Isolation of Recombinant Protective Helicobacter pylori Antigens

Download PDF
6 downloads 0 Views 185KB Size Report
Comment
A total of seven clones producing both new and previously described Helicobacter pylori proteins were isolated from a library of H. pylori genomic DNA.
INFECTION AND IMMUNITY, Sept. 1999, p. 4713–4719 0019-9567/99/$04.00⫹0 Copyright © 1999, American Society for Microbiology. All Rights Reserved.

Vol. 67, No. 9

Isolation of Recombinant Protective Helicobacter pylori Antigens D. HOCKING,1* E. WEBB,1 F. RADCLIFF,2† L. ROTHEL,1 S. TAYLOR,1 G. PINCZOWER,1 C. KAPOULEAS,1 H. BRALEY,1 A. LEE,2 AND C. DOIDGE1 Research and Development Division, CSL Limited, Parkville, Victoria, Australia 3052,1 and School of Microbiology and Immunology, University of New South Wales, Sydney, New South Wales, Australia 20522 Received 15 March 1999/Returned for modification 23 April 1999/Accepted 21 June 1999

A total of seven clones producing both new and previously described Helicobacter pylori proteins were isolated from a library of H. pylori genomic DNA. The screening approach by which these proteins were detected relied on the use of antisera raised in mice vaccinated with Helicobacter felis sonicate plus cholera toxin, a regimen which protects mice from H. pylori challenge. This strategy was designed to maximize the possibility of obtaining antigens which might be capable of conferring protection from H. pylori infection. Two of the clones were shown to encode the urease enzyme and the heat shock protein HspB, which have already been identified as protective antigens. The other five clones were sequenced, protein coding regions were deduced, and these sequences were amplified by PCR for incorporation into Escherichia coli expression vectors. The proteins produced from these expression systems were purified to allow testing for protective efficacy in an H. pylori mouse model. All five proteins were able to facilitate the clearance of a challenge with H. pylori, as judged by an assay of gastric urease activity and light microscopy on stomach sections. These results clearly indicate that the screening strategy has successfully identified candidate vaccine antigens. Helicobacter pylori is a gram-negative, spiral bacterium which infects the lining of the human stomach (32). It is widely distributed, chronically infecting as much as half of the world’s population. The bacterium appears to spread from person to person by oral-oral or fecal-oral transmission, there being no recognized environmental reservoir. Infection with the bacterium causes an inflammation of the gastric mucosa, or stomach lining, which usually does not resolve, and both infection and inflammation are believed to persist for many decades. Often this is not associated with symptoms, although the chronic infection can lead to an increased risk of a number of sequelae. A significant portion of those infected develop peptic ulceration of the duodenum or stomach (1, 2) when the infection process disrupts the usual protective mechanisms the stomach has against its own digestive products. Also, long periods of infection increase the risk of the development of adenocarcinoma or lymphoma of the stomach wall (22, 24). Therefore, prevention or treatment of H. pylori infection has the potential to prevent considerable mortality and morbidity resulting from the sequelae of chronic infection. In early experiments, H. pylori did not infect conventional laboratory animals. However, a laboratory mouse model of H. pylori infection with the closely related organism Helicobacter felis was developed (7, 16). H. felis is a spiral-shaped bacterium that has a very close DNA homology with H. pylori. The bacterium colonizes the mouse stomach in a manner similar to the way H. pylori colonizes the human stomach. The main ecological niche is gastric mucus, and colonization is mainly seen in the antrum of the stomach. In germfree mice, H. felis infection induces a gastritis that is very similar to human H. pylori infection, with a chronic inflammation of mononuclear cells ac-

companied by a polymorphonuclear leukocyte infiltration. Infection with either organism results in the induction of a similar systemic humoral immune response against H. pylori and H. felis, respectively (16). The H. felis model has proved to be useful for testing anti-H. pylori therapies: those treatments which are ineffectual in humans also fail to eradicate H. felis from murine gastric mucosa (7). The model has also been used to demonstrate that mice can be orally immunized with Helicobacter antigens, either to protect them from becoming infected (5) or to treat them when they are already infected so as to eradicate the infection (8). Antigens that have been used in these vaccines include disrupted cellular preparations from either H. felis or H. pylori, the bacterial enzyme urease from H. felis or H. pylori, or subunits thereof produced from Escherichia coli expressing all or part of the H. pylori urease molecule (21). H. pylori heat shock proteins (HspA and HspB) have also been shown to be protective antigens (11), as has the vacuolating cytotoxin, VacA (20), and the catalase enzyme (27). The fact that antigens derived from H. pylori can be used to protect mice from H. felis infection suggests that there are cross-reactive and cross-protective antigens between the two species. If an immune response to these H. pylori molecules will protect mice from H. felis infection, it is likely that similar immune responses will protect humans from infection with a wide range of H. pylori strains. Urease has been demonstrated to be such a cross-protective molecule in the H. felis and H. pylori mouse models (21). In the present study, in order to identify further cross-reactive and cross-protective antigens, a genomic DNA library from an H. pylori strain has been constructed and screened with serum from mice that had been orally immunized with a vaccine prepared from disrupted H. felis cells and a mucosal adjuvant. The objective was to identify E. coli clones expressing H. pylori proteins recognized by anti-H. felis antibodies and to test these proteins for possible protective activity against H. pylori challenge by using a recently developed murine model of H. pylori infection (15).

* Corresponding author. Mailing address: CSL Limited, 45 Poplar Rd., Parkville, Victoria, Australia 3052. Phone: 61-3-9389-1525. Fax: 61-3-9388-2063. E-mail: [email protected]. † Present address: Department of Haematology and Oncology, Royal Children’s Hospital, Parkville, Victoria, Australia 3052. 4713

4714

HOCKING ET AL.

