Hindawi Publishing Corporation Oxidative Medicine and Cellular Longevity Volume 2016, Article ID 1451676, 13 pages http://dx.doi.org/10.1155/2016/1451676
Research Article Inhibition of Receptor Interacting Protein Kinases Attenuates Cardiomyocyte Hypertrophy Induced by Palmitic Acid Mingyue Zhao,1 Lihui Lu,1 Song Lei,2 Hua Chai,1 Siyuan Wu,1 Xiaoju Tang,1 Qinxue Bao,1 Li Chen,1 Wenchao Wu,1 and Xiaojing Liu1 1
Laboratory of Cardiovascular Diseases, Regenerative Medicine Research Center, West China Hospital, Sichuan University, Chengdu 610041, China 2 Department of Pathology, West China Hospital, Sichuan University, Chengdu 610041, China Correspondence should be addressed to Xiaojing Liu;
[email protected] Received 18 August 2015; Revised 12 October 2015; Accepted 13 October 2015 Academic Editor: Hanjun Wang Copyright © 2016 Mingyue Zhao et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Palmitic acid (PA) is known to cause cardiomyocyte dysfunction. Cardiac hypertrophy is one of the important pathological features of PA-induced lipotoxicity, but the mechanism by which PA induces cardiomyocyte hypertrophy is still unclear. Therefore, our study was to test whether necroptosis, a receptor interacting protein kinase 1 and 3 (RIPK1 and RIPK3-) dependent programmed necrosis, was involved in the PA-induced cardiomyocyte hypertrophy. We used the PA-treated primary neonatal rat cardiac myocytes (NCMs) or H9c2 cells to study lipotoxicity. Our results demonstrated that cardiomyocyte hypertrophy was induced by PA treatment, determined by upregulation of hypertrophic marker genes and cell surface area enlargement. Upon PA treatment, the expression of RIPK1 and RIPK3 was increased. Pretreatment with the RIPK1 inhibitor necrostatin-1 (Nec-1), the PA-induced cardiomyocyte hypertrophy, was attenuated. Knockdown of RIPK1 or RIPK3 by siRNA suppressed the PA-induced myocardial hypertrophy. Moreover, a crosstalk between necroptosis and endoplasmic reticulum (ER) stress was observed in PA-treated cardiomyocytes. Inhibition of RIPK1 with Nec-1, phosphorylation level of AKT (Ser473), and mTOR (Ser2481) was significantly reduced in PAtreated cardiomyocytes. In conclusion, RIPKs-dependent necroptosis might be crucial in PA-induced myocardial hypertrophy. Activation of mTOR may mediate the effect of necroptosis in cardiomyocyte hypertrophy induced by PA.
1. Introduction It is well recognized that excessive intake of dietary saturated fatty acids contributes to heart failure [1]. Considering the elevated plasma concentration of free fatty acids (FFAs), this phenomenon is partly explained by the development of obesity, coronary atherosclerosis, and myocardial ischemia [1]. However, dysfunction of cardiomyocytes caused by excessive intracellular lipids accumulation could be a significant other side of this phenomenon. Overload of lipids in nonadipose tissues that affects cellular functions, namely, lipotoxicity, could also induce cell hypertrophy or even cell death [2]. Evidence suggests that accumulation of PA, the major saturated fatty acids in blood, may give rise to lipotoxicity in cardiomyocytes by induction of oxidative stress [3] and persistent ER stress [4].
ER performs a pivotal role in various cell processes, including synthesizing, assembling, modifying and trafficking of proteins, and maintaining intracellular Ca2+ homeostasis [5]. Upon ER stress, accumulation of unfolded proteins leads to activation of sensors (PERK, ATF6, and IRE1) via dissociating GRP78 from them and triggers unfolded protein response (UPR). A short-term UPR functions as a prosurvival response via reducing accumulation of unfolded proteins and restoring ER function. If UPR prolongs, its downstream signaling initiates complicated response to strengthen ER stress, activates proapoptosis pathways, and eventually induces cell death [6]. According to previous studies, myocardial hypertrophy and apoptosis induced by PA are accompanied with increased expression of ER stress markers [7].
