419
Isolation and characterization of an alternatively spliced variant of transcription factor Islet-1 K Ando1, S Shioda1,2, H Handa1 and K Kataoka1,2 1
Frontier Collaborative Research Center, Tokyo Institute of Technology, Yokohama 226-8503, Japan
2
Laboratory of Molecular and Developmental Biology, Graduate School of Biological Science, Nara Institute of Science and Technology, 8916-5 Takayama-cho, Ikoma 630-0192, Japan
(Requests for offprints should be addressed to K Kataoka; Email:
[email protected])
Abstract The LIM homeodomain protein Islet-1 (Isl1), one of the earliest markers for motor neuron differentiation, is also expressed in all classes of islet cells in the pancreas. Isl1 is known to bind and regulate the promoters of the insulin, glucagon and somatostatin genes. In this study, we describe isolation of a novel isl1 cDNA species from the mouse islet cell line TC6, which arose from the utilization of an alternative splicing acceptor site in the fifth exon. This shorter cDNA encodes an Isl1 isoform (Isl1-) lacking the carboxy-terminal 23 amino acids of the previously reported product Isl1-. Although the level of isl1- mRNA is much lower than that of isl1-, isl1- is preferentially expressed in murine insulinoma cell lines but not in glucagonoma cell line. Upon transient transfection, both Isl1- and Isl1- accumulate in the nuclei of murine insulinoma cells. We found that Isl1- is a relatively more potent transcriptional activator of the insulin promoter than Isl1- and that the Isl1- isoform undergoes phosphorylation. Therefore, the transcriptional activity of Isl1 is potentially regulated by the alternative splicing of its mRNA and by phosphorylation. Journal of Molecular Endocrinology (2003) 31, 419–425
Introduction Islet-1 (Isl1) was originally isolated as a transcription factor that binds to an islet cell-specific enhancer element in the insulin gene (Karlsson et al. 1990). Isl1 is expressed in cells as well as in the other classes of pancreatic endocrine cells (, and cells) (Dong et al. 1991, Thor et al. 1991), and it was also shown to bind and regulate the and cell-specific hormone genes glucagon (Wang & Drucker 1995) and somatostatin (Leonard et al. 1992) respectively. Isl1 is also expressed in developing neurons in the spinal cord, where it serves as an early marker of motor neuron differentiation (Ericson et al. 1992, Tsuchida et al. 1994). In accord with its expression profile, homozygous deletion of the isl1 gene in mice results in the ablation of islets and motor neurons (Pfaff et al. 1996, Ahlgren et al. 1997). In addition, heterozygous nonsense mutations have been found in the isl1 gene in patients with type 2 diabetes (Shimomura et al. 2000). Journal of Molecular Endocrinology (2003) 31, 419–425 0952–5041/03/031–419 © 2003 Society for Endocrinology
The Isl1 protein contains two LIM domains (LIM1 and LIM2) at the amino terminus and a homeodomain (HD) in the central region (see Fig. 1). The HD is responsible for the binding of Isl1 to target AT-rich DNA sequences, and the LIM domains are zinc-binding motifs that mediate interactions with other proteins such as NLI/Ldb1 (Sanchez-Garcia et al. 1993, Jurata et al. 1996). In contrast, the function of the carboxy-terminal region is not clearly defined. It is thought to serve as a transactivator domain, because a truncated Isl1 product (Isl1–310X) that has been found in type 2 diabetes patients and which lacks the carboxy-terminal 40 amino acids has been shown to be a weaker transactivator than wild type Isl1 (Shimomura et al. 2000). In this manuscript, we describe the isolation of an alternatively spliced isl1 cDNA variant from the mouse pancreatic cell line TC6. Its product, Isl1-, lacks 23 amino acids that are present in the carboxy-terminal region (amino acids 256–278) of the previously reported Isl1 (Isl1-). Unexpectedly, Online version via http://www.endocrinology.org
Printed in Great Britain
420
K ANDO
and others
· An alternatively spliced variant of Islet-1
Figure 1 Isolation of the alternatively spliced isoform of Isl1. The previously reported mouse Isl1 protein (Isl1-) and the newly identified isl1 cDNA product (Isl1-) are schematically shown. LIM1, LIM2 and HD represent the LIM domains 1 and 2 and the HD, respectively. The lower panel shows the genomic structure of the mouse isl1 gene and the splicing patterns of the isl1- and isl1- mRNAs.