INFECT. IMMUN. TABLE 1. Oligonucleotides used for PCR

Family

B C E G H

Sequence (5⬘ to 3⬘) Forward

Reverse

CGCCCGGGATGAAAAATCAAGTTAAAAAAATT GGGCCCGGGATGGCAATTTCAAAAGAAG GCGCCCCGGGATGTCAAATAGCATGTTGGATAAAAATAAA CATGCCATGGGCTTTGGGAATAAGCAGTTGCAAC CATGCCATGGGATACGCAAGCAAATTAGCC

MATERIALS AND METHODS Bacterial strains. H. pylori 921023 (a clinical isolate obtained from H. Mitchell, School of Microbiology and Immunology, University of New South Wales) was used as the DNA donor for preparing the gene library. E. coli ER1793 (a gift from E. Raleigh, New England Biolabs, Inc.) was the host used for phage infection and plating of Lambda ZAP Express. E. coli XL1-Blue MRF and XLOLR (Stratagene) were used for the excision of pBK-CMV phagemid and protein expression of cloned genes. Other E. coli expression strains included JM109 (Promega Corp.) and BL21 (Amersham Pharmacia Biotech). H. pylori SS1 (15) was used for challenging mice. H. felis CS1 was used in sonicate form for the preparation of mouse antisera (18). Isolation of H. pylori chromosomal DNA. Whole-cell DNA from H. pylori was prepared essentially as reported by Majewski and Goodwin (19). Antisera preparation. Mouse antisera was raised against H. felis by four orogastric immunizations at weekly intervals (6). Each vaccine dose consisted of 1 mg (protein) of sonicated H. felis CS1 cells and 10 ␮g of cholera toxin (CT; Sigma). At 3 weeks after the last immunization, blood was collected and the serum was pooled. To eliminate or reduce the nonspecific reactivity of antisera with host proteins, this serum was adsorbed with 50% (vol/vol) E. coli extract (Promega Corp.) containing 5% (wt/vol) skim milk and 0.05% (vol/vol) Tween 20 in Tris-buffered saline (TBS) at a final dilution of 1:100. The preparation was incubated at room temperature for 4 h prior to immunoscreening. The specificity of the sera was confirmed by dot blot and Western blot by using dilutions of whole cells of H. pylori as the positive control and E. coli XLOLR as the negative control. Bacterial growth conditions. For infection with Lambda ZAP Express, E. coli ER1793 cells were initially grown in Luria-Bertani (LB) broth supplemented with 0.2% (wt/vol) maltose and 10 mM MgSO4 at 30°C. After infection, cells were maintained in LB broth at 37°C for 15 min, plated on NZY agar medium and incubated at 42°C for 4 h, and then incubated at 37°C overnight. For phagemid excision and plasmid isolation, E. coli XL1-Blue MRF and XLOLR were grown in LB broth at 37°C, and transformed XLOLR cells were selected on LB-kanamycin plates (50 ␮g/ml) at 37°C. Construction of H. pylori gene library. An H. pylori expression library was constructed by using standard procedures (28) in the ZAP Express lambda vector (Stratagene) which had been supplied predigested with BamHI and calf intestinal phosphatase treated. Genomic DNA partially digested with Sau3AI (Promega Corp.) was fractionated by gel electrophoresis, and DNA fragments between 6 and 12 kb were isolated. This DNA was ligated with 1.0 ␮g of BamHI-digested lambda arms. Recombinant phage DNA was packaged in vitro by using Gigapack III Gold packaging extract (Stratagene). The library was titrated by infecting E. coli ER1793 or XL1-Blue MRF cells with aliquots of packaged phage and placed onto indicator plates containing IPTG and X-Gal (isopropyl-␤-D-thiogalactopyranoside and 5-bromo-4-chloro-3-indolyl-␤-D-galactopyranoside, respectively). The ratio of nonrecombinant phage to recombinant phage was 1:5. The titer of the recombinant library was calculated to be 106 PFU per ␮g of lambda DNA. Antibody screening of H. pylori genomic library. A portion of the library was screened by plaque immunoblot assay. A total of 10,000 plaques were plated (2,000 plaques/plate) and lifted onto Hybond-C extra nitrocellulose filters (Amersham) to be processed as described by Sambrook et al. (28). The filters were screened with a 1:100 dilution of anti-H. felis mouse sera at room temperature overnight. After being washed in 0.05% (vol/vol) Tween 20 in TBS, filters were incubated in 1:2,000 goat anti-mouse immunoglobulin G-conjugated horseradish peroxidase for 1.5 h. Filters were washed as described above, and the color reaction was developed with TMB Substrate (Kirkegaard & Perry Laboratories, Inc.). When a positive phage clone was identified, an agar plug containing the plaque was picked and phage eluted into SM buffer (100 mM NaCl, 8.5 mM MgSO4, 0.01% gelatin, 50 mM Tris-HCl [pH 7.5]). To obtain plaque purity, the process of infecting bacteria, replating, and immunoscreening was repeated. In vivo excision of pBK-CMV plasmid from Lambda ZAP Express vector. In vivo excision of pBK-CMV containing H. pylori DNA from Lambda ZAP Express was achieved by infecting E. coli XL1-Blue MRF simultaneously with Lambda ZAP Express containing insert DNA and ExAssist helper phage M13. Excised phagemids were packaged as filamentous phage particles and secreted from host cells, which were subsequently heat killed. The phagemids were rescued by infecting XLOLR cells and plating them onto LB-kanamycin (50 ␮g/ml) plates.

GCAGATCTAACCCTACTTTTAACCATGCCCAA GGGGTCGACTAAGATCTCTTGACTTCAACCTTAGCG GCGCAGATCTAGGTTTAATGGTAACTAACACGCTCATCCC CGGAATTCTCATTCGCCTTTTTGAATTTTTTCAATG CGGAATTCTTATCGGCTTGAAGTGTTCTTTTTC