2 Moreover, mammalian target of rapamycin (mTOR), which is also essential for cardiomyocyte development, growth, and functions, regulates mitochondrial fatty acid utilization in the heart [8]. The AKT/mTOR signaling pathway has emerged as an important regulator in the pathogenesis of myocardial hypertrophy [9]. In cardiomyocytes, PI3K/mTOR/p70 (S6K) plays a critical role in the leptininduced hypertrophy [10]. In islet beta-cells, PA activates mRNA translation and increases ER protein load via activation of the mTOR pathway [11]. In adipocytes, inhibition of AKT or mTOR signals by rapamycin attenuates the PAinduced ER stress [10]. However, whether PA evokes ER stress by activating mTOR signaling in cardiomyocytes is unclear, and the underlying mechanism of the PA-induced cardiomyocyte lipotoxicity, more specifically, in the PAinduced cardiomyocyte hypertrophy still remains elusive. Recent studies have indicated a previously unknown form of programmed necrosis called necroptosis, which is regulated by the RIPK1 and RIPK3. In particular, a kinase complex consisted of the RIPK1 and RIPK3 is a central step in the programmed necrotic cell death [12]. Necroptosis represents a newly identified mechanism of cell death sharing features of both apoptosis and necrosis. Although RIPKs-dependent necroptosis has been implicated in the development of several cardiovascular diseases, such as atherosclerosis [13], myocardial infarction [14], and ischemia-reperfusion injury [15], the potential role of RIPKs-dependent necroptosis in the PA-induced myocardial hypertrophy is still unknown. Therefore, in the perspective of its critical role in inflammation and cell death in cardiovascular diseases, we hypothesized that necroptosis might participate in the pathophysiological process of cardiomyocyte hypertrophy induced by PA. In order to verify our hypothesis, we sought to examine the influence of PA on the expression of RIPK1 and RIPK3 in NCMs and in H9c2 cells in this study. It has been reported that blockade of mTOR with its specific inhibitor CCI779 stimulates autophagy and eliminates the activation of RIPKs in RCC4 cells [16]. Accordingly, the crosstalk between necroptosis, ER stress, and AKT/mTOR signaling pathway in cardiomyocytes with PA treatment was also investigated.
2. Materials and Methods 2.1. Cell Culture and Pharmaceutical Treatments. The NCMs were obtained from decapitated 0 to 3-day-old SpragueDawley rats by collagenase II (0.05%) (Gibco) and trypsin (0.05%) digestion according to the methodology of previous studies [17]. The culture medium consisted of DMEM (high glucose) (Gibco) and 10% (v/v) fetal bovine serum (FBS, Hyclone, USA). All cells were maintained in a humidified 5% CO2 /95% air incubator at 37∘ C. H9c2, rat embryonic cardiac myoblasts from American Type Culture Collection (ATCC), were grown in DMEM with 10% FBS at 37∘ C and 5% CO2 . When cells reached 70–80% confluence, they were incubated with 1% BSA-DMEM with or without PA (200 𝜇M, Sigma) for 24 h. Thapsigargin (100 nM, Sigma) and pravastatin (10 𝜇M, Squibb) were used as the agonist and antagonist for ER stress [18]. Nec-1 (10 nM, Selleck) was a known specific inhibitor
