JOURNAL OF BACTERIOLOGY, Dec. 2005, p. 8081–8087 0021-9193/05/$08.00⫹0 doi:10.1128/JB.187.23.8081–8087.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Vol. 187, No. 23
Involvement of SenC in Assembly of Cytochrome c Oxidase in Rhodobacter capsulatus† Danielle L. Swem, Lee R. Swem, Aaron Setterdahl, and Carl E. Bauer* Department of Biology, Indiana University, Bloomington, Indiana 47405 Received 23 May 2005/Accepted 13 September 2005
SenC, a Sco1 homolog found in the purple photosynthetic bacteria, has been implicated in affecting photosynthesis and respiratory gene expression, as well as assembly of cytochrome c oxidase. In this study, we show that SenC from Rhodobacter capsulatus is involved in the assembly of a fully functional cbb3-type cytochrome c oxidase, as revealed by decreased cytochrome c oxidase activity in a senC mutant. We also show that a putative copper-binding site in SenC is required for activity and that a SenC deletion phenotype can be rescued by the addition of exogenous copper to the growth medium. In addition, we demonstrate that a SenC mutation has an indirect effect on gene expression caused by a reduction in cytochrome c oxidase activity. A model is proposed whereby a reduction in cytochrome c oxidase activity impedes the flow of electrons through the respiratory pathway, thereby affecting the oxidation/reduction state of the ubiquinone pool, leading to alterations of photosystem and respiratory gene expression. Many organisms obtain cellular energy through aerobic respiration, a process by which electrons travel through the respiratory chain to a terminal oxidase. During respiration, oxidases utilize electrons from the quinone pool to reduce oxygen to water while simultaneously translocating protons across the membrane. The translocation of protons generates an electrochemical proton gradient that is used by ATPase to drive the production of ATP. Rhodobacter capsulatus is a metabolically versatile purple nonsulfur photosynthetic bacterium that has the ability to grow through a variety of means, including photosynthesis, aerobic respiration, and fermentation. Like many bacteria, R. capsulatus contains a branched respiratory chain ending with two terminal oxidases. One is ubiquinol oxidase that obtains electrons directly from ubiquinol. The other is a cbb3-type cytochrome c oxidase that obtains electrons from cytochrome c2 and cy (11). The cbb3-type oxidase is composed of three major subunits; subunit I (CcoN) that contains noncovalently attached low-spin heme b, as well as a high-spin heme b3-[r]CuB complex, and subunits II and III that are both c-type cytochromes with covalently attached heme (CcoO and CcoP) (10). The cbb3-type oxidase is distinguished from the more common aa3-[r]type cytochrome c oxidase, in that the aa3-type oxidase has an additional copper site, CuA. This copper site is the primary acceptor of electrons from cytochrome c (22). Since the cbb3 oxidase does not have a CuA site, it has been proposed that the unique c-type cytochromes in cbb3 oxidase, CcoO and CcoP, fulfill the role of primary electron acceptors (29). Although there are undoubtedly multiple proteins required for proper assembly and function of cytochrome c oxidases, few have been well defined. Directly downstream from the cbb3 oxidase structural genes is the ccoGHIS operon that encodes
for various components required proper assembly of a functional cytochrome c oxidase (14). Specifically CcoI is believed to be required for acquisition of copper and CcoS for acquisition of prosthetic groups. An additional oxidase assembly factor that is involved in both mitochondrial and bacterial respiration is ScoI. Disruption of ScoI in yeast and human cells leads to rapid degradation of the CoxI subunit of cytochrome c oxidase that contains the CuA site (15, 20, 23). Since ScoI binds copper, it has been proposed that ScoI may be functioning as a copper chaperone that is responsible for delivering copper to the CuA site in the CoxI subunit (9). In support of this hypothesis is the presence of a 100% conserved copper-binding motif CXXXC in all ScoI homologs. Alternatively, it has also been proposed that ScoI may instead be functioning as a thiol-disulfide oxidoreductase with a role in keeping cysteines of CoxI in a reduced state so that it is capable of forming ligands with copper (7). However, direct biochemical evidence for or against these models is lacking. R. capsulatus contains a ScoI homolog named SenC. Interestingly, it has been demonstrated that SenC is required for activity of the cbb3 cytochrome oxidase despite the fact that this oxidase does not have a CuA site (4). Specifically, initial investigation of SenC showed that it affected both aerobic respiration and photosynthesis gene expression (4). A proposed role for a SenC homolog in R. sphaeroides is to act as a signal mediator between cytochrome cbb3 oxidase and the sensor kinase RegB that is involved in controlling expression of a number of processes such as photosynthesis and respiration (19). This theory predicts that SenC is directly involved in the redox sensing mechanism of RegB, which in turn regulates multiple operons in response to environmental oxygen levels. In the present study, we further define the role of SenC in R. capsulatus by constructing an in-frame deletion of senC, as well as point mutations in the putative CXXXC copper-binding site of SenC. Our results indicate that SenC does indeed have a role in promoting optimal activity of the cytochrome cbb3 oxidase and that the cysteines within the copper binding motif in
* Corresponding author. Mailing address: Department of Biology, Jordan Hall, Bloomington, IN 47405. Phone: (812) 855-6595. Fax: (812) 856-4178. E-mail:
[email protected]. † Supplemental material for this article may be found at http://jb .asm.org/. 8081
8082
SWEM ET AL.
