Interaction between Two Different Regulatory Elements Activates the ...

MOLECULAR AND CELLULAR BIOLOGY, May 1987, p. 1807-1814 0270-7306/87/051807-08$02.00/0

Vol. 7, No. 5

Copyright C 1987, American Society for Microbiology

Interaction between Two Different Regulatory Elements Activates the Murine oA-Crystallin Gene Promoter in Explanted Lens Epithelia ANA B. CHEPELINSKY,* BERND SOMMER, AND JORAM PIATIGORSKY Laboratory of Molecular and Developmental Biology, National Eye Institute, Bethesda, Maryland 20892 Received 30 October 1986/Accepted 9 February 1987

Previous experiments have indicated that 5' flanking DNA sequences (nucleotides -366 to +46) are capable of regulating the lens-specific transcription of the murine aA-crystallin gene. Here we have analyzed these 5' regulatory sequences by transfecting explanted embryonic chicken lens epithelia with different aAcrystali-CAT (chloramphenicol acetyltransferase) hybrid genes (aA-crystallin promoter sequences fused to the bacterial CAT gene in the pSVO-CAT expression vector). The results indicated the presence of a proximal (-88 to +46) and a distal (-111 to -88) domain which must interact for promoter function. Deletion experiments showed that the sequence between -88 and -60 was essential for function of the proximal domain in the explanted epithelia. A synthetic oligonucleotide containing the sequence between -111 and -84 activated the proximal domain when placed in either orientation 57 base pairs upstream from position -88 of the aA-crystaflin-CAT hybrid gene.

The lens crystallins are encoded by four major gene families (a, P, fy, and 8), which are expressed in the eye lenses of vertebrates. The expression of these genes is temporally and spatially regulated during development (for reviews, see references 4, 27, 46, and 47). a-Crystallin is the first crystallin to appear during lens differentiation in the mouse (58). The a-crystallin gene family consists of the aAand aB-crystallin genes. The aA-crystallin gene codes for two polypeptides (aA2 and aAins) which are produced by alternative RNA splicing (32, 33, 53). In previous experiments we demonstrated the presence of 5' flanking sequences responsible for the transcription of the murine aA-crystallin gene. A DNA fragment containing 366 base pairs (bp) upstream from the cap site and 46 bp of exon 1 was fused to the bacterial gene for chloramphenicol acetyltransferase (CAT) (24). This aA-crystallin-CAT fusion gene was expressed specifically in lens cells when tested in transient experiments with explanted chicken lens epithelia (7) and with transgenic mice (44). Furthermore, the developmental appearance of CAT activity closely followed the appearance of the endogenous aA-crystallin in transgenic mice (44). Whereas 366 bp of 5' flanking sequence of the murine aA-crystallin gene promoted CAT gene expression, 88 bp of 5' flanking sequence did not when the aA-crystalHin-CAT fusion gene was introduced into explanted lens epithelia (7). These previous experiments suggested either that the sequences responsible for the activation of this promoter are localized entirely in the region between nucleotides -366 and -88 or that they must interact with sequences downstream from -88. The present results support the latter hypothesis and map more precisely the two interacting regulatory elements of this lens-specific crystallin gene.

ended. In the construction with the synthetic oligonucleotide, the plasmid was phosphorylated. DNA fragments were isolated by electroelution from polyacrylamide gels, and plasmids were purified as described previously (7). pa88CAT-N281a and pa88CAT-N281b were constructed by BglII-AvaI digestion of pMaACrl800 (7) and isolation of the 281-bp fragment which was ligated to NdeI-digested paA88a-CAT (7). pa88CAT-N202a and pa88CAT-N202b were constructed by EcoRI-AvaI digestion of pMaACrl800 (7), isolation of the 202-bp fragment, and ligation to NdeIdigested paA88a-CAT (7). paA60a-CAT and paA66a-CAT were constructed by AvaI-BAL 31 nuclease-BamHI digestion of pMaACrl800 (7), electroelution of fragments of approximately 110 bp, and ligation to HindIII-digested pSVO-CAT (24). pa66CAT-N202a and pa66CAT-N202b were constructed by ligating the 202-bp (EcoRI-AvaI) fragment from pMaACrl800 (7) to NdeI-digested paA66a-CAT. pa60CAT-N202a was constructed by ligating the 202-bp (EcoRI-AvaI) fragment from pMaACrl800 (7) to NdeIdigested paA60a-CAT. paAllla-CAT was constructed by PvuII-BamHI digestion of pMaACrl800 (7), isolation of the 157-bp fragment, blunt ending with the Klenow fragment of DNA polymerase I, and ligation to HindIll-digested, bluntended, phosphatased pSVO-CAT (24) as described elsewhere (7). To construct pa88CAT-N26a and pa88CAT-N26b, the synthetic oligonucleotides 5'-OH-CTGCTGACGGTG CAGCCTCTCCCCCGAG3' and 5'-OH-CTCGGGGGAG AGGCTGCACCGTCAGCAG3' (OCS Laboratories, Inc., Denton, Tex.) were hybridized and ligated to NdeI-digested, blunt-ended, phosphorylated pa88a-CAT (7) (see Fig. 4A). The subscripts a and b indicate that the aA-crystallin sequences were inserted in the sense or antisense orientation, respectively, with respect to the original crystallin gene. Constructions were sequenced by primer extension with the following primers, as appropriate: 5'ACGCATCTG TGCGGTA3' (complementary to pBR322 sequence [14 nucleotides from the NdeI site and 71 nucleotides from the HindIII site in pSVO-CAT] [24]); 5'GCCTGCACAGAA TGGA3' (complementary to murine aA-crystallin gene nucleotides -33 to -48); 5'CAACGGTGGTATATCCAGT