Oxidative Medicine and Cellular Longevity for RIPK1, and rapamycin (1 𝜇M, Sigma) was used to block the mTOR signaling activation. All these treatments were pretreated with the NCMs or H9c2 cells for 2 h before the PA stimulation. 2.2. siRNA Transfection. Transient transfection was performed by use of the cationic lipid Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer’s instruction. The H9c2 cells were transfected for 24 h with 50 nM siRNA specific for RIPK1/RIPK3 or negative control siRNA before exposure to PA (200 𝜇M) for another 24 h. The sequences of siRNAs used were as follows: Negative control siRNA (siNC): 5 -GUG CGUUGCUAGUACCAAC dUdU-3 . RIPK1-siRNA (siRIPK1/siR1): 5 -GCG GGCAUGCACUACUUACAUG dUdU-3 . RIPK3-siRNA (siRIPK3/siR3): 5 -GCG GGGUCAGGAUCGAGAGAUU dUdU-3 . 2.3. Real-Time PCR. Gene expression was measured by quantitative RT-PCR (Q-PCR) as our previous report [19]. Total RNA was extracted from cells with TRIzol (Invitrogen, USA), and cDNA was synthesized using a reverse transcription (RT) kit (Toyobo, Japan). Q-PCR was carried out on CFX96 Real-Time PCR Detection System (BIO-RAD, USA) with fluorescence dye SYBR Green (SYBR Green Super mix kit, Bio-Rad, USA). Primer sequences were shown in Table 1. Normalization of gene expression was achieved by comparing the expression of 𝛽-actin for the corresponding samples. Relative fold expression values were determined applying the ΔΔCT threshold (Ct) method. 2.4. Western Blot Analysis. Total proteins were extracted from cells with radio-immunoprecipitation assay (RIPA) lysis buffer. Protein from cell extracts was quantified by Varioskan (Thermo, USA) using a BCA protein assay kit (Pierce, USA). Equivalent amount of cells lysates (25 𝜇g) was separated by denaturing 10% SDS-PAGE and then transferred to 0.45 𝜇m polyvinylidene difluoride (PVDF) membrane (Millipore, USA) using a MiniProtein III system (Bio-Rad, USA). Membranes were subsequently blocked with 5% skim milk in Tris-buffered saline and Tween 20 (TBST) solution for 2 h and were incubated with primary antibodies at 4∘ C overnight: RIPK3 (Cell Signaling, number 14401), RIPK1 (Cell Signaling, number 3493), GRP78 (Cell Signaling, number 3183), Phospho-mTOR (Ser2481) (Cell Signaling, number 2974), mTOR (Cell Signaling, number 2983), Calreticulin (Cell Signaling, number 12238), AKT (Cell Signaling, number 4685), and Phospho-AKT (Ser473) (Cell Signaling, number 4058). The antigen-antibody complexes were detected by enhanced chemiluminescence (ECL) substrate kit (Thermo, USA). Specific bands were scanned and quantified by the Quantity One analysis software (Bio-Rad, USA). 2.5. Detection of Cell Surface Area by F-Actin Staining. Cardiomyocytes surface area was detected by F-actin staining as previously reported [20]. After treatment, H9c2 cells
Oxidative Medicine and Cellular Longevity
3
Table 1: Primer sequences and amplicon sizes for real-time RT-PCR. Genes
GenBank ID
ANP
NM 012612.2
BNP
NM 031545.1
GRP78
NM 013083.2
CHOP
NM 001109986.1
ATF6
NM 001107196.1
𝛼-MHC
NM 017239.2
𝛽-actin
NM 001099771
𝛽-MHC
NM 017239.2
RIPK1
NM 001107350.1
RIPK3
NM 139342.1
Primer sequence (5 -3 ) F: 5 ACCAAGGGCTTCTTCCTCT 3 R: 5 TTCTACCGGCATCTTCTCC 3 F: 5 GCTCTTCTTTCCCCAGCTCT 3 R: 5 ACTGTGGCAAGTTTGTGCTG 3 F:5 CCCCAGATTGAAGTCACCTTTGAG 3 R: 5 CAGGCGGTTTTGGTCATTG 3 F: 5 AGCAGAGGTCACAAGCACCT 3 R: 5 CTCCTTCATGCGCTGTTTCC 3 F: 5 GCAGGTGTATTACGCTTCGC 3 R: 5 TGTGGTCTTGTTATGGGTGG 3 F: 5 ATACCTCCGCAAGTCAGAGAA 3 R: 5 ACGATCTTGGCCTTGACATAC 3 F: 5 ACTATCGGCAATGAGCGGTTC 3 R: 5 ATGCCACAGGATTCCATACCC 3 F: 5 GTGCCAAGGGCCTGAATGAG 3 R: 5 GCAAAGGCTCCAGGTCTGA 3 F: 5 CTTAAGCCCAAGTGCAGTCA 3 R: 5 ATAGCCCAACAAGGAGGATG 3 F: 5 CAGTGTTGGCTGGAAGAGAA 3 R: 5 AGGCTCAGAACTCCAGCAAT 3