the novel Isl1- isoform is a relatively more potent transactivator of the insulin promoter than Isl1-, suggesting a new regulatory role for the carboxyterminal region of Isl1.
Materials and methods Cells
MIN6 cells (Miyazaki et al. 1990) were a generous gift from Dr Jun-ichi Miyazaki (Osaka University). TC6 and TC1 clone 9 (hereafter TC1) cells were purchased from the American Tissue Culture Collection. MIN6 and TC6 cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 15% fetal calf serum, and TC1 cells were grown in F12K medium supplemented with 10% fetal calf serum. isl1 cDNA isolation and RT-PCR analysis
One microgram of total RNA isolated from TC6 cells using TRIZOL Reagent (Invitrogen) was subjected to a reverse transcription reaction (50 C for 1 h) using SuperScript II reverse transcriptase (Invitrogen) and a specific anti-sense primer Journal of Molecular Endocrinology (2003) 31, 419–425
(isl1-R; 5 -agaccgcgGTTCCTCATGCCTCAAT AGGAC-3 ), which is complementary to the 3 end of isl1 open reading frame. isl1 cDNAs containing the entire open reading frame were then amplified by PCR using LA-Taq DNA polymerase and 2GC buffer (Takara, Kyoto, Japan). The primers used were isl1-F1 (sense strand; 5 -gggaggcCTT ACAGATATGGGAGACATGGG-3 ), which corresponds to the region around the first ATG of isl1, and anti-sense isl1-R primer described above. The PCR cycles were 40 cycles of 94 C for 40 s, 55 C for 40 s and 72 C for 2 min. The PCR products were digested by StuI and SacII, linked to a double-stranded oligonucleotide encoding the FLAG-tag sequence (5 -ctagtacc ATGGATTACAAGGATGACGACGATAAGGG AGG-3 and 5 -CCTCCCTTATCGTCGTCAT CCTTGTAATCCATggta-3 ), and cloned into the SpeI-SacII-digested vector pGEM-T-easy (Promega) to generate pGEM-T-easy/FLAG-isl1- and pGEM-T-easy/FLAG-isl1-. The nucleotide sequence of isl1- is deposited in GenBank (accession number AB104633). For isl1 mRNA expression analysis, total RNA (1 µg) was subjected to RT-PCR using the Titan One-Tube RT-PCR System (Roche). The primers www.endocrinology.org
An alternatively spliced variant of Islet-1 ·
K ANDO
and others 421
were isl1-F2 (sense strand, 5 -AAGGAGCAACTA GTGGAGATGACGGG-3 ), which corresponds to the exon 4 encoding the HD of isl1, and the isl1-R primer described above. The PCR cycles were 40 cycles of 94 C for 40 s, 55 C for 40 s and 72 C for 60 s. Immunofluorescence staining
Isl1- and Isl1- expression plasmids were constructed by inserting partially digested NotI fragments excised from pGEM-T-easy/FLAGisl1- and pGEM-T-easy/FLAG-isl1- into the mammalian expression vector pHygEF2. MIN6 cells grown on collagen-coated cover slides (Iwaki, Tokyo) were transfected with 3·2 µg of plasmids (pHygEF2/FLAG-isl1- or pHygEF2/FLAG-isl1-) using 8 µl Lipofectamine 2000 reagent (Invitrogen). Twenty-four hours after transfection, the cells were fixed with PBS containing 3% formaldehyde at room temperature for 15 min and treated with 0·25% Triton X-100 in PBS for an additional 15 min. The cells were then stained with antiFLAG (M2) monoclonal antibody and Alexa Fluor 488-labeled anti-mouse IgG serum (Molecular Probes) and 4,6-diamidino-2-phenylindole. Luciferase assay