MATERIALS AND METHODS Plasmid constructions. All ligations were performed with DNA fragments which were blunt ended with the Klenow fragment of DNA polymerase I and inserted into plasmids which were treated with alkaline phosphatase and blunt *

Corresponding author. 1807

MOL. CELL. BIOL.

CHEPELINSKY ET AL.

1808

40

20

100

80

60

-366

d

Im

AGATCTCTGG6AGTTTCGGAGCTCTGCAGAT6GCCTGCTAATCT6TGCCTACCTC r

-287 4

p

o

-

s

Pp

r

o

TCCCCACCTGTGAAACAGGGCTCTGAATTCTTCCTCCAAAGGAGGCCAGGAGGATGCCTCAGTACAATGTGGGAAGAAACAGTGATGTCCCTTGGCTCAA

f

s

n

n

h

-

k

m

b

a

-

c

g

-

AGGATAAGGCTCTCCACAGACCTTCTTGGAGACATCTGGTCTGAGAGCCTCTGCTGCTCAGCGTGTGTTGCTGGGGCTGGCAGGSC6GGTGAGICATTCCAI -111

-88

-66

9

-60

N

f

d b d NWc e-------GCTGCTGACGGTGCAGCCTCTCCCCCGAGCTGAGCATAGACATTTTGGGAAATCCCTTAATTCCTCCATTCTGTGCAGGCA|^TTAGGGAGGGCTGGAA

k + I

h

+1 a

n

+46

ffi

CGCTAGCTCACCACCGCACTGCCCAGAGGCTCCTGTCTGACTCACT6CCASCCTTCGS *

FIG. 1. 5' Flanking DNA sequence of the murine aA-crystallin gene. This sequence contains additional 5' sequences and some corrections to that previously published (32). The major transcription initiation site (asterisk), TATA box (solid-line box), sequence resembling the consensus sequence of some viral enhancers (56) (broken-line box), alternating purines and pyrimidines (dashed under lines), and repeated sequences (arrows labeled with the same letters) are indicated. In our constructs below, position +46 is followed by ATC before the CAT gene sequence. The A comes from the constructed BamHI site (7).

G3'

or

5'TAGCTCCTGAAAATCTCGCC3' (complemen-

tary to the CAT gene sequence and either 46 to 66 nucleotides from the HindIlI site or next to the HindIII site, respectively, in the pSVO-CAT plasmid [24]). The primers were hybridized to plasmids digested with restriction enzymes with one or multiple recognition sites and sequenced by the dideoxynucleotide method (51, 55) with a sequencing kit (New England BioLabs, Inc., Beverly, Mass.). In some cases, the appropriate restriction fragment was sequenced by the Maxam and Gilbert method (38).

Plasmid paA364a-CAT (7) has been renamed potA366aCAT, and paA87a-CAT (7) has been renamed paA88a-CAT, since we have made several corrections in our original sequence (see Fig. 1). The numbers represent the base pairs of the aA-crystallin 5' flanking sequences upstream from the cap site fused to the CAT gene. Restriction enzymes were from New England BioLabs or from Bethesda Research Laboratories, Inc., Gaithersburg, Md. Klenow DNA polymerase I was from Boehringer Mannheim Biochemicals, Indianapolis, Ind.; T4 DNA ligase and T4 polynucleotide kinase were from Pharmacia Inc., Piscataway, N.J.; reverse transcriptase was from Seikagaku of America, St. Petersburg, Fla.; synthetic oligonucleotides were from OCS; [ot-32P]dATP was from Amersham Corp., Arlington Heights, Ill.; [y-32P]ATP was from ICN Pharmaceuticals, Inc., Irvine, Calif.; ['4C]chloramphenicol was from New England Nuclear Corp., Boston, Mass; and acetyl coenzyme A and actinomycin D were from Pharmacia Inc. Lens epithelia explants and transfection. Lens epithelia from 14-day-old chicken embryos were explanted, cultured, and transfected as indicated before (7). In each case, six explants were precultured for approximately 20 h and transfected with the specified plasmid DNA. Approximately 65 h after transfection, the original explants were removed with forceps under the microscope and homogenized (7).

