots and different levels of the appropriate competitor plasmid added as indicated below. These final pre-mixes which contained all components but the cDNA were individually aliquoted (50 aliquots each) and stored at −20°C until required. Reactions were initiated by addition of aliquots of cDNA reaction to the pre-mix and PCR amplifications done as above. The competing plasmid dilution series was determined exactly by weight using a Mettler analytical balance in approximately three-fold consecutive dilutions and added to the pre-mix as follows: actin plasmid, the level per reaction was 6.21 pg, 2.05 pg, 676 fg, 216 fg and 73.6 fg. DNA MTase plasmid, the level per action was 344 fg, 114 fg, 37.5 fg, 12.4 fg and 4.08 fg.

Results

DNA methyltransferase RT-PCR assay Since DNA MTase is expressed only at low levels in normal cells and a small change in expression in leukaemia may be important in the development of malignancy, we chose to develop a standardised competitive quantitative RT-PCR assay

Primer sequences for standardised competitive RT-PCR

Primers P11: 5′ATCCTGACCCTGAAGTACCC P12: 5′CAGCACCGCCTGGATAGCCACATACATGGC P9: 5′AC CGCTTCTACTTCCTCGAGGCCTA P10: 5′GTTGCAGTCCTCTGTGAACACTGTGG

Coordinates

Target size bp

Competitor size

216–235 102–131 3077–3102 3386–3412

231

302

335

460

Primer coordinates give the nucleotide positions within actin exon 1 (Accession No. K01742), actin exon 4 (K01744) and DNA MTase (X01744). The primers are designed to cross introns and therefore only amplify cDNA. Target size refers to the PCR product from cDNA. Competitor size refers to the PCR product from the competitor construct.


to ensure an accurate estimate of expression. In order to ensure precise estimation of competing DNA and thus minimise pipetting errors, the plasmid competitor dilution was determined by weight. This approach combined with standardised pre-mixes gave reproducible results in quantitation of the target sequence within and between samples. We found this method to be highly reproducible in comparison to other competitive RT-PCR methods which can be inconsistent as the cDNA and competitor DNA are often unstable. An example of a standardised competitive RT-PCR quantitation for DNA MTase with actin as an internal control is shown in Figure 1a. Densitometer quantitation of the target and competitor PCR fragments was determined for each dilution and the logarithm of the ratio of the target to competitor was plotted against the logarithm of the initial molar amount of added competitor (Figure 1b). The estimated amount of target cDNA was calculated by regression analysis of the log of the competitor over target ratio and the derived equation was solved for x when y = 0, that is when there was equimolar amounts of target and competitor. Determination

by weight of the amount of competitor added to each reaction results in the derived equation being linear with a high R2 value, as shown in Figure 1b.

DNA methyltransferase expression Twelve bone marrow aspirates from patients with leukaemia and six normal bone marrow aspirates were assayed for DNA MTase mRNA expression by competitive RT-PCR, using actin as an internal standard (Figure 2). DNA MTase expression was elevated in all samples from leukaemic patients, regardless of age, sex or subtype. Patient 99 (AML) shows the highest level of DNA MTase mRNA expression which is 10.1-fold higher than the mean expression in normal bone marrow. Patient 60 (AML) shows the lowest level of expression, but is still 2.5-fold higher than the mean expression in normal cells. The average mRNA expression levels for DNA methyltransferase are increased 4.4-fold as compared to the average expression in normal bone marrow (P ⬍ 0.0001, by Mann–Whitney two-

Figure 1 Example of standardised competitive RT-PCR from patient 38. (a) Inverted phosphorimage of a polyacrylamide gel containing RTPCR reactions with constant cDNA and competitor DNA serially diluted in approximately three-fold amounts. Actin, lanes (a–e); DNA MTase, lanes (g–k); lane f and l, no competitor added; *, heteroduplex of target and competitor amplicons. As the heteroduplex is comprised of equimolar amounts of target and competitor it was not quantitated. (b) Regression analysis of the logarithm of the ratio of competitor:target (C/T) against the logarithm of competing molecules added. Target cDNA was estimated by solving for x when y = 0.