SenC (specifically Cys87) are necessary for this function. We also show that the effect SenC has on transcription is an indirect effect caused by a decrease in cytochrome c oxidase enzymatic activity. MATERIALS AND METHODS Strains, media, and growth conditions. R. capsulatus strain SB1003 was used as the wild-type strain and parent to the subsequent SenC mutants. The DccoNO mutant (GK32) was previously described by Koch et al. (13). All R. capsulatus strains were grown on PYS medium (28). Dark aerobic growth conditions were achieved by growing 25 ml of cell culture in 250-ml flasks that were shaken at 300 rpm. Semiaerobic growth conditions were achieved by growing 33 ml of cell culture in 50-ml flasks that were shaken at 100 rpm. Anaerobic (photosynthetic) growth conditions were achieved by filling 18-ml screw-cap tubes completely and illuminating the culture with 60-W lamps. Escherichia coli strain S17-1 pir was utilized for conjugation with R. capsulatus, and the gentamicin concentrations in E. coli and R. capsulatus were 10 and 1.25 g/ml, respectively. Cloning and generation of SenC in-frame deletion. To create the in-frame deletion of SenC, 500 bp upstream of SenC were PCR amplified with the primers XbaIUp (5⬘-TTTCTAGAATCGTCACTGGCACCAGG) and EcoRVUp (5⬘-T CGATATCTTGCTCGAAACGTTCATC). Also, 500 bp downstream of SenC were also PCR amplified with the primers SacIDown (5⬘-ATGAGCTCTCGTA AACCCGCTGGATATG) and EcoRVDown (5⬘-TTGATATCCAACGGAAA TTGACCAGC). The upstream PCR product was enzymatically digested with XbaI and EcoRV, while the downstream product was digested with SacI and EcoRV. These restriction endonuclease sites were constructed into the primers used for PCR amplification and do not exist elsewhere in the PCR product. The two digested PCR products were then ligated in the presence of the gentamicin resistant suicide vector pZJD29a (J. Jiang and C. E. Bauer, unpublished plasmid construction), which was predigested with the restriction endonucleases XbaI and SacI. This ligation created a 1-kb insert that contained 500 bp upstream and downstream of senC. The only amino acid sequence remaining of the SenC protein is MNVSSKISNGN, which consists of the first six amino acids and the last three amino acids of SenC. The centrally located Ile and Ser residues shown above are created by the EcoRV restriction site, which placed the two PCR products in-frame. The pZJD29a plasmid also contains the sacB gene encoding levansucrase, which inhibits cells from growth on sucrose media. pZJD29a constructs containing the correct insert were sequenced to confirm the deletion was in frame and then transformed into mating strain S17-1 pir and ultimately conjugated with the R. capsulatus parent strain, SB1003. Colonies representing a single recombination have gentamicin resistance and were therefore selected for, isolated, and grown photosynthetically in PY medium without antibiotics to allow derivatives in which the second recombination event can propagate. After 4 days of growth, cultures were plated on PY 5% sucrose media with colonies being restreaked onto PY and on PY plus gentamicin to confirm the loss of the plasmid. Colonies with the proper phenotype were then confirmed for deletion of senC by PCR amplification of the senC region. The PCR product was cloned for sequencing to confirm the in-frame deletion of senC. The final senC deletion mutant was named LS01. A Flag-tagged senC construct was constructed by amplifying the promoter and entire senC gene with the Flag tag at the C terminus using the primers Sflag UpNcoI (5⬘-ATCCATGGACTACAAGGACGACGACGACAAGAACGTTT CGAGCAAGACC) and SflagDownXbaI (5⬘-ATTCTAGATCACTTGTCGTC GTCGTCCTTGTAGTCATTTC CGTTGCCCG). The PCR product was cloned into pBBR1mcs-2 (1) to construct pSenCFlagC and transformed into the mating strain S17-1 pir. Conjugation between this construct and LS01 (⌬senC) was performed as described previously (2). Generation of SenC point mutant (C87A). The SenC point mutation was generated by PCR mutagenesis with Turbo Pfu DNA polymerase as described by the Stratagene QuikChange kit (catalog no. 200518). A fragment of DNA composed of the senC open reading frame and 500 bp on either side was cloned into pBluescript SK(⫹) (Stratagene). This was used as the template for point mutant generation. The plasmid containing the potential point mutation was confirmed by sequence analysis. The mutated senC DNA fragment was then subcloned into the suicide vector, pZJD29a, and transformed into S17-1 pir for conjugation with LS01 (⌬senC). Selection for mutants was done the same as that for LS01 with the final constructs being confirmed by PCR amplification of the mutant senC gene and sequencing the area of interest. Spectroscopy on SB1003 and LS01. SB1003, LS01, and LS01 pSenCFlagC were grown aerobically to 50 Klett units in PY medium. Cells were harvested by centrifugation, resuspended in 10 mM Tris-HCl (pH 8)–50 mM NaCl, and then