CAT assays (24) were performed with the supernatant fraction as described previously (7). Each time point of CAT activity was determined from the supernatant fraction of three explants. Each experiment was performed at least twice, and the reproducibility of relative CAT activities within each experiment was within 20%. RNA purification from explanted lens epithelia. Thirty-eight explants were transfected with the indicated plasmid and approximately 48 h later were homogenized in guanidine-isothiocyanate and centrifuged through a cesium chloride cushion as indicated by Chirgwin et al. (8). The pellet was extracted with phenol-chloroform-n-butanol and was ethanol precipitated. RNA purification from murine lenses. Lenses from 10-dayold mice were homogenized in 0.1 M Tris hydrochloride (pH 7.5)-12.5 mM EDTA-0.15 M NaCl. Either random-bred Swiss [N:NIH(s)] or the homozygous aA-crystallin-CAT transgenic mouse no. 7378 (44) strains were used. Cytoplasmic RNA was purified by phenol-chloroform-isoamyl alcohol extraction and ethanol precipitation. Primer extension. The oligonucleotide 5'CAACG GTGGTATATCCAGTG3', which is complementary to the CAT gene 46 to 66 nucleotides from the HindIII site in pSVO-CAT (24), or the oligonucleotide 5'CAGGGCA CGCTTGAACCAAG3', which is complementary to nucleotides +92 to +111 of the murine aA-crystallin gene (32), was 5' end labeled with [y-32P]ATP and T4 polynucleotide kinase. Approximately 106 cpm (2.5 ng) of primer was added to the RNA in 10 ,ul of 0.3 M KCl-10 mM Tris hydrochloride (pH 7.5)-l mM EDTA. The RNA was heated at 75°C for 5 min and hybridized at 42°C for 25 min. Primers were extended in 100 mM KCl-50 mM Tris hydrochloride (pH 8.3)-0.33 mM EDTA-8 mM MgCl2-4 mM dithiothreitol-250 ,M deoxynucleoside triphosphates-0.1 ,ug of actinomycin D per ,lI-1.7 U of reverse transcriptase per RI in 30 p1 at 37°C

MURINE aA-CRYSTALLIN GENE PROMOTER REGULATORY ELEMENTS

VOL. 7, 1987

A

-366

-85

-88

-287

+46

-8'5 -88

57p

* pa 88CAT-N202 a . o pct88CAT-N202b 0

+46

"cA~~~~~rT

L i

A pci88CAT-N281b a w * p ax 88CAT-N281 b "~

1809

57 bp

B 60 A

0

0

*

4*

*

U

A

50 z 0

40

w* .*

-cm-Ac3

-cm-Ac,

-J

30 0-

I 1411 0

20

*

CM

10

20 30 40 MINUTES CAT ASSAY 10

FIG. 2. Effect of insertional mutagenesis on the activation of CAT gene expression by the murine aA-crystallin 5' flanking sequence. (A) Murine aA-crystallin sequences -366 to -85 or -287 to -85 inserted at the NdeI site of paA88a-CAT in the sense (a) or antisense (b) orientation. The murine aA-crystallin flanking or gene sequences (_) and the pBR322 sequence (-) are indicated. (B) Transient CAT expression in transfected chicken embryonic lens epithelia. Each time point corresponds to three explants. Inset: autoradiogram of thin-layer chromatography for 20- to 22-min CAT assay. paA366a-CAT (0) and paA88a-CAT (A) are indicated, and the other plasmids are defined in panel A. Abbreviations: cm, chloramphenicol; cm-Acl and cm-Ac3, monoacetylated forms of chloramphenicol.

for 1 hour (18). Extended products were analyzed in acrylamide-8 M urea sequencing gel.

a

10%

RESULTS 5' Flanking sequence of the murine atA-crystallin gene. We made several corrections to the partial sequence of the 5' flanking region of the aA-crystallin gene published earlier (32). The corrected sequence is shown in Fig. 1. The corrections increase the homology of the 5' flanking region of the oaA-crystallin gene of mice and hamsters (53). Several interesting features of this sequence include the TATA box (located between nucleotides -26 to -31), two regions of at least eight alternating purines and pyrimidines (underlined), several repeated stretches of 5 to 8 bp (arrows), and one region resembling the consensus sequence of some viral enhancers (26, 31, 56). The sequence does not contain a 5'CCAAT3' box in either strand, as found in many eucaryotic promoters (3, 25, 39, 42, 57). Functional analysis of the murine aA-crystaliin promoter. Our earlier studies showed that a DNA fragment containing 366 bp upstream from the cap site functions in transfected

chicken lens epithelia. By contrast, a DNA fragment containing only 88 bp upstream from the cap site promotes CAT gene expression very inefficiently, if at all, in the aAcrystallin-CAT fusion gene (7). We thus focused our attention on the sequences between positions -366 and -88. DNA fragments containing sequence -366 to -88 or -287 to -88 were inserted in both orientations into the vector that contains only 88 bp upstream from the cap site (paA88aCAT) at the NdeI site. This site leaves 57 bp of pBR322 DNA between the inserted fragment of the aA-crystallin gene and position -88 of the caA-crystallin gene flanking sequence (Fig. 2A). Both fragments were able to activate CAT expression after transfection into the explanted lens epithelia, even with the presence of the 57-bp spacer (Fig. 2B). It is interesting to note that both fragments functioned preferentially when they were inserted in the same orientation as in the original gene (pa88CAT-N281a and pa88CATN202a). Whereas the sequence from -287 to -85 was able to activate the region from positions -88 to +46 of the aAcrystallin promoter at a distance of 57 bp (pa88CAT-N202a), it was not able to activate the fragment from positions -88 to +46 when placed 1,634 bp downstream of the cap site of the

1810

MOL. CELL. BIOL.