313


314

Figure 2 DNA MTase mRNA levels for bone marrow from leukaemic and normal patients. DNA MTase mRNA levels were determined by standardised competitive RT-PCR. The mean of transcription from bone marrow samples of leukaemic patients was calculated to be 0.214, and the mean for the normal bone marrow samples was calculated to be 0.049.

tailed unpaired test). DNA MTase expression is also increased in HL60 and K562 cells to a level similar to that found in the bone marrow cells from leukaemic patients (data not shown). Discussion In this study, we demonstrate for the first time that the average expression of DNA methyltransferase mRNA from the bone marrow cells of leukaemic patients is elevated 4.4-fold, compared with expression from normal bone marrow. DNA MTase expression has been assayed previously in lung, liver and colon tumour samples using a wide range of methods, including protein-based assays21,22 and RNA-based assays20,22–24,37 and the results obtained have been variable. However, in this study we developed a standardised competitive RT-PCR assay which enabled accurate measurement of DNA MTase mRNA expression within and between samples. Early studies using a nonquantitative RT-PCR assay20 reported a 200-fold increase in DNA MTase expression for colon cancer compared with normal mucosa, whereas using semiquantitative RT-PCR assays, 18-fold increases were reported.21 Our results of elevated DNA methyltransferase levels in leukaemia are similar to studies in colon cancer that have used quantitative RT-PCR assays, where an average of 3.7-fold23 and 2.6-fold24 increases in DNA MTase transcripts were reported when normalised with GAPDH. Lee et al24 also found that the level of DNA MTase expression in colon cancer was 1.8-fold higher when normalised to actin, however, no significant elevation was detected when normalised to histone H4. Therefore these authors argue that the observed increased in DNA MTase expression was simply a reflection of the increase in cell proliferation in colon tumour cells. All quantitation analyses are dependent upon which gene

is selected to normalise against the integrity of the starting RNA, and in the past actin and GAPDH have been used as standards as these proteins are thought to be ubiquitously expressed in all tissues. It is becoming increasingly clear that even the use of housekeeping genes can present problems as standards because their expression may vary under certain conditions.38 This could be particularly relevant in tumour cells, where multiple genetic lesions are responsible for the development of the disease. However, it is unlikely that the 4.4-fold increase in DNA MTase mRNA levels in leukaemic cells, observed in this study, is the result of an equivalent increase in tumour cell proliferation. Leukaemic cells are predominantly dispersed in G1, which means that most are in cycle despite the fact that the mitotic index and the proportion of cells in S phase are decreased.39–41 This could be an important difference when compared with normal counterparts and could be related to the increase in DNA MTase levels. It is difficult to isolate immature blast cells from bone marrow at an equivalent stage of differentiation to the leukaemic blast cell. Nethertheless, it is clear that DNA MTase levels are elevated in leukaemic bone marrow cells relative to normal differentiated cells. An increased expression of DNA MTase in leukaemia could be important in leukaemogenesis. The 4.4-fold average increase in DNA methyltransferase expression in leukaemia is greater than the 2.2-fold average increase in expression of DNA methyltransferase that was shown to be associated with transformation of NIH 3T3 fibroblasts.14 Moreover, IMR90/ SV40 cells which expressed an average of nine-fold increased DNA MTase activity were significantly hypermethylated at CpG island sequences. An increase in DNA MTase activity may also be associated with hypomethylation in cancer cells and be linked with an increased rate of deletions and rearrangements often observed in leukaemia. A recent study


shows that genome-wide strand break accumulation was associated with progressive genomic hypomethylation and increased DNA MTase activity.42 In addition, T cell receptor-␤ chain rearrangements always occur on the allele that contains hypomethylated sequences in AML and ALL patients, whereas the germline allele is completely methylated.43 The results presented here show an increase in the average levels of DNA methyltransferase mRNA in leukaemia, consistent with the increased levels of transcription previously reported for colon and lung cancers. Such an association between elevation of DNA MTase levels and aberrant methylation patterns observed in leukaemia suggests a link between the regulation of DNA MTase expression and the onset and progression of cancer.

14

15

16 17 18

Acknowledgements We thank Clare Stirzaker for help in preparation of some of the RNA samples and in initial RT-PCR experiments. We thank Drs Robin Holliday and Peter Molloy for critical reading of the manuscript. This work was supported by the Anthony Rothe Memorial Trust. JRM is funded by an Anthony Rothe scholarship.