J. BACTERIOL. lysed by sonication. The crude cell extracts were then clarified by centrifugation at 10,000 ⫻ g in a microcentrifuge before the supernatant was removed and scanned spectrally from 400 to 900 nm. A DU640 Beckman spectrophotometer was used to analyze the sample. Cytochrome c oxidase activity. Visual analysis of cytochrome c oxidase activity was done by using the Nadi test. Nadi reactions were carried out as described by Marrs and Gest (16) by the addition of ␣-naphthol (Sigma) and dimethyl-pphenylenediamine (Sigma) on PY medium plates such that all cells were covered and then excess reagent was removed. Colonies were timed for formation of the indophenol blue. Quantitative analysis of cytochrome c oxidase activity was carried out by measuring the reduction of cytochrome c (Sigma) by cytochrome c oxidase as a function of the decrease in absorbance at 550 nm. Specifically, aerobic cultures were grown to 50 Klett units, 10 ml of cell culture was centrifuged at 5,000 ⫻ g for 10 min, and the media was decanted. Pellets were stored at ⫺80°C until the assay was performed. Cell pellets were resuspended in 1⫻ assay buffer (10 mM Tris-HCl [pH 7.0], 120 mM KCl), lysed via sonication, and centrifuged at 10,000 ⫻ g for 10 min. Then, 10 l of supernatant was combined with 940 l of assay buffer. The reaction was initiated by the addition of 50 l of reduced cytochrome c, and the decrease in absorbance at 550 nm was measured continuously for 1 min by using a spectrophotometer. Reduced cytochrome c was prepared by making a solution at 218 M in water and adding dithiothreitol to a final concentration of 0.5 mM. The sample was mixed gently and incubated at room temperature for 10 min. To assure the level of reduction is adequate, the absorbance of a 20-fold-diluted stock was measured at both 550 and 565 nm. A ratio of absorbance at 550 to 565 nm should be between 10 and 20 and indicates that the substrate is sufficiently reduced. Activity was quantified by the following calculation: U/ml ⫽ (Abs/min) ⫻ dilution factor ⫻ reaction volume (ml)/volume of sample (ml) ⫻ 21.84, where 21.84 ⫽ ⑀mM between ferrocytochrome c and ferricytochrome c at 550 nm (Sigma protocol in reference to product code CYTOC-OX1). Samples were normalized by determining the protein concentration of the cell extract by using Advanced Assay Reagent (Cytoskeleton, catalog no. ADV01). -Galactosidase assays. Transcriptional analysis of the puf operon was done by using the lacZ based reporter vector, pCB532⍀ (3). Transcriptional analysis of the ccoNOPQ and cydAB operons was done by utilizing the pDSccoN2 and pLS04Qo lacZ-based reporter vectors, respectively (25). -Galactosidase activity was measured as described by Young et al. (28) with the protein concentration determined by using Advanced Protein Reagent (Cytoskeleton) (28). Copper suppression assays were performed identically to those without copper, with the exception of 0.02 mM CuCl2 added to the growth medium. Diamide sensitivity study. SB1003 and LS01 were both grown overnight to stationary phase and then diluted 1:50 and allowed to recover to exponential phase (50 Klett units). Cultures were then divided into aliquots and either allowed to grow for additional 2 h with no alterations or with the addition of diamide (N,N,N⬘,N⬘-tetramethylazodicarboxamide) to a final concentration of 6 mM. After the 2-h growth period serial dilutions were done, and cultures were plated on PY in triplicate. Plates were incubated at 34°C for 3 days before the colonies were counted, and the total number of viable cells was quantitated.
RESULTS SenC gene organization and construction of a nonpolar in-frame deletion. As previously reported, SenC is the first gene in a three-gene operon containing the regA and hvrA genes. Previous in vivo mutational analysis of senC in R. capsulatus was performed with the mutant strain JB-1, which contained a kanamycin cassette inserted into the senC open reading frame at codon 179. This strain exhibited reduced cbb3 cytochrome oxidase activity, as well as a decrease in photosynthesis gene expression (4). Specifically, expression of the puf operon, encoding for the structural components of the lightharvesting and reaction center complexes, was shown to be decreased twofold in the senC insertion mutant, JB-1. However, the previously described insertion mutation in senC may have had polar effects on expression of downstream genes regA and hvrA, which are known regulators of photosynthesis and respiration (5, 6, 24). A specific phenotype of an R. capsulatus senC mutation was therefore somewhat uncertain, especially
VOL. 187, 2005
FIG. 1. Photosynthesis gene expression comparison. Spectral scan of crude cell extracts from aerobically grown cells. Wild type (SB1003) is indicated by a solid line, the ⌬senC strain (LS01) is indicated by a dash dot line, and the complemented strain ⌬senC/psenC (LS01 pSenCFlagC) is indicated by a dashed line.