CHEPELINSKY ET AL.

A

-287 -287 a

pai66CAT-N202a

-287

*+46

-88

hn . .10157I Lip

1.

-66 -85 I. 57bD .,# 0 W a

-6 Ut 5760 2

pca6OCAT-N2028

B

-85 I

pa88CAT-N202a

LMJ

a

.

*+48 I I

lw

--I-

I

40r

z 0

30 20

LU o-

10

10

40 30 20 MINUTES CAT ASSAY

FIG. 3. Effect of deletions in the proximal domain on acA-crystallin promoter activity. (A) Diagram of constructions. Mouse aA-crystallin ), and CAT gene ( C) are indicated. (B) flanking or gene sequences (_), the major transcription initiation site (*), pBR322 sequence ( Transient CAT expression with constructions containing deletions in the aA-crystallin proximal domain. Each time point corresponds to three explants.

aA-crystallin-CAT fusion gene (data not shown). Thus, the activating element is not functional unless quite close to its original position. These data suggested to us that the aAcrystallin promoter contains proximal (-88 to +46) and distal (-88 to -287) domains, which interact when the promoter is active. Interaction between the proximal and distal elements of the aA-crystallin promoter. We next investigated the proximal element of the murine aA-crystallin promoter to determine how many 5' flanking nucleotides in the fragment from positions -88 to +46 must interact with the distal activating element to express the aA-crystallin-CAT fusion gene in the explanted lens epithelia. The constructs included the distal activating element (fragment -287 to -85) placed 57 bp upstream from fragments containing positions -88 to +46 (pa88CAT-N202a), -66 to +46 (poL66CAT-N202a), or -60 to +46 (pa60CAT-N202a) of the murine aA-crystallin promoter (Fig. 3A). Unless otherwise stated, the activating element (positions -287 to -85) was in the same orientation as in the original gene.

The relative activity of these constructs was compared (Fig. 3B). The upstream activating element did not promote CAT activity as effectively when 66 bp of 5' flanking sequence was present (po66CAT-N2028) as when 88 bp of 5' flanking sequence was present (pa88CAT-N202a). When the distal domain was inserted in the opposite orientation (pa66CAT-N202b), there was no detectable expression of the CAT gene (data not shown). Moreover, the distal element failed to promote CAT activity when positions -88 to -61

were deleted from the proximal domain (pa60CAT-N202a). These results indicate that the sequence between positions -60 and -88 is essential for promoter activity. Sequences from -84 to -111 activating the proximal element. To map more precisely the distal element, a fragment containing 111 bp upstream and 46 bp downstream from the cap site of the murine aA-crystallin gene was introduced into the pSVO-CAT vector (24). This fragment promoted expression of the CAT gene when inserted in the same orientation as in the original gene (paAllla-CAT) (Fig. 4C). Since the sequence from -88 to +46 promotes little if any CAT activity in our assay, the 23 bp between -111 and -88 should contain the active element of the distal domain. To test this possibility, a 28-bp synthetic oligonucleotide with the sequence corresponding to -111 to -84 of the aAcrystallin gene was inserted into paA88a-CAT. A 57-bp spacer of pBR322 DNA was left between the 3' end of the oligonucleotide and position -88 of the caA-crystallin promoter (Fig. 4A and B). Regardless of its orientation, the synthetic oligonucleotide activated the proximal region of the caA-crystallin gene promoter. These experiments demonstrate that the active sequence in the distal domain is located between nucleotides -111 to -85. Transcription initiation site. Primer extension experiments were conducted to determine whether transcription initiated by the murine aA-crystallin promoter occurred at the same site(s) in hybrid genes as the site(s) of occurrence in vivo in the endogenous gene. Moreover, we also performed a primer extension experiment involving the lenses of a transgenic

VOL. 7, 1987

MURINE atA-CRYSTALLIN GENE PROMOTER REGULATORY ELEMENTS

1811

B

A

-111

*

+46

*

+46

pot111aCAT -111-84

pa88CAT-N26a

-88

57bp

pa88CAT-N26b

-

Nde I 1 18

1

5' CTGCTGACGGTGCAGCCTCTCCCCCGAG 3' 3 GACGACTGCCACGTCGGAGAGGGGCC 5'

C 40

PCa88CAT-N26a

9

c

4

A

30

z00 L LU~~~

cL) .4

20

N

c

10

10

20

30

40

MINUTES CAT ASSAY FIG. 4. Synthetic oligonucleotide activating the murine aA-crystallin promoter in explanted lens epithelia. (A) Insertion of sequences -111 to -84 obtained by chemical synthesis into paA88a-CAT. (B) Diagram of constructions. aA-crystallin flanking and gene sequences (_), the pBR322 sequence (-), and aLA-crystallin transcription initiation site (*) are indicated. (C) Transient CAT gene expression determined as indicated before (7). Each time point corresponds to three chicken lens epithelia explants. mouse strain containing the aA-crystallin-CAT gene (44) to test whether integration of the fusion gene into the cell