References 1 Holliday R. Epigenetic inheritance based on DNA methylation. In: Jost JP, Saluz HP (eds). DNA Methylation: Molecular Biology and Biological Significance. Birkhauser Verlag: Basel, 1993, pp 452– 468. 2 Bestor TH. Cloning of a mammalian DNA methyltransferase. Gene 1988; 74: 9–12. 3 Gruenbaum Y, Cedar H, Razin A. Substrate and sequence specificity of a eukaryotic DNA methylase. Nature 1982; 295: 620–622. 4 Bestor TH. Activation of mammalian DNA methyltransferase by cleavage of a Zn binding regulatory domain. EMBO J 1992; 11: 2611–2617. 5 Baylin SB, Makos M, Wu JJ, Yen RW, deBustros A, Vertino P, Nelkin BD. Abnormal patterns of DNA methylation in human neoplasia: potential consequences for tumor progression. Cancer Cells 1991; 3: 383–390. 6 Laird PW, Jaenisch R. DNA methylation and cancer. Hum Mol Genet 1994; 3: 1487–1495. 7 Spruck C, Rideout W, Jones PA. DNA methylation and cancer. In: Jost JP, Saluz HP (eds). DNA Methylation: Molecular Biology and Biological Significance. Birkhauser Verlag: Basel, 1993, pp 487– 509. 8 Yoshiura K, Kanai Y, Ochiai A, Shimoyama Y, Sugimura T, Hirohashi S. Silencing of the E-cadherin invasion-suppressor gene by CpG methylation in human carcinomas. Proc Natl Acad Sci USA 1995; 92: 7416–7419. 9 Merlo A, Herman JG, Mao L, Lee DJ, Gabrielson E, Burger PC, Baylin SB, Sidransky D. 5′ CpG island methylation is associated with transcriptional silencing of the tumour suppressor p16/CDKN2/MTS1 in human cancers. Nature Med 1995; 1: 686–692. 10 Gonzalez ZM, Bender CM, Yang AS, Nguyen T, Beart RW, Van TJ, Jones PA. Methylation of the 5′ CpG island of the p16/CDKN2 tumor suppressor gene in normal and transformed human tissues correlates with gene silencing. Cancer Res 1995; 55: 4531–4535. 11 Herman JG, Merlo A, Mao L, Lapidus RG, Issa JP, Davidson NE, Sidransky D, Baylin SB. Inactivation of the CDKN2/p16/MTS1 gene is frequently associated wth aberrant DNA methylation in all common human cancers. Cancer Res 1995; 55: 4525–4530. 12 Herman JG, Jen J, Merlo A, Baylin SB. Hypermethylation-associated inactivation indicates a tumor suppressor role for p15INK4B. Cancer Res 1996; 56: 722–727. 13 Kautiainen TL, Jones PA, DNA methyltransferase levels in tumori-

19 20

21

22

23 24

25

26

27

28

29 30 31 32 33 34

genic and nontumorigenic cells in culture. J Biol Chem 1986; 261: 1594–1598. Wu JJ, Issa JP, Herman J, Bassett DE, Nelkin BD, Baylin SB. Expression of an exogenous eukaryotic DNA methyltransferase gene induces transformation of NIH-3T3 cells. Proc Natl Acad Sci USA 1993; 90: 8891–8895. Vertino PM, Yen RW, Gao J, Baylin SB. De novo methylation of CpG island sequences in human fibroblasts overexpressing DNA (cytosine-5-)-methyltransferase. Mol Cell Biol 1996; 16: 4555– 4565. MacLeod AR, Szyf M. Expression of antisense to DNA methyltransferase mRNA induces DNA demethylation and inhibits tumorigenesis. J Biol Chem 1995; 270: 8037–8043. Laird PW, Jackson-Grusby L, Fazeli A, Dickinson SL, Jung WE, Li E, Weinberg RA, Jaenisch R. Suppression of intestinal neoplasia by DNA hypomethylation. Cell 1995; 81: 197–205. Rideout WD, Coetzee GA, Olumi AF, Jones PA. 5-Methylcytosine as an endogenous mutagen in the human LDL receptor and p53 genes. Science 1990; 249: 1288–1290. Bandaru B, Gopal J, Bhagwat AS. Overproduction of DNA cytosine methyltransferases causes methylation and C → T mutations at non-canonical sites. J Biol Chem 1996; 271: 7851–7859. el-Deiry WS, Nelkin BD, Celano P, Yen RW, Falco JP, Hamilton SR, Baylin SB. High expression of the DNA methyltransferase gene characterizes human neoplastic cells and progression stages of colon cancer. Proc Natl Acad Sci USA 1991; 88: 3470–3474. Issa JP, Vertino PM, Wu J, Sazawal S, Celano P, Nelkin BD, Hamilton SR, Baylin SB. Increased cytosine DNA-methyltransferase activity during colon cancer progression. J Natl Cancer Inst 1993; 85: 1235–1240. Belinsky SA, Nikula KJ, Baylin SB, Issa JP. Increased cytosine DNA-methyltransferase activity is target-cell-specific and an early event in lung cancer. Proc Natl Acad Sci USA 1996; 93: 4045– 4050. Schmutte C, Yang AS, Nguyen TT, Beart RW, Jones PA. Mechanisms for the involvement of DNA methylation in colon carcinogenesis. Cancer Res 1996; 56: 2375–2381. Lee PJ, Washer LL, Law DJ, Boland CR, Horon IL, Feinberg AP. Limited up-regulation of DNA methyltransferase in human colon cancer reflecting increased cell proliferation. Proc Natl Acad Sci USA 1996; 93: 10366–10370. Tsukamoto N, Morita K, Karasawa M, Omine M. Methylation status of c-myc oncogene in leukemic cells: hypomethylation in acute leukemia derived from myelodysplastic syndromes. Exp Hematol 1992; 20: 1061–1064. Lubbert M, Oster W, Ludwig WD, Ganser A, Mertelsmann R, Herrmann F. A switch toward demethylation is associated with the expression of myeloperoxidase in acute myeloblastic and promyelocytic leukemias. Blood 1992; 80: 2066–2073. Humphries DE, Nicodemus CF, Schiller V, Stevens RL. The human serglycin gene. Nucleotide sequence and methylation pattern in human promyelocytic leukemia HL-60 cells and T-lymphoblast Molt-4 cells. J Biol Chem 1992; 267: 13558–13563. Zion M, Ben YD, Avraham A, Cohen O, Wetzler M, Melloul D, Ben NY. Progressive de novo DNA methylation at the bcr-abl locus in the course of chronic myelogenous leukemia. Proc Natl Acad Sci USA 1994; 91: 10722–10726. Palotie A, Syvanen AC. Development of molecular genetic methods for monitoring myeloid malignancies. Scand J Clin Lab Invest 1993; 213 (Suppl.): 29–38. Nelkin BD, Przepiorka D, Burke PJ, Thomas ED, Baylin SB. Abnormal methylation of the calcitonin gene marks progression of chronic myelogenous leukemia. Blood 1991; 77: 2431–2434. Ritter M, de KE, Huhn D, Neubauer A. Detection of DNA methylation in the calcitonin gene in human leukemias using differential polymerase chain reaction. Leukemia 1995; 9: 915–921. Dhodapkar M, Grill J, Lust JA. Abnormal regional hypermethylation of the calcitonin gene in myelodysplactic syndromes. Leukemia Res 1995; 19: 719–726. Ihalainen J, Pakkala S, Savolainen ER, Jansson SE, Palotie A. Hypermethylation of the calcitonin gene in the myelodysplastic syndromes. Leukemia 1993; 7: 263–267. Issa JP, Zehnbauer BA, Civin CI, Collector MI, Sharkis SJ, Davidson NE, Kaufmann SH, Baylin SB. The estrogen receptor CpG island