Resulting bacterial colonies contained pBK-CMV double-stranded phagemid with the cloned DNA insert from H. pylori. These colonies were then analyzed for protein expression. SDS-PAGE and immunoblot analysis of proteins. The total proteins produced by cloned H. pylori DNA in E. coli XLOLR were analyzed by standard sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting techniques (28, 30). Then, 10-ml cultures of XLOLR carrying the expression plasmid were grown in supermedium (25 g of tryptone/liter, 15 g of yeast extract/liter, 5 g of NaCl/liter) at 37°C overnight. Cultures were divided in two: one part was induced with IPTG to a final concentration of 1 mM; the other part remained as an uninduced control culture. Incubation continued for 2 to 4 h. Aliquots of 1 ml were collected and cells were pelleted by centrifugation and resuspended in 10 mM Tris-HCl (pH 8.0). Cells were mixed with an equal volume of SDS sample reducing buffer and boiled for 10 min. Proteins were resolved by electrophoresis on 4 to 20% gradient Tris-glycine gels (Novex) and stained with Coomassie brilliant blue (CBB). A gel run in parallel was electrotransferred onto nitrocellulose membrane (Bio-Rad) for detection of immunoreactive proteins of H. pylori by using anti-H. felis mouse sera as described above. For the molecular mass estimation, the CBB-stained wet gel was scanned with a Molecular Dynamics model 300A densitometer, and the apparent molecular mass was determined relative to standard proteins by using ImageQuant version 3.3 software. Protein N-terminal sequence determination. Proteins to be N-terminal sequenced were separated by SDS-PAGE, transferred onto polyvinylidene difluoride membrane (Novex) in electroblotting buffer (10 mM 3-[cyclohexylamino]1-propanesulfonic acid [CAPS; pH 11.0; Sigma]), stained with 0.1% (wt/vol) CBB in 50% (vol/vol) methanol, and then destained in 50% (vol/vol) methanol until the protein bands were visible. The bands corresponding to immunopositive proteins, identified by Western blot, were excised and sequenced. Amino acid sequencing was performed on an Applied Biosystems model 473A sequencer at the Centre of Animal Biotechnology, School of Veterinary Science, University of Melbourne. Additional sequencing was provided by Auspep Pty., Ltd. DNA preparation and sibling analysis of clones. Plasmid DNA was isolated by the alkaline lysis method (28) from cultures of E. coli XLOLR clones carrying different H. pylori DNA inserts. Restriction enzyme digestions were performed as recommended by the enzyme manufacturer (Promega Corp.). Restriction fragments of cloned H. pylori DNA to be used as probes were resolved by gel electrophoresis in 0.8% agarose, stained with ethidium bromide, excised from the gel, and purified by using a silica matrix (BRESAclean DNA Purification Kit; GeneWorks Pty., Ltd.). The SalI/NotI fragments of 2.5 to 7.0 kb were labelled with [␣-32P]dATP by using a Random Primer DNA Labelling System (Gibco BRL/Life Technologies). For cross-hybridization analysis to determine related clones, cell suspensions of XLOLR clones were dotted onto nitrocellulose and treated according to the manufacturer’s protocol (Amersham). Filters were hybridized at 65°C overnight in a solution containing 2⫻ PE (189 mM Na2HPO4, 22.2 mM NaH2PO4 䡠 2H2O, 80 mM EDTA [pH 8.0]), 1% (wt/vol) skim milk, and 7% (wt/vol) SDS. After hybridization, filters were subjected to one 15-min wash in 2⫻ SSC (1⫻ SSC is 0.15 M NaCl plus 0.015 M sodium citrate)–0.1% (wt/vol) SDS at room temperature and two 30-min washes in 2⫻ SSC–0.1% (wt/vol) SDS at 65°C. The hybridization results were visualized by autoradiography on Kodak Biomax MS film. DNA sequence analysis. Nested deletions were generated by using ExoIII and S1 nucleases (Promega Corp.), and DNA sequencing was performed by using standard dideoxynucleotide termination reactions containing 7-deaza-dGTP (Sequenase Kit; USB). 7-Deaza-dITP was used, if necessary, to resolve severe GC band compressions. [35S]dATP was used as the label. Sequencing reactions were analysed on 6% polyacrylamide wedge gels containing 8 M urea. Internal sequencing primers were synthesized as necessary. Subcloning antigen coding regions into E. coli expression vectors. The specific antigen coding sequences from H. pylori cloned families B, C, E, G, and H were isolated by PCR amplification of representative clones by using the oligonucleotides shown in Table 1, which were designed to contain appropriate restriction endonuclease sites to enable cloning into particular expression vectors. Amplified products from families B, C, and E were cloned into the XmaI/BglII sites of pGEX-STOP vector (a modified version of pGEX-4T-1 [Amersham Pharmacia Biotech], in which a termination codon had been inserted close to the N terminus of glutathione S-transferase (GST) and a ribosome-binding site,

VOL. 67, 1999

CLONING POTENTIALLY PROTECTIVE H. PYLORI ANTIGENS

extra restriction sites, and a six-histidine tag inserted within the multiple cloning site, as described by Cox et al. [4]). This allowed the production of a non-GST fusion protein containing a C-terminal hexa-histidine tag (hexa-His). Constructs of families C and B were expressed in E. coli ER1793, while family E was expressed in E. coli BL21. The amplified product from family G was cloned into the NcoI/EcoRI sites of pSE420 (Invitrogen Corp.) and expressed in E. coli JM109 to provide a nonfusion protein which did not contain a purification tag. In the case of family H, where the production of a native protein proved to be a difficult task, the amplified product was cloned into the BamHI/EcoRI sites of pGEX-3X (Amersham Pharmacia Biotech) to produce a GST fusion protein in E. coli JM109. Growth conditions and the production of recombinant protein. Clones were grown at 37°C in Terrific broth (29), and the induction of recombinant protein production was achieved by the addition of IPTG to a final concentration of 1 mM with continued incubation overnight. Cells were harvested and stored frozen either for subsequent protein purification or for sonication and use as a wholecell immunogen. Isolation and purification of recombinant proteins. (i) Protein B. Protein B was expressed with a hexa-His tag to enable immobilized metal affinity chromatography to be used in the purification process. A pellet of E. coli cells harboring protein B was resuspended by gentle stirring in 50 mM phosphate–50 mM NaCl–1 mM EDTA–5% (vol/vol) glycerol–0.05% NaN3 (pH 7.5). The suspension was subjected to sonication on ice for 3 min and then centrifuged for 30 min at 3,200 ⫻ g. The pellet was resuspended in phosphate-NaCl buffer (50 mM phosphate, 0.5 M NaCl, 0.05% NaN3 [pH 7.5]) and centrifuged at 5,000 ⫻ g. The resulting pellet was resuspended in phosphate-NaCl buffer containing 0.1% Tween, centrifuged, and finally solubilized by agitation on ice overnight in phosphate-NaCl buffer containing 7.5 M urea. The preparation was further centrifuged at 10,000 ⫻ g, and the supernatant was centrifuged twice more. The final supernatant was applied to a column of Chelating Sepharose Fast Flow (Amersham Pharmacia Biotech) that had been charged with nickel according to the manufacturer’s instructions. Contaminants binding to the column were eluted by washing the column with 20 mM phosphate–0.5 M NaCl–50 mM imidazole–7.5 M urea (pH 7.5). Protein B was eluted from the column by using 20 mM phosphate–50 mM NaCl–7.5 M urea (pH 6.0). In order to refold and remove urea from partially purified protein B, fractions containing protein B were pooled and dialyzed against 20 mM phosphate–0.5 M NaCl (pH 7.5) with one change of buffer and then dialyzed against 20 mM phosphate–50 mM NaCl (pH 7.5). The retentate was centrifuged at 3,000 ⫻ g for 30 min, and the supernatant was collected and set aside for further purification. The pellet was resuspended in 20 mM phosphate–50 mM NaCl–7.5 M urea (pH 7.5) and then dialyzed against a 10-fold volume of 0.8 M arginine to aid in protein refolding. Protein content in the resulting retentate was estimated by the DC Protein Assay (Bio-Rad) according to the manufacturer’s instructions by using bovine serum albumin standard (Pierce Chemical Co.). Fractions were analyzed for purity by SDS-PAGE and by gel scan with a densitometer (Molecular Dynamics). Sucrose was added to the retentate at a final concentration of 10% (wt/vol) upon storage. The soluble fraction of protein B prepared above was further purified by application to a column of chelating sepharose Fast Flow by using buffers containing no urea. Protein B was eluted from the column using a linear gradient of 20 mM phosphate–150 mM NaCl (pH 7.5) containing 0 to 100% 0.5 M imidazole. Fractions containing protein B were pooled and dialyzed against phosphate-buffered saline (PBS; 7.7 mM Na2HPO4, 150 mM NaCl, 2.25 mM NaH2PO4), and sucrose was added to the preparation as described above. (ii) Protein C. A cell pellet of E. coli cells expressing protein C with a hexa-His tag was gently resuspended in buffer and sonicated as described for protein B above. The sonicate was centrifuged for 30 min at 5,000 ⫻ g, and the supernatant was collected and further clarified by centrifugation at 16,000 ⫻ g. The clarified supernatant was applied to a column of nickel-charged Chelating Sepharose Fast Flow. Contaminants binding to the column were eluted by washing the column with 20 mM phosphate–0.5 M NaCl–50 mM imidazole (pH 7.5). Protein C was eluted from the column by using a linear gradient of 20 mM phosphate–50 mM NaCl (pH 7.5) containing 0 to 100% 0.5 M imidazole. (iii) Protein E. E. coli cells expressing protein E were pelleted and resuspended in PBS. Cell lysis was achieved by sonication on ice for 3 min. The sonicate was then centrifuged at 10,000 ⫻ g for 20 min, and the pellet was retained. The pellet was washed with PBS, and the centrifugation was repeated. Sonicate pellets were solubilized in 25 mM Tris–7 M urea (pH 9.5) with gentle mixing for 2 h at room temperature. Particulates were removed by three centrifugations at 25,000 ⫻ g for 30 min. The resulting supernatant was retained for chromatography. A Q Sepharose High-Performance Column (Amersham Pharmacia Biotech) was equilibrated with 25 mM Tris–7 M urea (pH 9.5). Solubilized material was applied to the column and washed through with three column volumes of the same buffer. The unbound material, together with the first two column volumes of wash, was collected. Bound material was removed from the column with a further three column volumes of 25 mM Tris–7 M urea–1 M NaCl (pH 9.5). The unbound material contained the purified protein E which was concentrated by diafiltration by using a 10-kDa cutoff membrane (Amicon, Inc.). To lower the urea concentration of the sample, the concentrate was then dialyzed against 50 mM Tris–2 M urea (pH 8.0) for 36 h at 4°C.