since a senC mutation in R. sphaeroides has a distinctly different phenotype with regard to its effect on photosynthesis gene expression over that described for the R. capsulatus insertion mutation JB-1 (8). To alleviate the possibility of polarity effects, we constructed a deletion of the senC gene in R. capsulatus by fusing the first six senC codons in-frame to the last four codons of senC resulting in the strain LS01. In contrast to the reduced synthesis of the photosystem in strain JB-1 (4), spectral scans of LS01 exhibited a marked increase in photosystem production in the presence of oxygen relative to the parent strain SB1003 (Fig. 1). Introduction of a wild-type copy of senC (containing a Flag tag that was utilized in other studies, LS01 pSenCFlagC) was provided in trans in LS01 and completely restored wild-type photo-pigment production, thereby indicating that the senC deletion does not have a polar effect on regA (Fig. 1). Cytochrome cbb3 oxidase activity is reduced in the senC deletion strain LS01. We next addressed whether strain LS01 (⌬senC) affected the enzymatic activity of cbb3 oxidase. A visual observation of cbb3 oxidase activity in growing cells can be performed with the Nadi assay, a method that has been extensively utilized to observe cytochrome c-dependent biological respiration since 1884 (16). During the Nadi reaction, a strain containing a functional cytochrome c oxidase catalyzes rapid (⬍1 min) formation of blue colored indophenol from colorless ␣-naphthol using dimethyl-p-phenylenediamine as an exogenous electron donor. However, strains containing a nonfunctional cytochrome c oxidase will not catalyze this reaction resulting in a substantial delay (⬎30 min) in spontaneous indophenol formation. After subjecting wild-type R. capsulatus (SB1003) colonies grown on PY media to Nadi reagents, the colonies turn visibly blue in approximately 5 s and reach maximum coloration (entire colony blue) within 20 s (Fig. S1 in the supplemental material). In contrast, strain LS01 takes considerably longer, with initial blue color occurring at about 1 min with maximal color not achieved until ⬃10 min (Fig. S1 in the supplemental material). As a control, we also assayed the Nadi
RESPIRATORY ROLE FOR SenC IN R. CAPSULATUS
8083
reaction in the R. capsulatus cbb3 oxidase deletion mutant strain GK32 that lacks cbb3 oxidase activity (13). Colonies of strain GK32 do not form blue coloration until ⬃30 min after being incubated with the Nadi reagents (data not shown). In confirmation that the Nadi-slow phenotype observed with LS01 is a direct result of a disruption of SenC, we also observed that the regA-disrupted strain exhibited a normal (⬍1min color development) Nadi reaction (Fig. S1 in the supplemental material). Furthermore, the addition of senC in trans to strain LS01 restores Nadi activity to wild-type levels (Fig. S1 in the supplemental material). Thus, strain LS01 can be characterized as exhibiting a Nadi-slow phenotype, which is not as severe as a cbb3-null mutation. These data indicates that the activity of cbb3 oxidase is not entirely dependent on SenC but that SenC does significantly enhance the activity of this enzyme. Since the Nadi reaction is not quantitative, we also measured cbb3 oxidase activity by undertaking an assay in which the activity of cytochrome c oxidase is measured as a function of the decrease in absorbance of cytochrome c at 550 nm that occurs when this cytochrome donates an electron to cbb3 oxidase. The results of this assay indicate that LS01 displays a 79% decrease in cytochrome c oxidase activity relative to that observed with wild-type cells during aerobic growth (Fig. 2A). As a control for nonrespiratory oxidation of cytochrome c, we also assayed for oxidation in the cbb3 oxidase deletion mutant GK32, which exhibited an 88% reduction in activity relative to wild-type cell extracts (Fig. 2A). This quantitative assay thus mimics observations of the Nadi reaction where strain LS01 exhibits a decrease in respiration that is not as severe as that observed with a null mutation in cbb3 oxidase. To confirm that the senC mutant phenotypes are not a result of a polar effect on regA, cytochrome c oxidase activity was also measured in LS01 with senC provided in trans, as well as in a ⌬regA mutant. As shown in Fig. 2A, the introduction of senC on a plasmid restored cytochrome c oxidase activity to wildtype levels. It has previously been demonstrated that RegA affects transcription on ccoNOPQ operon that encodes for cbb3 oxidase, specifically a regA mutant demonstrates a 9.2-fold decrease in transcription of this operon under aerobic conditions (25). Despite this decrease in transcription, the ⌬regA mutant has near-wild-type levels of cytochrome c oxidase enzymatic activity (Fig. 2A). Exogenous addition of copper suppresses the senC deletion phenotype. As stated above in the Introduction, the SenC homolog, Sco1 is proposed to act as a copper chaperone by delivering copper to the CuA site of cytochrome c oxidase (9). To address the possibility of SenC functioning as a copper chaperone, we assayed whether the addition of copper to the growth medium of R. capsulatus can suppress the senC deletion phenotype by reconstituting a functional cbb3 oxidase. Various copper concentrations were tested to determine the highest level of copper that could be added to PY media without affecting the growth rate of R. capsulatus. When the senC deletion strain LS01 was grown on PY plates containing 20 M CuCl2, the Nadi-slow phenotype was suppressed to a level that was indistinguishable from that observed with wild-type cells (Fig. S2 in the supplemental material). As a control, the cbb3 deletion mutant GK32 was also grown on copper-supplemented medium, where it maintained a Nadi-minus pheno-
8084
SWEM ET AL.
FIG. 2. Cytochrome oxidase activity. (A) Cytochrome oxidase activity of crude cell extracts from aerobically grown cells. Activity is expressed in U/ml/mg of protein where 1 U is defined as the amount required to oxidize 1.0 mol of ferrocytochrome c per minute at pH 7.0 at 25°C. (B) Cytochrome oxidase activity with cells grown in the presence of 0.02 mM CuCl2. Wild-type (WT; SB1003), ⌬senC (LS01) ⌬ccoN (GK32), and ⌬regA (DS05) strains were evaluated.