The reporter plasmid h-ins-p-luc, containing the human insulin promoter region, was described previously (Kataoka et al. 2002). NIH3T3 cells grown in a 35 mm dish were transfected with a total of 1·5 µg of plasmids (0·4 µg luciferase plasmid, 1·0 µg expression plasmid and 0·1 µg pEF-Rluc (Kataoka et al. 2001)) using 10 µl PolyFect reagent (Qiagen). Cells were harvested 24 h after transfection by 200 µl of Passive Lysis Buffer (Promega). The firefly and Renilla luciferase activities were measured using the Dual Luciferase Assay System (Promega). Western analysis
Twelve microliters of cell extracts used for the luciferase assay, which had been dissolved in the Passive Lysis Buffer (Promega), were added with 4 µl of SDS sample buffer (200 mM Tris pH 6·8, 8% SDS, 400 mM dithiothreitol, 0·2% bromophenol blue and 40% glycerol), and boiled for 5 min. The samples were then subjected to 8% SDSPAGE under reducing and denatured conditions, www.endocrinology.org
Figure 2 Expression of isl1 isoforms in pancreatic endocrine cell lines. Total RNA (1 µg) isolated from TC1, TC6 and MIN6 cells grown in the presence of 1 mM (−) or 20 mM (+) glucose for 24 h was subjected to RT-PCR analysis with isl1-specific primers. Amplification products were resolved by PAGE and visualized by ethidium bromide staining. The 433 and 364 bp products are derived from the isl1- and isl1- mRNAs, respectively.
followed by transfer onto an Immobilon membrane (Millipore). The membrane was stained with the anti-FLAG (M2) antibody, biotinylated anti-mouse IgG serum and streptavidin-horseradish peroxidase conjugate (Amersham Pharmacia). For calf intestinal alkaline phosphatase (CIAP) treatment, nuclear extracts were prepared from transfected NIH3T3 cells as described in the literature (Schreiber et al. 1989). Briefly, cells grown in a 35 mm dish were washed with PBS, and were added with 200 µl ice-cold buffer A (10 mM Hepes pH 7·9, 10 mM KCl, 1·5 mM MgCl2, 1 mM EDTA, 1 mM dithiothreitol, 0·1% Nonidet P40 and protease inhibitors). The cells were scraped, transferred into a microtube, and centrifuged at 2500 g for 1 min at 4 C. The pellet was re-suspended in 20 µl buffer B (20 mM Hepes, pH 7·9, 400 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 20% glycerol and protease inhibitors) and incubated on ice for 10 min. After centrifugation at 15 000 g for 10 min, the supernatant (nuclear extract) was collected. Four microliters of the extract were diluted to final concentration of 25 mM Tris (pH 7·9), 100 mM NaCl, 5 mM MgCl2 and 8 mM dithiothreitol, added with 20 units CIAP (Takara), incubated at 30 C for 1 h, and then subjected to Western analysis.
Results Isolation of an alternatively spliced variant of isl1 cDNA
We molecularly cloned isl1 cDNAs from total RNA prepared from the murine insulinoma cell line Journal of Molecular Endocrinology (2003) 31, 419–425
422
K ANDO
and others
· An alternatively spliced variant of Islet-1
Figure 3 Nuclear localization of Isl1 isoforms in MIN6 cells. Expression vectors encoding FLAG-tagged Isl1- and Isl1- were transfected into MIN6 cells. The cells were fixed and stained with anti-FLAG antibody and Alexa Fluor 488-labeled anti-mouse IgG antiserum (upper panels) and with 4,6-diamidino-2-phenylindole (DAPI) (lower panels).