4715

(iv) Protein G. A pellet of E. coli cells expressing protein G was suspended in two volumes of 50 mM Tris-HCl–5% glycerol–1 mM dithiothreitol–1 mM Pefabloc SC (Boehringer Mannheim, Roche, Germany) (pH 8.0) and lysed on ice by sonication for a total of 2 min. The sonicate was centrifuged at 10,000 ⫻ g for 30 min. The supernatant was retained with the pH adjusted to 8.0 and the conductivity adjusted to ⬍4.0 ms; the supernatant was applied to a Hiload Q Sepharose HP (Amersham Pharmacia Biotech) column equilibrated in 25 mM Tris-HCl (pH 8.0). Unbound material was washed from the column with 25 mM Tris-HCl (pH 8.0) (8 column volumes [CV]). Bound protein was eluted with a linear gradient 0 to 1 M NaCl (20CV). A peak which eluted at 0.2 M NaCl was identified by SDS-PAGE to contain protein G. Fractions with the highest purity of protein G from this peak were pooled. The protein concentration was estimated as described for protein B. (v) Protein H. E. coli cells expressing protein H were suspended in sonication buffer (10 mM phosphate, 150mM NaCl [pH 7.2]) and sonicated on ice for 3 min. Triton X-100 20% (vol/vol) was added to the sonicate to a final Triton X-100 concentration of 1% (vol/vol); the mixture was then stirred gently for 30 min and centrifuged at 34,000 ⫻ g for 30 min. The pellet was resuspended in 3 volumes of sonication buffer and again sonicated and treated with detergent. The insoluble protein was then solubilized in 20 mM Tris–7.5 M urea (pH 8.0) and passed through a series of membrane filters (Millipore Corp.): prefilter AW, followed by 0.8-␮m type AA, and finally by 0.45-␮m type HVLP. The filtered preparation was loaded onto a Q Sepharose HP Column equilibrated with 30 mM Tris–7.5 M urea (pH 8.0; buffer A). The column was then washed with buffer A. A 10-fold concentration of the flow through was achieved by using a 30-kDa cutoff ultrafiltration membrane (Amicon), and the pH was adjusted to 9.5. Anion exchange was repeated in 30 mM Tris–7.0 M urea (pH 9.5; buffer B). The column was washed with buffer B. The nonadsorbed fraction contained purified protein H and was concentrated ⬃10-fold as described above. The concentration of urea was reduced to ⬍2.0 M by dilution of the final product with sonication buffer. Immunization protocol. Female specific-pathogen-free (SPF) BALB/c mice aged 6 to 8 weeks were obtained for the vaccination studies from Combined Universities Lab Animal Services Pty., Ltd. (CULAS), Little Bay, Sydney, Australia. During all of the immunization experiments the mice were housed under SPF conditions in the School of Microbiology and Immunology Animal House at the University of New South Wales. Animals were housed on a sterile bedding of wood shavings and sawdust and were fed autoclaved rodent cubes (Clarke Holdings, Sydney, Australia); sterile water was supplied ad libitum. Mice in groups of 10, were immunized orogastrically at 7-day intervals (days 0, 7, 14, and 21) with various amounts of protein plus 10 ␮g of CT (Sigma). Test groups included single purified recombinant protein antigens and a combination of some of these proteins. Also tested were preparations of sonicated E. coli cells expressing recombinant antigens which had not undergone a purification process. A combination of these sonicates was also tested. A positive control group of H. pylori sonicate and CT was included. Also, negative control groups included mice immunized with CT alone or PBS alone (both challenged), as well as unimmunized, unchallenged animals. A representative portion of mice were bled from the tail vein prior to challenge (day 28). Mice were challenged with three doses of H. pylori, starting 1 week after the final immunization (days 28, 30, and 32). Mice were sacrificed for analysis on days 52 and 53. Dosage regimen. In the case of E. coli sonicated cells, all mice were given four 100-␮l orogastric doses containing cell sonicate (⬎7mg) in conjunction with 10 ␮g of CT. This large dosage was used because a previous study had indicated that immunization with 1 mg of sonicated E. coli expressing these recombinant H. pylori antigens was insufficient to stimulate protection in the H. felis model (unpublished data). For the purified proteins, mice were dosed orogastrically four times at weekly intervals. For each dosage, group B mice received 200 ␮l of test antigen B in amounts of ⬃114 ␮g of total protein/mouse. The remaining groups received, as follows: group C, 100-␮l dose of antigen C per mouse at ⬃200 ␮g of total protein; group E, a 200-␮l dose of antigen E per mouse at ⬃364 ␮g of total protein; group G, a 150-␮l dose of antigen G per mouse at ⬃200 ␮g of total protein; and group H, a ⬃350-␮l dose split into 200- and 150-␮l volumes per mouse at ⬃1,113 ␮g of total protein. Mice given the combination of purified antigens B, C, and G received a 200-␮l dose/mouse with equal amounts of each protein. The positive control group of mice received a 100-␮l dose of H. pylori sonicate at 1,000 ␮g of total protein. Negative control groups of mice were given a 100-␮l dose of CT or PBS. Challenge. H. pylori SS1 was grown under microaerophilic conditions for 2 days in liquid culture of brain heart infusion (BHI) broth (Oxoid) supplemented with 5% horse serum, Skirrow’s selective supplement, and antibiotics as described by Radcliff et al. (27). The cells were centrifuged, and the concentration was adjusted to approximately 109 cells per ml. Immunized mice and controls were challenged 1 week after the completion of the vaccine schedule with 0.1 ml of this suspension, which was made fresh each day. At 2 weeks after H. pylori challenge, mice were euthanized, and stomachs were collected for assessment of infection. Sample collection. At the endpoint of the experiment, mice were anesthetized by intraperitoneal injection with 50 mg of both ketamine and xylazine (Parnell Laboratories) per kg. Stomach tissue was collected: half of the antral portion of the stomach was used for the rapid urease test (13), which detects the presence