type. The same copper suppression effect was observed on defined minimal growth medium where the addition of 20 M CuCl2 also suppresses the Nadi-slow phenotype. This indicates that free copper in the growth medium does not simply react with the ␣-naphthol and DMPD (N,N-dimethyl-p-phenylenediamine monohydrochloride) to form the blue indophenol. Instead, copper appears to specifically suppress the senC mutation, giving rise to a functional cytochrome cbb3 oxidase that generates indophenol from the Nadi reagents. A quantitative measurement of copper suppression was
J. BACTERIOL.
again undertaken by assaying cytochrome c oxidation at 550 nm promoted by cytochrome cbb3 oxidase in cell extracts. As shown in Fig. 2B, the addition of 20 M exogenous copper to the growth medium resulted in complete suppression of the reduced cytochrome cbb3 oxidase activity phenotype of strain LS01. In contrast, addition of exogenous copper to the growth medium of the cbb3 cytochrome oxidase-null mutant strain GK32 had no suppressing effect on cytochrome cbb3 oxidase activity (Fig. 2B). To further demonstrate similar functionality between SenC and ScoI, we constructed a chromosomal Cys873Ala point mutation, which is the first cysteine in the putative CXXXC copper-binding motif. The C87A mutant displayed a Nadi-slow phenotype similar to the in frame deletion of SenC, taking ⬃20 min to complete color formation. Quantitative analysis of cytochrome oxidase activity in C87A revealed an 82% decrease in activity relative to the wild type (Fig. 2A). Copper suppression analysis by the addition of 20 M CuCl2 to C87A was undertaken, and again activity was resumed to near wild-type levels (Fig. 2B). Diamide resistance. Analysis of structural features of the SenC/Sco1 family of proteins has shown that there is a high level of similarity to a novel class of thiol-disulfide oxidoreductases (2, 7, 18, 26). Thus, in addition to being a potential copper chaperone, it is also possible that SenC/Sco1 may affect the redox state of cysteines. Because of this hypothesis, experiments were undertaken to determine the effects of a thiol oxidant, N,N,N⬘,N⬘-tetramethylazodicarboxamide (diamide) on wild type, LS01, and the cbb3 mutant strain GK32. The response to diamide depends on the oxidoreductase equilibrium. Specifically, if the equilibrium is toward the formation of dithiols, then the senC mutant may be hypersensitive, and if it is toward the formation of disulfides, then it would be resistant. For this assay, cell cultures were grown semiaerobically to exponential phase and then divided with one set of cultures continuing to grow without perturbation, and the other set grown in the presence of 6 mM diamide. After two additional hours of growth, the cells were plated to determine viable cell count. The results of this assay show that wild-type (SB1003) cultures exhibit substantial sensitivity to diamide, resulting in ⬃97% death. Surprisingly, strain LS01 demonstrated considerably less sensitivity (Fig. 3). The SenC C87A mutant also exhibited a very similar phenotype to that of LS01 (data not shown). These results suggest that if SenC is an oxidoreductase it would function in the direction of formation of disulfides. Specifically in the absence of SenC (LS01) there would be a shortage of disulfides resulting in an accumulation of reductants, hence making it resistant to diamide. Indeed, evidence supporting SenC functioning as an oxidoreductase in this matter is supported by the observation that strain GK32, which lacks cytochrome cbb3 oxidase activity and therefore may accumulate reductants, also exhibits a high level of resistance to diamide (Fig. 3). However, since both mutants display the same phenotype it is difficult to say whether the diamide resistance of LS01 is a direct or indirect effect that results from the loss of a functional cytochrome cbb3 oxidase. Effect of an in-frame deletion of senC on transcription. We characterized what role the nonpolar senC mutation may have on gene expression by analyzing expression of cytochrome cbb3 oxidase and ubiquinol oxidase using translational lacZ fusions.
RESPIRATORY ROLE FOR SenC IN R. CAPSULATUS
VOL. 187, 2005
8085
FIG. 3. Diamide resistance of wild-type (SB1003), ⌬senC (LS01), and ⌬ccoN (GK32) aerobically grown cells that upon reaching exponential phase were either allowed to continue growing for 2 h untreated or continued growing for 2 h with 6 mM diamide. Strains are as described in Fig. 2.
One reporter plasmid has a fusion to the first gene in the ccoN operon that encodes for the apoproteins of the cbb3 cytochrome oxidase, and the second has a fusion to the cydA gene which is the first gene of ubiquinol oxidase operon (25). The results of the -galactosidase assays show that ccoN expression in LS01 has a 2- and a 1.5-fold decrease aerobically and semiaerobically, respectively, as well as a 2-fold increase photosynthetically, relative to wild-type cells (Fig. 4A). In contrast, expression of cydAB operon was increased 14-fold aerobically and 7-fold semiaerobically, whereas no effect was observed under photosynthetic conditions in strain LS01 (Fig. 4B). If the effect that LS01 is having on transcription is indeed due to a dysfunctional cytochrome cbb3 oxidase, one would assume that addition of the exogenous copper, which rescues wild-type levels of cytochrome oxidase activity, would also resume wild-type levels of cytochrome cbb3 and ubiquinol oxidase expression. To test this hypothesis, the -galactosidase assays described above were repeated in the presence of 20 M exogenous copper. As shown in Fig. 5, the addition of copper did indeed suppress the phenotype of LS01, with expression of ccoN and cydAB resuming wild-type levels. This result supports the hypothesis that SenC is not directly involved in the transcription of the ccoN or the cydAB operons but rather displays an indirect effect caused by a dysfunctional cytochrome c oxidase. The ability of the SenC deletion to undergo copper suppression of oxidase expression also confirms that the inframe deletion does not have a polar effect on regA expression. Therefore, the transcriptional expression differences observed in LS01 on the ccoN and cydAB operons can be attributable to a decrease in cytochrome cbb3 oxidase activity. DISCUSSION Involvement of SenC in respiration. Sco1 homologs are present in genomes from a vast array of organisms ranging from bacteria to mammals. The initial proposed role for Sco1 is a copper chaperone, responsible for delivering copper to the CuA site of subunit 2 of the aa3-type cytochrome c oxidase (17). This hypothesis stood primarily on the basis that Sco1 mutants lacked efficient respiration and Sco1 contains a con-
FIG. 4. Terminal oxidase gene expression. (A) -Galactosidase activity of the ccoN promoter from aerobically grown wild-type (SB1003) and ⌬senC (LS01) cells. (B) -Galactosidase activity of the cydAB promoter from aerobically grown wild-type (SB1003) and ⌬senC (LS01) cells. Activity units indicate micromoles of ONPG (o-nitrophenyl--D-galactopyranoside) hydrolyzed/min/mg of protein.