315


316 35 36 37

38

39

is methylated in most hematopoietic neoplasms. Cancer Res 1996; 56: 973–977. Hanada M, Delia D, Aiello A, Stadtmauer E, Reed JC. bcl-2 gene hypomethylation and high-level expression in B-cell chronic lymphocytic leukemia. Blood 1993; 82: 1820–1828. Harrison J, Molloy PL, Clark SJ. Direct cloning of polymerase chain reaction products in an XcmI T-vector. Anal Biochem 1994; 216: 235–236. Miyoshi E, Jain SK, Sugiyama T, Fujii J, Hayashi N, Fusamoto H, Kamada T, Taniguchi N. Expression of DNA methyltransferase in LEC rats during hepatocarcinogenesis. Carcinogenesis 1993; 14: 603–605. Savonet V, Maenhaut C, Miot F, Pirson I. Pitfalls in the use of several ‘housekeeping’ genes as standards for quantitation of mRNA: the example of thyroid cells. Anal Biochem 1997; 247: 165–167. Greenberg ML, Chanana AD, Cronkite EP, Giacomelli G, Rai KR, Schiffer LM, Stryckmans PA, Vincent PC. The generation time of human leukemic myeloblasts. Lab Invest 1972; 26: 245–252.

40 Vincent PC. Kinetics of leukemia and control of cell division and replication. In: Henderson ES, Lister TA (eds). Leukemia. WB Saunders: 1990, pp 55–104. 41 Killmann SA. Proliferative activity of blast cells in leukemia and myelofibrosis. Morphological differences between proliferating and non-proliferating blast cells. Acta Med Scand 1965; 178: 263–280. 42 Pogribny IP, Basnakian AG, Miller BJ, Lopatina NG, Poirier LA, James SJ. Breaks in genomic DNA and within the p53 gene are associated with hypomethylation in livers of folate/methyldeficient rats. Cancer Res 1995; 55: 1894–1901. 43 Ohyashiki JH, Ohyashiki K, Kawakubo K, Tauchi T, Nakazawa S, Kimura N, Toyama K. T-cell receptor beta chain gene rearrangement in acute myeloid leukemia always occurs at the allele that contains the undermethylated J beta 1 region. Cancer Res 1992; 52: 6598–6602.