4716

HOCKING ET AL.

INFECT. IMMUN.

FIG. 1. (A) SDS-polyacrylamide gel showing the expression of recombinant H. pylori antigens in E. coli XLOLR, cloned into pBK-CMV. One representative clone for each family of proteins isolated is depicted. (B) Corresponding immunoblot of recombinant H. pylori antigens probed with a 1:100 dilution of mouse anti-H. felis sera. Lanes: 1, prestained molecular mass standards; 2, urease A subunit (⬃30 kDa) and B subunit (⬃62 kDa); 3, Lpp20 doublet (⬃17 and ⬃19 kDa); 4, L7/L12 ribosomal protein (⬃13 kDa); 5, protein E (⬃36 kDa); 6, HspB (⬃55 kDa); 7, protein G (⬃50 kDa); 8, protein H (⬃29 kDa); 9, negative control, pBK-CMV in E. coli XLOLR; 10, positive control, H. pylori 921023 lysate.

of Helicobactor spp. The other half of the stomach was placed in 10% formalin and processed for histology, and 4-␮m sections were stained with May-Gru ¨nwald-Giemsa. Each stomach section was coded and examined blindly for the presence of H. pylori by light microscopy (oil immersion, ⫻1,000). Assessment of Helicobacter infection. The number of bacteria visible in each field of view was counted and recorded, and these scores were then summed. The average was then calculated to give a mean number of bacteria per field of view and hence the colonization score per mouse. Sections were examined from the antrum-body border (five fields of view above and below where the transitional zone was determined to be) through to the end of the antrum. Statistics. The significance of the difference in infection levels between immunized and control mice was assessed by using the chi-square test. Nucleotide sequence accession numbers. The nucleotide sequences coding for the proteins C, E, G, and H have been deposited in GenBank under accession numbers U86609, U86610, U86607, and U86608, respectively.

RESULTS Genomic library screen. In order to clone potential protective antigens of H. pylori, a genomic library of strain HP921023 was constructed in the expression vector Lambda ZAP Express. The library was screened for immunoreactive proteins with sera from mice vaccinated with H. felis in an attempt to detect clones expressing cross-reactive H. pylori antigens. Approximately 10,000 plaques were screened by using the anti-H.

felis mouse serum. Fifty immunopositive clones with various signal intensities were recognized by the mouse serum. These were picked, purified, and expressed in the excised plasmid pBK-CMV for further characterization of the cloned DNA and the encoded proteins. The proteins expressed by these recombinant plasmids were analyzed by SDS-PAGE (Fig. 1A) and immunoblotting (Fig. 1B). The molecular mass of immunoreactive recombinant proteins ranged from approximately 13 to 62 kDa. A pattern emerged whereby clones could be grouped into families based on the protein profile and/or size and the data generated from DNA cross-hybridization studies (Table 2). Families were named alphabetically for convenience. Urease AB clone identity. Positive clones were screened for the presence of urease homology since the genomic DNA used in the generation of the library was obtained from a UreABpositive strain of H. pylori and urease is a known, cloned protective antigen (21). Hybridization with oligonucleotide probes to UreA and UreB genes identified five clones as urease A and urease B positive (Table 2). All of the urease-positive clones were grouped as family A. The identity of the 62- and 33-kDa proteins was confirmed by protein N-terminal sequencing. Protein homology searches in the database Swiss-Prot/GenPeptide

TABLE 2. Summary of cloned H. pylori antigen families Family

No. of clones

Urease AB hybridization oligonucleotide A and B

A

5

Yes

B

14

No

C E F G H

10 1 1 2 1

No No No No No

a b

Protein molecular mass (kDa)

Protein N-terminal sequence

Protein identity (from database)

⬃62 ⬃33 ⬃19 ⬃17 ⬃13 ⬃36 ⬃55 ⬃50 ⬃29

MKKISRKEYV MKLTPKELDKLMLHRAGE MLNQVLLKLGMSVKAAMV Not determined MISKEEVLEYIGSLS Not determined AKEIKFVDAARNLFF MFGFKQLQLQFSQK Not determined

Urease B subunita Urease A subunita Lpp20a Mature Lpp20 L7/L12b, ribosomal protein Unknown HspBa Unknown Unknown

N-terminal sequences were compared with those in the Swiss-Prot/GenPeptide database. Data from DNA sequence analysis.