served CXXXC motif similar to that of cytochrome c oxidase. The model supporting this theory is some times referred to as the “bucket brigade,” in which copper is sequestered from the cytosol by another copper-binding protein, Cox17, shuttled to the intermembrane of the mitochondria, and “passed off” to Sco1. Sco1 in turn interacts with cytochrome c oxidase delivering copper to its CuA site (12). Prokaryotic organisms, such as R. capsulatus and B. subtilis, may lack a need for a Cox17 homolog due to the absence of an inner membrane structure. SenC is believed to be located in the cytoplasmic membrane with the carboxyl-terminal copper-binding domain located in the periplasmic space (8). Such an orientation would allow direct contact of Sco1 with exogenous copper in the growth media and therefore it may be hypothesized that Sco1 homologs in prokaryotes are themselves involved in sequestering copper and subsequently transferring the copper to cytochrome c oxidase. Indeed, the copper suppression of a SenC
8086
SWEM ET AL.
FIG. 5. Terminal oxidase gene expression in the presence of 0.02 mM CuCl2. (A) -Galactosidase activity of the ccoN promoter from aerobically grown wild-type (SB1003) and ⌬senC (LS01) cells. (B) Galactosidase activity of the cydAB promoter from aerobically grown wild-type (SB1003) and ⌬senC (LS01) cells. Activity units indicate micromoles of ONPG hydrolyzed/min/mg of protein.
mutant in the present study supports the idea that it is capable of sequestering copper from the media without the help of a Cox17-like homolog. This observation does not rule out the possibility of copper chaperones; however, it does support the copper suppression phenotype observed in prokaryotes but not in eukaryotes. In the present study we have demonstrated that exogenous copper in the form of cupric chloride can complement a senCnull mutant, resuming normal respiration. However, the argument has been made that the addition of copper may actually be rendering an oxidative stress response. However, it should be noted that the addition of other cations such as zinc and magnesium did not complement the respiration-deficient phenotype of a senC mutant (data not shown), indicating a specific necessity for copper. This observation rules out that the exogenously added copper is simply functioning as a Lewis acid that catalyzed a chemical reaction. Instead, the observed suppres-
J. BACTERIOL.
sion of a null senC phenotype by high levels of copper suggests that SenC may indeed have a role in sequestering and delivering copper to cbb3-type cytochrome c oxidase. A caveat to this model is that cytochrome cbb3 oxidase does not contain a CuA site, which is the site that Sco1 is thought to chaperone copper to in aa3-[r]type cytochrome oxidases. This indicates that SenC may have evolved to deliver copper to the CuB site that is present in cbb3-type cytochrome c oxidases in bacterial species. Alternatively, ScoI may be involved in delivery of copper to both the CuA and CuB sites in mitochondrial aa3-type cytochrome oxidases and, when the CuA site was lost in bacterial cbb3 oxidases, ScoI homologs were subsequently retained to continue delivery to the CuB site. Note that the presence of ScoI homolog in an organism containing only a cbb3-type cytochrome c oxidase is not unique to R. capsulatus. Campylobacter jejuni also contains a ScoI homolog and yet only has a cbb3-type cytochrome c oxidase (21). Recently, the solution structure of Sco1 was solved from B. subtilis, as well as a crystal structure of H. sapiens Sco1 (26, 27). These structures reveal that this family of proteins has a thioredoxin-type fold, and it is proposed that Sco1 actually functions as a signaling molecule rather than a copper chaperone. The support for this hypothesis comes from the fact that the crystallization of Sco1 was only attainable without copper bound, and the proposed copper binding site was not sterically possible based on the positions of the cysteines revealed by the crystal. This observation led to a hypothesis that ScoI/SenC could also be functioning as an oxidoreductase and that the oxidation state of the copper allows the cysteines to either be available for peroxidase reactions or not. To test this hypothesis, wild-type R. capsulatus and the senC mutant were both exposed to the strong thiol oxidant, diamide, which is known to promote spurious disulfide bond formation. The senC deletion strain demonstrated a dramatic increase in resistance to diamide over the wild-type control. This result does not support or refute the possibility of an oxidoreductase model for SenC since oxidoreductases are reversible enzymes. As stated in Results, the resistance of a senC mutant to diamide only indicates that if it is an oxidoreductase its equilibrium is toward the formation of disulfides, and hence in its absence there may be an