Amplicon (bp) 141 130 117 157 136 114 77 353 166 173
were washed and fixed by 4% paraformaldehyde for 30 min at room temperature. Then the cells were incubated with 0.1% TritonX-100 in PBS for 3 to 5 min and stained with Rhodamine Phalloidin (100 nM, Cytoskeleton) for 20 min. Rinse cells with PBS and incubate them with diluted DAPI for 10 mins, away from light. Images were captured by Eclipse TE2000-U fluorescent microscope system (Nikon, Japan) and semiquantitatively analyzed for cell surface area with ImageJ software (NIH, USA).
used was Alexa Fluor 488 Goat Anti-Rabbit IgG (1 : 400, green fluorescence, Invitrogen, USA) or Alexa Fluor 594 Goat Anti-Rabbit IgG (1 : 400, red fluorescence, Invitrogen, USA). Rinse cells and incubate them with diluted DAPI for 10 min, away from light. Images were collected using an Eclipse TE2000-U fluorescence microscope system (Nikon, Japan) and analyzed with ImageJ software (NIH, USA) to semiquantitatively determine the expression of RIPK1 and RIPK3.
2.6. Cells Ultrastructure Observation by Transmission Electron Microscopy [21]. After treatment, H9c2 cells were collected and fixed with 3% glutaraldehyde in 100 mM cacodylate buffer, postfixed in 1% cacodylate-buffer osmium tetroxide for 2 h at room temperature, and dehydrated in a graded series of ethanol. Then the cells were embedded in EponAradite. Ultrathin sections were cut with a diamond knife on a Leica EM UC6rt (Leica, German) and double-stained with uranyl acetate and lead citrate. Ultrastructure of H9c2 cells was observed with a Hitachi H7650 transmission electron microscope (TEM, Hitachi, Japan) at 80 kV.
2.8. Oil Red O Staining. To measure intracellular lipid accumulation, H9c2 cells were stained by Oil Red O dye (Sigma-Aldrich, catalog number 398039) according to the methodology of previous study [23]. After treatment, cells were washed and fixed by 4% (v/v) paraformaldehyde. Then the cells were incubated with the Oil Red O working solution for 30 min at room temperature. Subsequently, the cells were washed twice with 60% isopropanol and then counterstained with hematoxylin (Dako, USA) for 30 s. Excess hematoxylin was washed in water. Cells were then observed under the microscope and images were collected using an ECLIPSE 50i system (Nikon, Japan). Oil Red O-staining positive cell counts were determined over five viewing fields and averaged. Totally more than 150 cells in each group were chosen randomly for statistical analysis.
2.7. Immunofluorescence Staining. H9c2 cells were plated onto coverslips in 6-well plated. When reaching 60–70% confluent, the cells were treated with PA and Nec-1 or with PA alone. Coverslips were then fixed and blocked as described before [22], followed by exposure to the primary antibodies (anti-RIPK1 1 : 100 or anti-RIPK3 1 : 100, Cell Signaling, USA) at 4∘ C overnight. After washing with PBS, incubate the cells with fluorescent-conjugated secondary antibodies for 2 h at room temperature, away from light. The second antibody
2.9. Statistical Analysis. All results were expressed as mean ± SD. We performed statistical analysis using one- or two-way ANOVA and Student-Newman-Keuls post hoc tests or 𝑡-tests. A 𝑝 value of