CLONING POTENTIALLY PROTECTIVE H. PYLORI ANTIGENS

VOL. 67, 1999

4717

TABLE 3. Expression and purification of H. pylori antigens Solubilitya (%)

Expression level (% total E. coli protein)

Protein

Purification tag

B

Hexa-His

⬎90, I

5

C E

Hexa-His Hexa-His

S I

5 4

G H

None GST

50, PS I

a

10 15

Ease of purification

Affinity chromatography; refolding by dialysis; affinity chromatography Affinity chromatography Anion exchange; concentration; refolding by dialysis Anion exchange Anion exchange; concentration; anion exchange

Degree of purity (%)

Yield (mg/liter of cell culture)

⬎90

0.4

⬎90 13

3.4 0.15

⬎80 35

16 8.3

I, insoluble; S, soluble; PS, protein soluble.

identified 100% homology of the 10-amino-acid residues of the 62-kDa protein with the urease B subunit of H. pylori. Similarly, the 18-amino-acid sequence of the 33-kDa protein was found to have 94.4% homology with the urease A subunit, with only one mismatched amino acid residue. DNA and N-terminal amino acid sequence analysis. Preliminary protein N-terminal sequence was also obtained from a representative clone of families B, C, F, and G. The amino acid sequence of the 19-kDa protein of family B corresponded to a membrane-associated lipoprotein antigen of H. pylori designated as Lpp20 by Kostrzynska et al. (14). Protein sequence data for the 55-kDa protein from family F exhibited ca. 80% homology with the first 15 N-terminal amino acids residues of the heat shock protein B (HspB) sequence of H. pylori, with only three residues mismatched. This finding supported the immunoblotting results in that it explained the high signal intensity of this immunoreactive band, as heat shock proteins are known to elicit a strong antibody response. No significant homology was found in the database to the 13-kDa protein of family C or to the 48-kDa protein of family G. Subsequent DNA sequence information has identified C as the L7/L12 ribosomal protein homologue of H. pylori. However, the identity of proteins E, G, and H remains largely unknown following DNA sequence analysis, although E and H have a potential N-terminal membrane sequence and G has a sequence common to proteins involved in signal transduction. Moreover, DNA sequencing of these clones has identified some errors in the N-terminal amino acid sequences reported in Table 2 for family G (with the changes Phe[4] to Asn[4] and Phe[11] to Ile[11]), and for family C an additional residue was found to be alanine, as the second residue, with isoleucine positioned instead as the third residue. Using the information provided by DNA sequence analysis in conjunction with the observed molecular weight and the known N-terminal sequences where available, we were able to identify the protein coding regions. Protein expression. The protein coding regions identified were amplified and cloned into vectors to allow controlled expression in E. coli. The cell pellet from 10 to 32 liters of culture was processed for purification. Although some effort was made toward optimizing expression levels, the recombinant proteins were expressed at different levels (Table 3), with family G and H proteins reaching 10 and 15% of the total E. coli protein content, respectively, and other proteins produced at somewhat lower levels. Furthermore, the ease of purification of these proteins differed markedly (Table 3), with yields of purified protein ranging from 0.15 to 16 mg/liter and the degree of purity ranging from 13 to ⬎90%. Prophylactic efficacy study with a H. pylori mouse model. The purified and semipurified proteins were used to test their protective efficacy against H. pylori infection in a H. pylori

mouse model following the dosage regimen described in Materials and Methods. Preparations of sonicated E. coli expressing the recombinant antigens were also tested. In the latter case, the sonicate of family E protected a significant number of mice from H. pylori challenge when compared with control groups (␹2, P ⬍ 0.05) (data not shown). This was the only sonicate preparation able to stimulate protection other than the H. pylori sonicate plus CT, which induced a superior level of protection when compared to all other remaining groups (␹2, P ⬍ 0.05), (data not shown). Immunization with purified preparations of recombinant H. pylori antigens proved to be a more successful strategy for identifying potential vaccine candidates (Table 4). Mice immunized with individual preparations of family B, C, E, G, and H antigens, as well as by a combination of antigens, all had significantly reduced levels of H. pylori infection compared to the negative control groups (␹2, P ⬍ 0.05) (Tables 4 and 5). The number of mice in those groups that were protected from H. pylori challenge was statistically equivalent to the level of protection seen in the positive control group (H. pylori sonicate plus CT; 100%). A sixfold improvement in protection level was achieved when protein C was given in purified form compared with the sonicate. Purified protein G also gave an increased level of protection over the sonicate equivalent, even though ⬃3.5-fold less antigen was given. Only protein E exhibited the same level of protection for both sonicated and semi purified preparations. However, in terms of dose this equates to approximately sixfold increase in response as the low degree of purity (13%), and the low dosage of total protein in the latter sample meant that sixfold less protein E was administered. Most notably, immunization with the purified recombinant lipoprotein Lpp20 and the ⬃29-kDa protein H of unknown identity gave significant levels of protection 80% each, despite the fact that 3-fold and 2.5-fold less antigen was given in each case. The high level of protection seen with individual antigens was not augmented by a combination of a particular subset of these antigens (B, C, and G) also included for testing. Limited quantities of proteins E and H precluded testing them in combination. However, subsequent testing of combinations including these antigens may provide protective efficacy equivalent to the positive control. DISCUSSION The concept that antigens which may be protective against H. pylori can be identified by using H. felis protective antisera has resulted in the isolation from a H. pylori gene library of a number of E. coli clones expressing H. pylori immunoreactive proteins. Interestingly, two of these proteins proved to be the urease enzyme (A and B subunits) and the heat shock protein HspB, which have already been demonstrated to be protective

4718

INFECT. IMMUN.

HOCKING ET AL. TABLE 4. H. pylori SS1 infection levels at 3 weeks postchallenge in female SPF BALB/c mice immunized with a range of purified recombinant H. pylori antigensa

Expt group

Proteins B*d C* E* G* H* B, C, and G*

Protein identity or function

Lpp20 L7/L12 ribosomal protein Secreted protein Signal transduction Secreted protein NA

Controls H. pylori plus CT* PBS alone CT alone Normal

Dosage/immunization (␮g)b

⬃114 ⬃200 ⬃50 ⬃200 ⬃389 NA 1,000 ⫹ 10 NA 10 NA

H. pylori infection (no. of infected mice/total no. in group) Gastric urease assay

Histology c

0/10 1/10 0/9 3/8 1/10 1/10

2/10 4/10 4/9 4/8 2/10 3/10

0/10 8/9 9/10 0/10

0/10 7/9 10/10 0/10

a H. pylori SS1 colonization was initially determined via gastric urease assay and later confirmed by light microscopy on May-Gru ¨nwald-Giemsa-stained stomach sections. NA, not applicable. b Amount of purified antigen delivered calculated from the percent purity obtained for each recombinant protein. c Mice considered to be protected from H. pylori challenge included animals with a “minimal” infection, which was defined as a colonization score that was 1/10 of the average score in the negative control groups (⬍0.61 organisms/field of view). Data for the mean number of organisms per field of view for individual mice are presented in Table 5. d *, P ⬍ 0.05 (␹2).