increase in reductants, therefore increasing its resistance to the spurious formation of disulfides by diamide. SenC does not directly affect transcription. SenC was also proposed to directly affect gene expression in R. capsulatus and in R. sphaeroides. This conclusion was based on the observation that the previously described R. capsulatus senC insertional mutant, JB-1, exhibited a slight decrease in photosystem production. It was also believed that this phenotype was independent of an effect on cytochrome cbb3 oxidase since the cytochrome cbb3 oxidase mutant, M7, exhibited the opposite phenotype by having an increase in photosystem production (4). However, the data presented here reveal that an in-frame senC deletion mutant has a phenotype similar to that of a cytochrome cbb3 oxidase mutant, with both exhibiting a slight increase in photosystem production. The decrease in photosystem production observed in the previous senC mutant, JB-1, was therefore, most likely due to a polar effect on the transcriptional regulator, RegA, which directly affects the transcription of photosynthetic apparatus genes. It has also been proposed that SenC may be an intermediate
RESPIRATORY ROLE FOR SenC IN R. CAPSULATUS
VOL. 187, 2005
in the transfer of a signal between cytochrome c oxidase and the two-component signal transduction system, RegB/RegA (8). Recent studies on redox sensing by the sensor kinase RegB actually shed light on why a mutation that affects cbb3 oxidase activity also affects synthesis of the photosystem. The primary regulatory circuit that controls synthesis of the photosystem is the RegB/RegA two-component system, which upregulates photosystem apparatus gene expression under anoxygenic conditions. It has recently been discovered that RegB monitors the oxidation-reduction state of the ubiquinone pool as an input signal to control kinase activity. Specifically, the presence of oxidized ubiquinone inhibits RegB autophosphorylation (L. R. Swem et al., submitted for publication). In the absence of a functional cytochrome cbb3 oxidase, the ubiquinone pool becomes more reduced due to the lack of electrons flowing through cytochrome cbb3 oxidase. The reduced ubiquinone pool derepresses RegB autophosphorylation leading to induction of the photosystem even under aerobic growth conditions. In fact, this is the phenotype of both a cbb3 oxidase and a senC mutant, which both exhibit an increase in photosystem production aerobically. In both mutants, we believe this phenotype is attributed to a highly reduced ubiquinone pool, which is a consequence of a dysfunctional cytochrome cbb3 oxidase. The reduced ubiquinone pool is unable to inhibit RegB autophosphorylation and photosynthetic gene expression is ultimately increased as a consequence. Summary. The data presented here indicates that SenC is involved in copper metabolism, which is required for synthesis of a functional cytochrome cbb3 oxidase. We also demonstrate that the multiple regulatory phenotypes previously associated with senC mutations are due solely to the decreased activity of cytochrome cbb3 oxidase. At present, there is no direct evidence that that SenC or cytochrome cbb3 oxidase directly modulate the activity of the RegB/RegA two-component regulatory system. ACKNOWLEDGMENTS We thank Jeffrey Zaleski for stimulating discussions regarding this work. This study was supported by National Institutes of Health grant GM53940. REFERENCES 1. Antoine, R., and C. Locht. 1992. Isolation and molecular characterization of a novel broad-host-range plasmid from Bordetella bronchiseptica with sequence similarities to plasmids from gram-positive organisms. Mol. Microbiol. 6:1785–1799. 2. Balatri, E., L. Banci, I. Bertini, F. Cantini, and S. Ciofi-Baffoni. 2003. Solution structure of Sco1: a thioredoxin-like protein Involved in cytochrome c oxidase assembly. Structure 11:1431–1443. 3. Bauer, C. E., D. A. Young, and B. L. Marrs. 1988. Analysis of the Rhodobacter capsulatus puf operon: location of the oxygen-regulated promoter region and the identification of an additional puf-encoded gene. J. Biol. Chem. 263:4820–4827. 4. Buggy, J., and C. E. Bauer. 1995. Cloning and characterization of senC, a gene involved in both aerobic respiration and photosynthesis gene expression in Rhodobacter capsulatus. J. Bacteriol. 177:6958–6965. 5. Buggy, J. J., M. W. Sganga, and C. E. Bauer. 1994. Characterization of a light-responding transactivator responsible for differentially controlling reaction center and light-harvesting-I gene expression in Rhodobacter capsulatus. J. Bacteriol. 176:6936–6943. 6. Buggy, J. J., M. W. Sganga, and C. E. Bauer. 1994. Nucleotide sequence and characterization of the Rhodobacter capsulatus hvrB gene: HvrB is an activator of S-adenosyl-L-homocysteine hydrolase expression and is a member of the LysR family. J. Bacteriol. 176:61–69.