TC6 by using an RT-PCR strategy. Among four clones analyzed by nucleotide sequencing, one clone was found to contain an internal in-frame deletion of 69 nucleotides compared with the previously reported isl1 cDNA. As schematically shown in Fig. 1 (upper panel), this cDNA encodes a protein that lacks 23 amino acids that correspond to amino acids 256–278 of the previously described Isl1. Hereafter, we call this shorter Isl1 isoform Isl1- (GenBank accession number AB104633), and refer to the previously described isoform as Isl1-. A comparison of the nucleotide sequences of the isl1- and isl1- cDNAs with the corresponding mouse genomic sequence revealed that these two mRNA species were generated by the usage of an alternative splicing acceptor site in the fifth exon (Fig. 1, lower panel). Journal of Molecular Endocrinology (2003) 31, 419–425
The isl1- isoform is preferentially expressed in murine insulinoma cell lines
We examined the mRNA expression profile of the two isl1 isoforms. Total RNAs were isolated from mouse glucagonoma (TC1 clone 6) and insulinoma (TC6 and MIN6) cell lines grown in the presence of low (1 mM) or high (20 mM) concentrations of glucose and were analyzed by RT-PCR using specific primer pairs. As shown in Fig. 2, both the isl1- and isl1- isoforms are expressed in TC6 and MIN6 cells, and isl1- is abundant. In contrast, the isl1- isoform is barely detectable in TC1 cells, suggesting that it is preferentially expressed in insulinoma cells. Although a high concentration of glucose activates transcription of the insulin gene in these insulinoma cell www.endocrinology.org
An alternatively spliced variant of Islet-1 ·
K ANDO
and others 423
Figure 4 Activation of the insulin promoter by Isl1- and Isl1-. (A) A luciferase reporter plasmid (0·4 µg) driven by the human insulin promoter was transfected into NIH3T3 cells with varying amounts (0·2, 0·5, 1·0 µg) of FLAG-tagged Isl1- or Isl1- expression plasmids. Data are normalized to basal luciferase activity. (B) Levels of expression of FLAG-Isl1- and FLAG-Isl1-. Extracts prepared from cells used for the luciferase assay were subjected to SDS-PAGE followed by Western analysis using the anti-FLAG antibody. The FLAG-Isl1- and FLAG-Isl1- proteins are indicated by arrows.
lines, the level of glucose in the culture medium had no effect on the levels of expression and on the relative amounts of the two isl1 isoforms. Isl1- is a more potent transactivator than Isl1-
We next tested whether the two Isl1 isoforms are functionally different. For this purpose, we constructed mammalian expression vectors encoding FLAG-tagged Isl1- and Isl1-. MIN6 cells transfected with these constructs were stained with anti-FLAG antibody. Both Isl1- and Isl1- were observed to predominantly localize in the nucleus (Fig. 3). We then transfected both expression vectors into NIH3T3 fibroblast cells together with an insulin promoter-luciferase reporter plasmid. In accord with previous data demonstrating that the transactivation potential of Isl1- is modest (German et al. 1992, Shimomura et al. 2000), we observed a marginal but significant activation of the insulin promoter by Isl1- in a dose-dependent manner (Fig. 4A). We also observed dose-dependent www.endocrinology.org
transactivation by Isl1- to a reproducibly greater extent than by Isl1-. We confirmed the levels of expression of Isl1- and Isl1- by Western blot analysis (Fig. 4B). Although Isl1- accumulated at slightly higher levels than Isl1-, Isl1- appeared to be a relatively stronger transactivator of the insulin gene promoter than Isl1- (for example, compare Isl1- 1·0 µg and Isl1- 0·5 µg, Fig. 4A and B, lanes 4 and 6). Thus, the transactivation activity of Isl1- is relatively higher than that of Isl1-. The Isl1- isoform is phosphorylated
We noticed that FLAG-tagged Isl1- but not Isl1- migrated as a doublet, as shown by Western blot analysis (see Fig. 4B, lane 4). One plausible explanation for this observation is that Isl1- is modified, most likely by phosphorylation. To test this hypothesis, we prepared nuclear extracts from NIH3T3 cells transfected with Isl1- and Isl1-. The extracts were treated with CIAP and subjected to SDS-PAGE/Western blot analysis. As shown in Fig. 5, treatment with CIAP caused the more slowly migrating form of Isl1- to disappear and Journal of Molecular Endocrinology (2003) 31, 419–425
424
K ANDO
and others
· An alternatively spliced variant of Islet-1
Figure 5 Phosphorylation of Isl1-. Nuclear extracts were prepared from NIH3T3 cells transfected with expression plasmids encoding FLAG-tagged Isl1- or Isl1-. Extracts were treated with CIAP and subjected to SDS-PAGE followed by Western analysis using anti-FLAG serum. Arrows indicate Isl1-, Isl1- and the phosphorylated form of Isl1- (Pi-Isl1-).