chromosome affected transcription initiation. The hybrid in transgenic mice contained the sequence between positions -366 and +46 of the murine aA-crystallin gene fused to the CAT gene. A primer complementary to the CAT gene (50 to 70 bases from the aA-crystallin-CAT junction) was used for the RNAs derived from the hybrid genes, and a primer complementary to exon 1 of the murine aAcrystallin gene (nucleotides +92 to +111) was used for the RNAs derived from the natural gene (see Materials and Methods). The results are shown in Fig. 5. Lanes 1 and 2 show the primer-extended products of aA-crystallin mRNA from lenses of normal mice and of transgenic mice containing the aA-crystallin-CAT gene, respectively. In these cases, the primer was complementary to the aA-crystallin gene coding sequence. There is one major initiation site (extended product, 111 nucleotides long) and one minor initiation site (extended product, 114 nucleotides long) for the aA-crystallin mRNA. The major initiation site corresponds to position + 1 of the gene in Fig. 1 and the minor one corresponds to position -3. gene

The results with the CAT primer are shown in Fig. 5, lanes 3 to 7. With this primer, the extended products should be 119 and 122 nucleotides long if the initiation sites for transcription were at the same location in exon 1 in the normal aA-crystallin gene and the hybrid aA-crystallin-CAT gene. Two bands of expected length corresponding to initiation sites +1 and -3 were observed, indicating that the aAcrystallin promoter initiated transcription at the same sites in both cases. RNA from lens epithelia transfected with po88CAT-N26a (Fig. 5, lane 5) or poxAllla-CAT (lane 6) gave the same two extended products. Thus, the insertion of foreign sequences at position -88 does not affect the accuracy of the initiation site directed by the mouse aA-crystallin promoter. The primer-extended products derived from the plasmids, however, also showed several larger species. The nature of these bands has not been established. The two principal extended products with the CAT primer were not present when RNA was used from normal lenses lacking the otA-crystallin-CAT hybrid gene (lane 3) or from mocktransfected lens epithelia (lane 7). The result of a primer extension experiment with the CAT primer and lens RNA from transgenic mice containing the aA-crystallin-CAT gene

151?

CHEPELINSKY ET AL.

MOL. CELL. BIOL. 6

7

''lllCAT

orime'

.~~~~~~~~~~~~~~~~~ ....i ..~~ ~~~"-9

--122

-11l0

--90

-76

-67

FIG.

5.

RNA analysis by primer extension. The autoradiogram

prec,cnts data from primer extension with RNAs from the following

>oaie>. L,anes: and 3, wild-type .lVstHfllin-C transgenic mice strain 1

AT

chicken n'>\SCl'l-N26,-transfected l chicken

mice lens; 2 and 4, otA7378 (44) lens; 5, plasmid

lens epithelia; 6, plasmid

1,,-CAT-transfected

lens epithelia; 7, mockrj-.insf'ected chicken lens epithelia. Lanes 1 and 2 show RNA (0.6 ,ug) c\Icnded with primer complementary to exon 1 of the aA-crystallin -l: lanes 3 to 7 show RNA (50 ,ug) extended with primer )iiiplenmentary to the CAT sequence of the aA-crystallin-CAT h% hi'di,ene. The lower and upper arrows on each side point to the iitnjior and minor extended products, respectively. The extended on lanes 1 and 2 are 111 and 114 bases, and those on lanes rl0odiLltS t L) ilric 119 and 122 bases. These lengths correspond to initiations + lnd -3 in Fig. 1 (see text for further discussion). These poHit)ons were determined in gels containing sequencing ladders. In .he -,el shown here, pBR322-MspI digestion fragments were used as ,iI/e Mnlrkers (indicated on right).

Al I

shown in lane 4. Again, two products of these same obtained. Thus, chromosomal integration of this hybrid gene did not affect its initiation site for transcription. 44)

are

wizewere

DISCUSSION Wc established previously that a DNA fragment containing 366 bp upstream and 46 bp downstream from the cap site of the murine uA-crystallin gene has cis-acting regulatory elements directing its lens tissue-specific expression (7, 44). lThe present results show that oaA-crystallin sequences between nucleotides -366 and +46 still promote CAT gene cxpiession when a 57-bp spacer is introduced at position S8. (allowing us to define two separate regulatory elements ot the murine cxA-crystallin gene promoter (one distal, upstream from position -88, and one proximal, downstream from position -88). Studies on the regulation of numerous othcr eucaryotic genes have indicated that their promoters m-e aLctivated by an interaction between several control clerments (2. 3. 10, 14, 17, 19-23, 52, 54, 57). A preliminary report also suggests the presence of two interacting domains Ior the function of the murine y2-crystallin gene promoter (S. ok. W. Stevens, M. Breitman, R. Gold, and L.-C. Tsui, J. (cell Bliochem. Suppl. 1OD:121, 1986). -