antigens (3, 11, 12, 17, 21), thus providing confidence that this screening procedure has the potential to identify H. pylori vaccine candidates. Two other proteins corresponded to known sequences. These were a lipoprotein designated Lpp20 by Koztryznska et al. (14) and a L7/L12 ribosomal protein which was identified by sequence homology with other bacterial species. The remaining three proteins are of unknown identity and function, although the protein sequence of two (antigens E and H) would indicate a possible membrane location, each having a potential amino-terminal hydrophobic domain which may function as a transmembrane signal or anchor. However, Tomb et al. (31)

TABLE 5. Colonization data obtained after immunization with a range of purified recombinant H. pylori proteins Expt group

Proteins B C E G H B, C, and G Controls H. pylori ⫹ CT PBS alone CT alone Normal

Colonization scores for individual mice (mean nos. of organisms/field of view/stomach)

0.03, 1.15, 0.10, 1.00, 0.21, 0, 0, 0, 0.10, 0.02 0.22, 0.15, 0, 1.35, 1.98, 0.36, 0.875, 0.38, 2.96, 0.22 0, 0.16, 1.36, 0.74, 0.33, 0, 0, 1.375, 1.34 2.34, 0.26, 1.92, 0.176, 0.18, 0, 3.94, 2.07 0.10, 0, 0.60, 0.23, 0.63, 0.26, 3.88, 0, 0.59, 0.425 0, 7.71, 0, 2.90, 0.43, 0.13, 0, 0.10, 3.07, 0.21 0.04, 0.10, 0, 0, 0, 0, 0, 0, 0, 0.18 0.94, 4.30, 7.50, 4.70, 5.72, 0, 16.01, 0.056, 4.01 7.30, 1.47, 2.17, 14.28, 6.7, 2.41, 14.06, 3.38, 13.85, 1.00 All zero

have assigned putative identities to proteins E, G, and H as a conserved hypothetical secreted protein, a hemolysin secretion protein precursor, and a conserved hypothetical secreted protein, respectively, based on the amount of identity with other proteins in the database. One of the advantages of using a cross-species screening approach is the likely ability to select antigens which are conserved between H. pylori and H. felis, two organisms which have ca. 95% homology (25). It is therefore probable that antigens which are shared between these two species will have a high probability of conservation across H. pylori strains, thus providing generic vaccine candidates. Another perceived advantage of the screening strategy was the potential to limit the number of putative antigens to be examined to those in a protective mixture (lysate) capable of raising an antibody response. This was well supported by the isolation of only seven different expressed proteins. Regardless of whether antibodies are the protective mechanism or not in this model, they are markers for recognition by the immune system. When tested for protective efficacy in an H. pylori mouse model (15), the five new candidate antigens in purified form all elicited significant levels of protection compared to the control groups, with Lpp20 and antigens E and H emerging as the most likely vaccine candidates. Protection against infection and disease by extracellular bacteria, where the mechanism has been elucidated, has usually been shown to be mediated by antibodies against a limited range of secreted or surface components of the bacterium. However, the number of H. pylori proteins shown to be effective protective antigens in animal models, including those shown in this publication, is surprising large. Also, the location of one antigen shown to be protective in this study, antigen C, is intracellular. While other intracellular protective antigens such as urease, HspB, and catalase have been detected on the surface of intact organisms grown in broth culture (26), this property has been attributed to cell autolysis and the adherence of released proteins to the cell membranes of intact H. pylori cells. Similarly, both urease and HspB have been detected on the cell surface

CLONING POTENTIALLY PROTECTIVE H. PYLORI ANTIGENS

VOL. 67, 1999

of H. pylori in vivo from human gastric biopsies (9). In vitro localization studies in H. pylori are currently under way to ascertain the position occupied by antigens E and H. All of the immunogenic proteins identified by the screening procedure used here were shown to be protective in this animal model. The significant number and probably the internal location of some H. pylori protective antigens suggests that protection may not be mediated through antibody-dependent mechanisms. This may be partly explained by recent evidence that the protective effect seen in mice appears to be T-cell mediated (10, 23), thus requiring T-cell recognition rather than specific antibody action. T-cell-mediated protection would predict a broader range of protective antigens than the situation where protection was mediated by specific antibody action. This study reports the identification of novel H. pylori antigens that can give significant protection against H. pylori challenge when administered orogastrically with a mucosal adjuvant in a mouse model system. The protection afforded by immunization in this model does not appear to be complete, at least in some animals, even with lysate. This may reflect limitations in the immune mechanisms involved or else a requirement for multiple antigens or improved adjuvants and delivery systems. The proteins isolated via the screening and selection strategy presented here are worthy of consideration as vaccine candidates for prophylactic and therapeutic use in humans. ACKNOWLEDGMENTS This study was part of a collaborative research program between CSL Limited and The University of NSW. We thank John Wilson for expert assistance with animal work and Kirsten Vandenberg and Mary Papadopoulos for their excellent technical support. REFERENCES 1. Bell, G. D. 1993. Clinical aspects of infection with Helicobacter pylori. Commun. Dis. Rep. CDR Rev. 3:59–62. 2. Blaser, M. J. 1992. Helicobacter pylori: its role in disease. Clin. Infect. Dis. 15:386–391. 3. Corthesy-Theulaz, I., N. Porta, M. Glauser, E. Saraga, A. C. Vaney, R. Haas, J. P. Kraehenbuhl, A. L. Blum, and P. Michetti. 1995. Oral immunization with Helicobacter pylori urease B subunit as a treatment against Helicobacter infection in mice. Gastroenterology 109:115–121. 4. Cox, J. C., S. J. Edwards, I. Frazer, and E. A. Webb. 21 December 1996. Variants of human papilloma virus antigens. Patent WO9619496. 5. Chen, M., A. Lee, and S. Hazell. 1992. Immunisation against gastric helicobacter infection in a mouse/Helicobacter felis model. Lancet 339:1120–1121 (Letter.) 6. Czinn, S. J., A. Cai, and J. G. Nedrud. 1993. Protection of germ-free mice from infection by Helicobacter felis after active oral or passive IgA immunisation. Vaccine 11:637–642. 7. Dick-Hegedus, E., and A. Lee. 1991. Use of a mouse model to examine anti-Helicobacter pylori agents. Scand. J. Gastroenterol. 26:909–915. 8. Doidge, C., I. Gust, A. Lee, F. Buck, S. Hazell, and U. Manne. 1994. Therapeutic immunisation against Helicobacter infection. Lancet 343:914–915. 9. Dunn, B. E., N. B. Vakil, B. G. Schneider, M. M. Miller, J. B. Ziter, T. Peutz, and S. H. Phadnis. 1997. Localization of Helicobacter pylori urease and heat shock protein in human gastric biopsies. Infect. Immun. 65:1181–1188. 10. Ermak, T. H., P. J. Giannasca, R. Nichols, G. A. Myers, J. Nedrud, R. Weltzin, C. K. Lee, H. Kleanthous, and T. P. Monath. 1998. Immunization of mice with urease vaccine affords protection against Helicobacter pylori infection in the absence of antibodies and is mediated by MHC class II-restricted responses. J. Exp. Med. 188:2277–2288. 11. Ferrero, R., J. Thiberge, I. Kansau, N. Wuscher, M. Huerre, and A. Labigne.