the more rapidly migrating form to accumulate, indicating that Isl1- is phosphorylated. In contrast, the mobility of Isl1- was not affected by CIAP treatment. These results indicate that Isl1- undergoes phosphorylation that can be distinguished by mobility on SDS-PAGE.
Discussion We isolated a novel splicing variant of isl1 cDNA and analyzed the function of its product, Isl1-, in comparison with the previously reported Isl1-. Although the isl1- isoform represents only a small portion of total isl1 mRNA, it was specifically detected in murine insulinoma cell lines but not glucagonoma cell line, suggestive of a cell lineage-specific regulation of Isl1 splicing. We demonstrated here that Isl1- is phosphorylated. The 23 amino acid region contains two threonine and one serine residues, two of which (Thr263 and Ser269) are each followed by a proline residue and may be targets for MAP kinase family members (Davis 1993). However, from our analysis using CIAP, we cannot conclude that these amino acid residues in the 23 amino acid region are phosphorylated, because there remains a possibility that this region is just required to Journal of Molecular Endocrinology (2003) 31, 419–425
regulate the phosphorylation of other sites of the protein. Furthermore, we cannot exclude the possibility that Isl1- is phosphorylated in a manner that does not affect protein mobility with respect to SDS-PAGE. Although the role of phosphorylation in Isl1 activity is not clear at present, this modification possibly affects the transactivation properties of Isl1, because Isl1- is a relatively more potent transactivator than Isl1-. One possible explanation for this is that the transactivation function of Isl1- is negatively regulated by phosphorylation and that Isl1- escapes this regulation. Previous work has demonstrated that the carboxy terminus (amino acids 310–349) serves as a transactivator domain (Shimomura et al. 2000). The 23 amino acid region present in Isl1- but not Isl1- (amino acids 256–278) is adjacent to this transactivator domain and may thus exert a negative regulatory effect on it. Therefore, Isl1 transactivation activity may be regulated in two ways, by alternative splicing and by phosphorylation. However, as far as we have tested, the isl1- isoform represents only a small portion of total isl1 mRNA in murine insulinoma cell lines. A more detailed expression profile of the two isoforms in pancreatic endocrine cell types, as well as in neuronal tissues, awaits the availability of isoform-specific antibodies, which in turn will clarify the physiological relevance of the isl1- isoform.
Acknowledgements We thank Dr Jun-ichi Miyazaki (Osaka University) for the generous gift of the MIN6 cell line. This work was supported by Grants-in-Aid for Scientific Research on Priority Areas, for Encouragement of Young Scientists, and of the 21st Century COE Program from the Ministry of Education, Culture, Sports, Science and Technology in Japan, and a grant from the Ministry of Health, Labor and Welfare in Japan to K K.