We have identified the sequence between positions -111 and -84 in the distal element as critical for activation of the proximal element of the murine aA-crystallin promoter. It is interesting that one regulatory sequence identified in the 5' flanking region of a chicken aA-crystallin promoter-8crystallin hybrid gene, when tested in cultured lens cells of mice (43), is different from the distal sequence and further upstream to that described for the murine otA-crystallin gene. Although the 5' flanking sequences of the aA-crystallin gene of the mouse and hamster are highly conserved, the chicken 5' flanking sequence is quite different from that of the other two species (42, 52). There are three 8-bp regions of complete homology between mouse and chicken in the aA-crystallin promoter. One is in the mouse proximal domain, positions -57 to -64 (5'GAAATCCC3'); one is in the distal domain, -104 to -111 (5'CTGCTGAC3'); and one is further upstream, -129 to -136 (5'CTGGGCAG3'). The distal regulatory element of the murine aA-crystallin promoter was functional in either orientation when it was relatively close to its original site. Possibly a dyad of symmetry in the distal activating element (5'GC tAC GGTGCAGC3') contributes to this orientation independence. Some regulatory proteins bind to DNA as dimers through a-helix domains that contact the major groove (see references 45 and 48). Interestingly, the distal element appeared to function less efficiently when inverted and placed several hundred base pairs upstream, as judged from the experiment in which the sequence between positions -85 and -287 was reversed. One possible explanation of this result is that sequences between positions -111 and -287 specifically interfered with promoter activity when situated between the distal and proximal element. We do not know whether promoter efficiency would also be reduced if the distal element (-111 to -88) were placed in its original orientation at a comparable position upstream. However, dependence upon distance and orientation has been observed for regulatory elements of other genes (1, 6, 9, 15, 16, 21, 35, 41), and it has been suggested that the ability to function in one or both orientations may be sequence dependent (6). The sequence of the 5' flanking region of the murine aA-crystallin gene shows several interesting features with respect to its ability to regulate gene expression. First, the proximal domain does not contain a classical 5'CCAAT3' box, which is present in many (3, 25, 39, 42, 57) but not all (30) eucaryotic genes transcribed by RNA polymerase II. It is unlikely that either of the two CAT sequences at positions -78 to -76 and -72 to -70 (which occupy generally similar positions as the CCAAT boxes in other genes) acts as a typical CCAAT box, since it has been shown for the murine major 3-globin gene (42) and for the herpes simplex virus thymidine kinase gene (25) that a single base change in the pentanucleotide 5'CCAAT3' severely lowers transcription. Nonetheless, the present experiments indicate that this region (positions -88 to -60) is a critical, functional stretch of the proximal element of the murine aA-crystallin promoter. We do not know whether the murine aA-crystallin promoter interacts with a member of the CCAAT-binding proteins (25, 39) or with another, different trans-acting factor. It is interesting to note that among the crystallins, a classical CCAAT box is found only in the chicken 81crystallin gene (5, 28) and is absent from either strand of the 5' flanking region of the chicken 82-crystallin gene (5); the murine (present study), chicken (43), and hamster (53) aA-crystallin gene; the hamster aB-crystallin gene (49); the rat ,B1-crystallin gene (13); the human ,A3/A1-crystallin

VOL. 7, 1987

MURINE aA-CRYSTALLIN GENE PROMOTER REGULATORY ELEMENTS

gene (29); and the murine (36, 37), rat (12), and human (11, 40) -y-crystallin genes. Finally, there are other sequences of possible interest within the proximal and distal domains of the murine aAcrystallin promoter. One of these comprises the three A and T stretches present between positions -51 and -71; dA.dT regions have been reported to be involved in DNA bending (34). It is also possible that the alternating purine and pyrimidine stretches in the distal or proximal domain have a regulatory role. Alternating purines and pyrimidines are found in Z DNA and may affect DNA function (50). Lastly, the 5 to 8 bp which are repeated in the proximal and distal domains or those which are repeated within the distal domain may deserve further attention. ACKNOWLEDGMENTS We thank Azriel Schmidt for useful suggestions on RNA purification, Paul F. Lambert for help in the sequencing, and Dawn Chicchirichi for typing the manuscript. Bernd Sommer is grateful to Deutscher Akademischer Austauschdienst, Sonderprogram Gentechnologie and to Alcon Laboratories, Inc. (award to Joram Piatigorsky) for support during the course of this work. LITERATURE CITED 1. Ares, M., M. Mangin, and A. L. Weiner. 1985. Orientationdependent transcriptional activator upstream of a human U2 snRNA gene. Mol. Cell. Biol. 5:1560-1570. 2. Bergman, Y., D. Rice, R. Grosschedl, and D. Baltimore. 1984. Two regulatory elements of immunoglobulin K light chain gene expression. Proc. Natl. Acad. Sci. USA 81:7041-7045. 3. Bienz, M., and H. R. B. Pelham. 1986. Heat shock regulatory elements function as an inducible enhancer in the Xenopus hsp70 gene and when linked to a heterologous promoter. Cell 45:753-760. 4. Bloemendal, H. 1982. Lens proteins. Crit. Rev. Biochem. 12: 1-38. 5. Borras, T., J. M. Nickerson, A. B. Chepelinsky, and J. Piatigorsky. 1985. Structural and functional evidence for differential promoter activity of the two linked -crystallin genes in the chicken. EMBO J. 4:445-452. 6. Boulet, A. M., C. R. Erwin, and W. J. Rutter. 1986. Cell-specific enhancers in the rat exocrine pancreas. Proc. Natl. Acad. Sci. USA 83:3599-3603. 7. Chepelinsky, A. B., C. R. King, P. S. Zelenka, and J. Piatigorsky. 1985. Lens-specific expression of the chloramphenicol acetyltransferase gene promoted by 5' flanking sequences of the murine aA-crystallin gene in explanted chicken lens epitheha. Proc. Natl. Acad. Sci. USA 82:2334-2338. 8. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, and W. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:52945299. 9. Ciliberto, G., L. Dente, and R. Cortese. 1985. Cell-specific expression of a transfected human a1-antitrypsin gene. Cell 41:531-540. 10. Cohen, R. S., and M. Meselson. 1985. Separate regulatory elements for the heat-inducible and ovarian expression of the Drosophila hsp26 gene. Cell 43:737-746. 11. den Dunnen, J. T., R. J. M. Moormann, F. P. M. Cremers, and G. G. Schoenmakers. 1985. Two human -y-crystallin genes are linked and riddled with Alu-repeats. Gene 38:197-204. 12. den Dunnen, J. T., R. J. M. Moormann, N. H. Lubsen, and J. G. G. Schoenmakers. 1986. Concerted and divergent evolution within the rat -y-crystallin gene family. J. Mol. Biol. 189: 37-46. 13. den Dunnen, J. T., R. J. M. Moormann, N. H. Lubsen, and J. G. G. Schoemmakers. 1986. Intron insertions and deletions in the 3/-y-crystallin gene family: the rat PB1 gene. Proc. Natl. Acad. Sci. USA 83:2855-2859.