8087
7. Chinenov, Y. V. 2000. Cytochrome c oxidase assembly factors with a thioredoxin fold are conserved among prokaryotes and eukaryotes. J. Mol. Med. 78:239–242. 8. Eraso, J. M., and S. Kaplan. 2000. From redox flow to gene regulation: role of the PrrC protein of Rhodobacter sphaeroides 2.4.1. Biochemistry 39:2052– 2062. 9. Glerum, D. M., A. Shtanko, and A. Tzagoloff. 1996. SCO1 and SCO2 act as high copy suppressors of a mitochondrial copper recruitment defect in Saccharomyces cerevisiae. J. Biol. Chem. 271:20531–20535. 10. Gray, K. A., M. Grooms, H. Myllykallio, C. Moomaw, C. Slaughter, and F. Daldal. 1994. Rhodobacter capsulatus contains a novel cb-type cytochrome c oxidase without a CuA center. Biochemistry 33:3120–3127. 11. Hochkoeppler, A., F. E. Jenney, Jr., S. E. Lang, D. Zannoni, and F. Daldal. 1995. Membrane-associated cytochrome cy of Rhodobacter capsulatus is an electron carrier from the cytochrome bc1 complex to the cytochrome c oxidase during respiration. J. Bacteriol. 177:608–613. 12. Horng, Y. C., P. A. Cobine, A. B. Maxfield, H. S. Carr, and D. R. Winge. 2004. Specific copper transfer from the Cox17 metallochaperone to both Sco1 and Cox11 in the assembly of yeast cytochrome c oxidase. J. Biol. Chem. 279: 35334–35340. 13. Koch, H. G., O. Hwang, and F. Daldal. 1998. Isolation and characterization of Rhodobacter capsulatus mutants affected in cytochrome cbb3 oxidase activity. J. Bacteriol. 180:969–978. 14. Koch, H. G., C. Winterstein, A. S. Saribas, J. O. Alben, and F. Daldal. 2000. Roles of the ccoGHIS gene products in the biogenesis of the cbb3-type cytochrome c oxidase. J. Mol. Biol. 297:49–65. 15. Krummeck, G., and G. Rodel. 1990. Yeast SCO1 protein is required for a posttranslational step in the accumulation of mitochondrial cytochrome c oxidase subunits I and II. Curr. Genet. 18:13–15. 16. Marrs, B., and H. Gest. 1973. Genetic mutations affecting the respiratory electron-transport system of the photosynthetic bacterium Rhodopseudomonas capsulata. J. Bacteriol. 114:1045–1051. 17. Mattatall, N. R., J. Jazairi, and B. C. Hill. 2000. Characterization of YpmQ, an accessory protein required for the expression of cytochrome c oxidase in Bacillus subtilis. J. Biol. Chem. 275:28802–28809. 18. McEwan, A. G., A. Lewin, S. L. Davy, R. Boetzel, A. Leech, D. Walker, T. Wood, and G. R. Moore. 2002. PrrC from Rhodobacter sphaeroides, a homologue of eukaryotic Sco proteins, is a copper-binding protein and may have a thiol-disulfide oxidoreductase activity. FEBS Lett. 518:10–16. 19. Oh, J. I., I. J. Ko, and S. Kaplan. 2004. Reconstitution of the Rhodobacter sphaeroides cbb3-PrrBA signal transduction pathway in vitro. Biochemistry 43:7915–7923. 20. Paret, C., A. Lode, U. Krause-Buchholz, and G. Rodel. 2000. The P(174)L mutation in the human hSCO1 gene affects the assembly of cytochrome c oxidase. Biochem. Biophys. Res. Commun. 279:341–347. 21. Parkhill, J., B. W. Wren, K. Mungall, J. M. Ketley, C. Churcher, D. Basham, T. Chillingworth, R. M. Davies, T. Feltwell, S. Holroyd, K. Jagels, A. V. Karlyshev, S. Moule, M. J. Pallen, C. W. Penn, M. A. Quail, M. A. Rajandream, K. M. Rutherford, A. H. van Vliet, S. Whitehead, and B. G. Barrell. 2000. The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 403:665–668. 22. Pitcher, R. S., T. Brittain, and N. J. Watmough. 2002. Cytochrome cbb3 oxidase and bacterial microaerobic metabolism. Biochem. Soc. Trans. 30: 653–658. 23. Schulze, M., and G. Rodel. 1988. SCO1, a yeast nuclear gene essential for accumulation of mitochondrial cytochrome c oxidase subunit II. Mol. Gen. Genet. 211:492–498. 24. Sganga, M. W., and C. E. Bauer. 1992. Regulatory factors controlling photosynthetic reaction center and light-harvesting gene expression in Rhodobacter capsulatus. Cell 68:945–954. 25. Swem, L. R., S. Elsen, T. H. Bird, D. L. Swem, H. G. Koch, H. Myllykallio, F. Daldal, and C. E. Bauer. 2001. The RegB/RegA two-component regulatory system controls synthesis of photosynthesis and respiratory electron transfer components in Rhodobacter capsulatus. J. Mol. Biol. 309:121–138. 26. Williams, J. C., C. Sue, G. S. Banting, H. Yang, D. M. Glerum, W. A. Hendrickson, and E. A. Schon. 2005. Crystal structure of human SCO1: implications for redox signaling by a mitochondrial cytochrome c oxidase “assembly” protein. J. Biol. Chem. 280:15202–15211. 27. Ye, Q., I. Imriskova-Sosova, B. C. Hill, and Z. Jia. 2005. Identification of a disulfide switch in BsSco, a member of the Sco family of cytochrome c oxidase assembly proteins. Biochemistry 44:2934–2942. 28. Young, D. A., C. E. Bauer, J. C. Williams, and B. L. Marrs. 1989. Genetic evidence for superoperonal organization of genes for photosynthetic pigments and pigment-binding proteins in Rhodobacter capsulatus. Mol. Gen. Genet. 218:1–12. 29. Zufferey, R., O. Preisig, H. Hennecke, and L. Thony-Meyer. 1996. Assembly and function of the cytochrome cbb3 oxidase subunits in Bradyrhizobium japonicum. J. Biol. Chem. 271:9114–9119.