Editor: D. L. Burns

12.

13. 14. 15. 16. 17. 18. 19. 20. 21.

22. 23.

24. 25.

26.

27. 28. 29. 30. 31.

32.

4719

1995. The GroES homolog of Helicobacter pylori confers protective immunity against mucosal infection in mice. Proc. Natl. Acad. Sci. USA 92:6499–6503. Ferrero, R. L., J. M. Thiberge, M. Huerre, and A. Labigne. 1994. Recombinant antigens prepared from the urease subunits of Helicobacter spp: evidence of protection in a mouse model of gastric infection. Infect. Immun. 62:4981–4989. Hazell, S., T. Borody, A. Gal, and A. Lee. 1987. Campylobacter pyloridis gastritis. I. Detection of urease as a marker of bacterial colonization and gastritis. Am. J. Gastroenterol. 82:292–296. Kostrzynska, M., P. W. O’Toole, D. E. Taylor, and T. J. Trust. 1994. Molecular characterization of a conserved 20-kilodalton membrane-associated lipoprotein antigen of Helicobacter pylori. J. Bacteriol. 176:5938–5948. Lee, A., J. O’Rourke, M. C. de Ungria, B. Robertson, G. Daskalopoulos, and M. F. Dixon. 1997. A standardized mouse model of Helicobacter pylori infection—introducing the Sydney strain. Gastroenterology 112:1386–1397. Lee, A., J. Fox, G. Otto, and J. Murphy. 1990. A small animal model of human Helicobacter pylori active chronic gastritis. Gastroenterology 99:1315–1323. Lee, A., M. F. Dixon, S. J. Danon, E. Kuipers, F. Megraud, H. Larsson, and B. Mellgard. 1995. Local acid production and Helicobacter pylori: a unifying hypothesis of gastroduodenal disease. Eur. J. Gastroenterol. Hepatol. 7:461–465. Lee, A., S. L. Hazell, J. O’Rourke, and S. Kouprach. 1988. Isolation of a spiral-shaped bacterium from the cat stomach. Infect. Immun. 56:2843–2850. Majewski, S. I., and C. S. Goodwin. 1988. Restriction endonuclease analysis of the genome of Campylobacter pylori with a rapid extraction method: evidence for considerable genomic variation. J. Infect. Dis. 157:465–471. Marchetti, M., B. Arico ´, D. Burroni, N. Figura, R. Rappuoli, and P. Ghiara. 1995. Development of a mouse model of Helicobacter pylori infection that mimics human disease. Science 267:1655–1658. Michetti, P., I. Corthesy-Theulaz, C. Davin, R. Haas, A. Vaney, M. Heitz, J. Bille, J. Krachenbuhl, E. Saraga, and A. Blum. 1994. Immunization of BALB/c mice against Helicobacter felis infection with H. pylori urease. Gastroenterology 107:1002–1011. Nomura, A., G. N. Stemmermann, P. H. Chyou, I. Kato, G. I. Perez-Perez, and M. J. Blaser. 1991. Helicobacter pylori infection and gastric carcinoma among Japanese Americans in Hawaii. N. Engl. J. Med. 325:1132–1136. Pappo, J., D. Torrey, L. Castriotta, A. Savinainen, Z. Kabok, and A. Ibraghimov. 1999. Helicobacter pylori infection in immunized mice lacking major histocompatibility complex class I and class II functions. Infect. Immun. 67:337–341. Parsonnet, J. 1993. Helicobacter pylori and gastric cancer. Gastroenterol. Clin. North Am. 22:89–104. Paster, B. J., A. Lee, J. G. Fox, F. E. Dewhirst, L. A. Tordoff, G. J. Fraser, J. L. O’Rourke, N. S. Taylor, and R. Ferrero. 1991. Phylogeny of Helicobacter felis sp. nov., Helicobacter mustelae, and related bacteria. Int. J. Syst. Bacteriol. 41:31–38. Phadnis, S. H., M. H. Parlow, M. Levy, D. Ilver, C. M. Caulkins, J. B. Connors, and B. E. Dunn. 1996. Surface localization of Helicobacter pylori urease and a heat shock protein homolog requires bacterial autolysis. Infect. Immun. 64:905–912. Radcliff, F. J., S. L. Hazell, T. Kolesnikow, C. Doidge, and A. Lee. 1997. Catalase, a novel antigen for Helicobacter pylori vaccination. Infect. Immun. 65:4668–4674. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Tartof, K. D., and C. A. Hobbs. 1987. Improved media for growing plasmid and cosmid clones. Bethesda Res. Lab. Focus 9:12. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76:4350–4354. Tomb, J.-F., O. White, A. R. Kerlavage, R. A. Clayton, G. G. Sutton, R. D. Fleischmann, K. A. Ketchum, H. P. Klenk, S. Gill, B. A. Dougherty, K. Nelson, J. Quackenbush, L. Zhou, E. F. Kirkness, S. Peterson, B. Loftus, D. Richardson, R. Dodson, H. G. Khalak, A. Glodek, K. McKenney, L. M. Fitzegerald, N. Lee, M. D. Adams, E. K. Hickey, D. E. Berg, J. D. Gocayne, T. R. Utterback, J. D. Peterson, J. M. Kelley, M. D. Cotton, J. M. Weidman, C. Fujii, C. Bowman, L. Watthey, E. Wallin, W. S. Hayes, M. Borodovsky, P. D. Karp, H. O. Smith, C. M. Fraser, and J. C. Venter. 1997. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388:539–547. Warren, J. R., and B. J. Marshall. 1983. Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet i:1273–1275.