1813

14. Derse, D., and J. W. Casey. 1986. Two elements in the bovine leukemia virus long terminal repeat that regulate gene expression. Science 231:1437-1440. 15. Deschamps, J., F. Meulink, and I. M. Verma. 1985. Identification of a transcriptional enhancer element upstream from the proto-oncogene fos. Science 230:1174-1177. 16. Dynan, W. S., and R. Tjian. 1985. Control of eukaryotic messenger RNA synthesis by sequence-specific DNA binding proteins. Nature (London) 316:774-778. 17. Edlund, T., M. D. Walker, P. J. Barr, and W. J. Rutter. 1985. Cell-specific expression of the rat insulin gene: evidence for role of two distinct 5' flanking elements. Science 230:912-916. 18. Eisenberg, S. P., D. M. Coen, and S. L. McKnight. 1985. Promoter domains required for expression of plasmid-borne copies of the herpes simplex virus thymidine kinase gene in virus-infected mouse fibroblasts and microinjected frog oocytes. Mol. Cell. Biol. 5:1940-1947. 19. Falkner, F. G., and H. G. Zachau. 1984. Correct transcription of an immunoglobulin k gene requires an upstream fragment containing conserved sequence elements. Nature (London) 310: 71-74. 20. Foster, J., J. Stafford, and C. Queen. 1985. An immunoglobulin promoter displays cell-type specificity independently of the enhancer. Nature (London) 315:423-425. 21. Garcia, J. V., L. Bich-Thuy, J. Stafford, and C. Queen. 1986. Synergism between immunoglobulin enhancers and promoters. Nature (London) 322:383-385. 22. Gluzman, Y. (ed.). 1985. Eukaryotic transcription. The role of cis- and trans-acting elements in initiation. Current communications in molecular biology. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 23. Gopal, T. V., T. Shimada, A. W. Baur, and A. W. Nienhuis. 1985. Contribution of promoter to tissue-specific expression of the mouse immunoglobulin kappa gene. Science 229:1102-1104. 24. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051. 25. Graves, B. J., P. F. Johnson, and S. L. McKnight. 1986. Homologous recognition of a promoter domain common to the MSV LTR and the HSV tk gene. Cell 44:565-576. 26. Gruss, P. 1984. Magic enhancers? DNA 3:1-5. 27. Harding, J. J., and M. J. C. Crabbe. 1984. The lens: development, proteins, metabolism and cataract, p. 207-440. In H. Davson (ed.), The eye: vegetative physiology and biochemistry, vol. 1B. Academic Press, Inc., New York. 28. Hayashi, S., H. Kondoh, K. Yasuda, G. Soma, Y. Ikawa, and T. S. Okada. 1985. Tissue-specific regulation of a chicken &crystallin gene in mouse cells: involvement of the 5' end region. EMBO J. 4:2201-2207. 29. Hogg, D., L.-C. Tsui, M. Gorin, and M. L. Breltman. 1986. Characterization of the human -rystallin gene Hu,A3/A1 reveals ancestral relationships among the fry-crystallin superfamily. J. Biol. Chem. 261:12420-12427. 30. Jaynes, J. B., J. S. Chamberlai, J. N. Buskln, J. E Johnson, 1986. Transcriptional regulation of the and S. D. Ha muscle creatine kinase gene and regulated expression in transfected mouse myoblasts. Mol. Cell. Biol. 6:2855-2864. 31. Khoury, G., and P. Gruss. 1983. Enhancer elements. Cell 33:313-314. 32. King, C. R., and J. Piatigorsky. 1983. Alternative RNA splicing of the murine xA-crystallin gene: protein-coding information within an intron. Cell 32:707-712. 33. King, C. R., and J. Piatigorsky. 1984. Alternative splicing of aA-crystallin RNA: structural and quantitative analyses of the mRNAs for the aA2- and cuAVs-crystallin polypeptides. J. Biol. Chem. 259:1822-1826. 34. Koo, H., H. Wu, and D. M. Crothers. 1986. DNA bending at adenine-thymine tracts. Nature (London) 320:501-506. 35. Laimins, L. A., P. Gruss, R. Pozzatti, and G. Khoury. 1984. Characterization of enhancer elements in the long terminal repeat of Moloney murine sarcoma virus. J. Virol. 49:183-189. 36. Lok, S., M. L. Breitman, A. B. Chepelinsky, J. Piatigorsky, R. J. M. Gold, and L.-C. Tsui. 1985. Lens-specific promoter

1814

37.