References Ahlgren U, Pfaff SL, Jessell TM, Edlund T & Edlund H 1997 Independent requirement for ISL1 in formation of pancreatic mesenchyme and islet cells. Nature 385 257–260. Davis RJ 1993 The mitogen-activated protein kinase signal transduction pathway. Journal of Biological Chemistry 286 14553–14556. www.endocrinology.org
An alternatively spliced variant of Islet-1 · Dong J, Asa SL & Drucker DJ 1991 Islet cell and extrapancreatic expression of the LIM domain homeobox gene isl-1. Molecular Endocrinology 5 1633–1641. Ericson J, Thor S, Edlund T, Jessell TM & Yamada T 1992 Early stages of motor neuron differentiation revealed by expression of homeobox gene Islet-1. Science 256 1555–1560 German MS, Wang J, Chadwick RB & Rutter WJ 1992 Synergistic activation of the insulin gene by a LIM-homeo domain protein and a basic helix-loop-helix protein: building a functional insulin minienhancer complex. Genes and Development 6 2165–2176. Jurata LW, Kenny DA & Gill GN 1996 Nuclear LIM interactor, a rhombotin and LIM homeodomain interacting protein, is expressed early in neuronal development. PNAS 93 11693–11698. Karlsson O, Thor S, Norberg T, Ohlsson H & Edlund T 1990 Insulin gene enhancer binding protein Isl-1 is a member of a novel class of proteins containing both a homeo- and a Cys-His domain. Nature 344 879–882. Kataoka K, Yoshitomo-Nakagawa K, Shioda S & Nishizawa M 2001 A set of Hox proteins interact with the Maf oncoprotein to inhibit its DNA binding, transactivation, and transforming activities. Journal of Biological Chemistry 276 819–826. Kataoka K, Han SI, Shioda S, Hirai M, Nishizawa M & Handa H 2002 MafA is a glucose-regulated and pancreatic beta-cell-specific transcriptional activator for the insulin gene. Journal of Biological Chemistry 277 49903–49910. Leonard J, Serup P, Gonzalez G, Edlund T & Montminy M 1992 The LIM family transcription factor Isl-1 requires cAMP response element binding protein to promote somatostatin expression in pancreatic islet cells. PNAS 89 6247–6251. Miyazaki J, Araki K, Yamato E, Ikegami H, Asano T, Shibasaki Y, Oka Y & Yamamura K 1990 Establishment of a pancreatic beta
www.endocrinology.org
K ANDO
and others 425
cell line that retains glucose-inducible insulin secretion: special reference to expression of glucose transporter isoforms. Endocrinology 127 126–132. Pfaff SL, Mendelsohn M, Stewart CL, Edlund T & Jessell TM 1996 Requirement for LIM homeobox gene Isl1 in motor neuron generation reveals a motor neuron-dependent step in interneuron differentiation. Cell 84 309–320. Sanchez-Garcia I, Osada H, Forster A & Rabbitts TH 1993 The cysteine-rich LIM domains inhibit DNA binding by the associated homeodomain in Isl-1. EMBO Journal 12 4243–4250. Schreiber E, Matthias P, Muller MM & Schaffner W 1989 Rapid detection of octamer binding proteins with ‘mini-extracts’, prepared from a small number of cells. Nucleic Acids Research 17 6419. Shimomura H, Sanke T, Hanabusa T, Tsunoda K, Furuta H & Nanjo K 2000 Nonsense mutation of islet-1 gene (Q310X) found in a type 2 diabetic patient with a strong family history. Diabetes 49 1597–1600. Thor S, Ericson J, Brannstrom T & Edlund T 1991 The homeodomain LIM protein Isl-1 is expressed in subsets of neurons and endocrine cells in the adult rat. Neuron 7 881–889. Tsuchida T, Ensini M, Morton SB, Baldassare M, Edlund T, Jessell TM & Pfaff SL 1994 Topographic organization of embryonic motor neurons defined by expression of LIM homeobox genes. Cell 79 957–970. Wang M & Drucker DJ 1995 The LIM domain homeobox gene isl-1 is a positive regulator of islet cell-specific proglucagon gene transcription. Journal of Biological Chemistry 270 12646–12652.
Received 9 June 2003 Accepted 20 August 2003
Journal of Molecular Endocrinology (2003) 31, 419–425