38.

39. 40. 41.

42. 43.

44.

45. 46. 47.

CHEPELINSKY ET AL.

activity of a mouse y-crystallin gene. Mol. Cell. Biol. 5:2221-2230. Lok, S., L.-C. Tsui, T. Shinohara, J. Piatigorsky, R. J. M. Goid, and M. Breitman. 1984. Analysis of the mouse -y-crystallin gehe family: assignment of multiple cDNAs to discrete genomic sequences and characterization of a representative gene. Nucleic Acids Res. 12:4517-4529. Maxam, A. M., and W. Gilbert. 1977. A new method for sequencing DNA. Proc. Natl. Acad. Sci. USA 74:560-564. McKnight, S., and R. Tjian. 1986. Transcriptional selectivity of viral gene in mammalian cells. Cell 46:795-805. Meakin, S. 0., M. L. Breitman, and L.-C. Tsui. 1985. Structural and evolutionary relationships among five members of the human y-crystallin gene family. Mol. Cell. Biol. 5:1408-1414. Mercola, M., J. Goverman, C. Mirell, and K. Calame. 1985. Immunoglobulin heavy-chain enhancer requires one or more tissue-specific factors. Science 227:266-270. Myers, R. M., K. Tilly, and T. Maniatis. 1986. Fine structure genetic analysis of a 3-globin promoter. Science 232:613618. O i, K., K. Yasuda, H. Kondoh, and T. S. Okada. 1985. DNA sequences responsible for the tissue-specific expression of a chicken a-crystallin gene in mouse lens cells. EMBO J. 4:2589-2595. Overbeek, P. A., A. B. Chepelinsky, J. S. Khiflan, J. Piatigorsky, and H. Westphal. 1985. Lens-specific expression and developmental regulation of the bacterial chloramphenicol acetyltransferase gene driven by the murine aA-crystallin promoter in transgenic mice. Proc. Natl. Acad. Sci. USA 82:7815-7819. Pabo, C. O., and R. T. Sauer. 1984. Protein-DNA recognition. Annu. Rev. Biochem. 53:293-321. Piatigorsky, J. 1984. Lens crystallins and their gene families. Cell 38:620-621. Piatigorsky, J. 1987. Gene expression and genetic engineering in the lens. Invest. Ophthalmol. Visual Sci. 28:9-28.

MOL. CELL. BIOL.

48. Ptashne, M. 1986. A genetic switch. Gene control and phage K. Blackwell Scientific Publications, Ltd., Oxford. 49. Quax-Jeuken, Y., W. Quax, G. van Rens, P. M. Khan, and H. Bloemendal. 1985. Complete structure of the aB-crystallin gene: conservation of the exon-intron distribution in the two nonlinked a-crystallin genes. Proc. Natl. Acad. Sci. USA 82:

5819-5823. 50. Rich, A., A. Nordheim, and A. H. J. Wang. 1984. The chemistry and biology of left-handed Z-DNA. Annu. Rev. Biochem.

53:791-846. 51. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 71:5463-5467. 52. Struhl, K. 1982. The yeast his3 promoter contains at least two distinct elements. Proc. Natl. Acad. Sci. USA 79:7385-7389. 53. van den Heuvel, R., W. Hendricks, W. Quax, and H. Bloemendal. 1985. Complete structure of the hamster oaAcrystallin gene: reflection of an evolutionary history by means of exon shuffling. J. Mol. Biol. 185:273-284. 54. Voss, S. D., U. Schiokat, and P. Gruss. 1986. The role of enhancers in the regulation of cell-type-specific transcriptional control. Trends Biochem. Sci. 11:287-289. 55. Wallace, R. B., M. J. Johnson, S. V. Suggs, K. Miyoshi, R. Bhatt, and K. Itakura. 1981. A set of synthetic oligodeoxyribonucleotide primers for DNA sequencing in the plasmid vector pBR322. Gene 16:21-26. 56. Weiher, H., M. Konig, and P. Gruss. 1983. Multiple point mutations affecting the simian virus 40 enhancer. Science 219: 626-631. 57. Wu, B. J., R. E. Kinston, and R. I. Morimoto. 1986. Human HSP70 promoter contains at least two distinct regulatory domains. Proc. Natl. Acad. Sci. USA 83:629-633. 58. Zwann, J. 1983. The appearance of a-crystallin in relation to cell cycle phase in the embryonic mouse lens. Dev. Biol. 96: 173-181.