(J) jameson - Nature

© 1998 Nature America Inc. • http://genetics.nature.com

letter

Role of Ahch in gonadal development and gametogenesis

Ahch (also known as Dax1) encodes a transcription factor that has been implicated in sex determination and gonadal differentiation1–3. Mutations in human AHC cause X-linked, adrenal hypoplasia congenita (AHC) and hypogonadotropic hypogonadism4,5 (HH). Duplication of the Xp21 dosage-sensitive sex reversal (DSS) region, which contains the Ahch locus1, and transgenic overexpression of Ahch (ref. 6) cause male-to-female sex reversal. Using Cre-mediated disruption of Ahch, we have generated a mouse model of AHC-HH that allows the function of Ahch to be examined in both males and females. Although Ahch has been postulated to function as an ovarian determination gene2,6, the loss of Ahch function in females does not affect ovarian development or fertility. Ahch is instead essential for the maintenance of spermatogenesis. Lack of Ahch causes progressive degeneration of the testicular germinal epithelium independent of abnormalities in gonadotropin and testosterone production and results in male sterility. Ahch is thus not an ovarian determining gene, but rather has a critical role in spermatogenesis.

Ahch encodes Dax-1, a member of the nuclear hormone receptor superfamily that lacks a typical zinc-finger DNA-binding domain4. It is expressed in the developing urogenital ridge, ovary, testis, adrenal cortex, hypothalamus and anterior pituitary gland2, and it colocalizes with another orphan nuclear receptor, steroidogenic factor 1 (Sf-1; ref. 7). Sf-1 activates Ahch,

and its gene product, Dax-1, inhibits the transcriptional activity of Sf-1 through protein-protein interactions8–11, suggesting that they act in a common genetic pathway. Disruption of mouse Ftzf1, which encodes Sf-1, leads to complete adrenal and gonadal agenesis, persistence of Müllerian structures in male mice and hypothalamic and pituitary abnormalities12–14. AHC mutations in humans cause an X-linked syndrome with AHC and HH. This disorder is characterized by adrenal insufficiency, which usually presents in early infancy, and reflects the abnormal development of the adult zone of the adrenal cortex15. Later in life, affected males fail to undergo puberty. They have low serum gonadotropin levels and there is evidence for hormonal defects at both the hypothalamic and pituitary levels15,16. Females who are heterozygous carriers of AHC mutations are normal and there are no descriptions of female homozygotes with AHC mutations, presumably because males who would transmit the disease are infertile. Although the salient clinical and hormonal manifestations of AHC have been well characterized in humans, it has not been possible to study the effects of AHC mutations during organ development. Several lines of evidence indicate that AHC may have a role in ovarian development. A duplication of the DSS locus at Xp21, which encompasses AHC, causes phenotypic male-to-female sex reversal in XY genetic males1. Recently, it was also shown that transgenic overexpression of Ahch antagonizes

a

loxP loxP

b

c

loxP

d Ahch/∆2


Richard N. Yu1, Masafumi Ito1, Thomas L. Saunders2, Sally A. Camper2 & J. Larry Jameson1

Ahch Gapd Ahch Gapd Ahch Gapd

Fig. 1 Targeted mutagenesis of Ahch. Dax-1 has a unique N-terminal DNAbinding domain and a C-terminal domain similar to that of the orphan nuclear receptors. a, Structure of mouse Ahch and the loxP-containing targeting vector. Ahch consists of two coding exons and a single intron. The first exon contains the N terminus and 63% of the C-terminal coding region. The second exon contains the remaining 37% of the C-terminal coding sequence. Ahch was isolated from a mouse genomic DNA library, mapped and sequenced. The two exons are depicted as boxes. The targeting vector contains 5.5 kb of 5’ and 3.1 kb of 3’ gene sequences. A single loxP site was inserted upstream of the splice acceptor signal of exon 2. The phosphoglycerate kinase (PGK) promoterdriven, floxed neomycin cassette was inserted downstream of exon 2 and a PGK promoter-driven thymidine kinase (tk) gene cassette was placed upstream of exon 1. E, EcoRI; H, HindIII. b, Structure of targeted Ahch, before and after Cre-mediated recombination of the loxP sites. Animals carrying the loxP-modified Ahch were mated with mice harbouring the CMV-driven, Cre recombinase transgene to effect deletion of the second coding exon of Ahch. c, Southernblot analysis of wild-type and Ahch-deleted mice following HindIII digestion. In wild-type mice, a HindIII digest generates 4.3- and 3.8-kb hybridizing fragments of Ahch. The targeted Ahch allele converts the 3.8-kb fragment to 3.5 kb, reflecting insertion of a new HindIII site adjacent to the neomycin gene. After Cre-mediated excision of exon 2 and the neomycin gene, the 3.5-kb fragment is reduced to 3.0 kb. The restriction fragments obtained correspond with the expected genotype. flox2, Ahch allele with loxP sites flanking the exon 2; ∆2, Ahch allele with deletion of exon 2. d, RT-PCR analysis of mRNA isolated from Ahch target tissues in wild-type and Ahch-deleted mice. Primers specific for Ahch exons 1 and 2 or Gapd coding sequences were used for amplification. Only full-length Ahch transcripts that are correctly spliced and contain the second exon are detected using this Ahch primer set. Ahch transcripts are detected in wild-type target tissues but are absent in mutant tissues. ∆2/Y, male deletion mutant; ∆2/∆2, female deletion mutant.

1Division of Endocrinology, Metabolism, and Molecular Medicine, Northwestern University Medical School, 303 East Superior Street, Chicago, Illinois 60611, USA. 2Department of Human Genetics, University of Michigan Medical School, 1500 West Medical Center Drive, Ann Arbor, Michigan 48109, USA.

Correspondence should be addressed to J.L.J. (e-mail: [email protected]). nature genetics volume 20 december 1998

353

letter


Ahch∆2/Y


wild-type

a

b

c

d

the function of Sry, preventing normal testes development and converting the bipotential gonad towards the ovarian lineage6. A mouse model of Ahch deficiency would be useful to further elucidate the role of Ahch in adrenal development, male reproductive function and gonadal sex determination. A standard strategy for gene targeting in which a neomycin selection marker cassette replaced the first exon of Ahch failed to generate undifferentiated embryonic stem (ES) cells (data not shown). Therefore, we used Cre-loxP recombination17 to allow targeting of the Ahch locus in ES cells and to permit transmission of a disrupted X-linked Ahch to both male and female offspring. loxP recombination sites were introduced on either side of exon 2 of the mouse Ahch locus and downstream of the neomycin cassette (Fig. 1a). Deletion or point mutations of this Ahch exon are known to cause AHC and HH (ref. 15). Cre-mediated excision of the loxP-targeted (‘floxed’) gene in transfected ES cells generated multiple cell lines exhibiting deletion of the neomycin cassette. None of the isolates, however, contained a deleted Ahch second exon (data not shown), consistent with the idea that Ahch function is necessary to sustain growth of the undifferentiated ES cells. For this reason, Cre-mediated excision was performed in vivo by cross-breeding mice harbouring the cytomegalovirus (CMV) promoter–Cre transgene (Fig. 1b). As ES cells are XYderived, this strategy allows the chimaeric, loxP-targeted male mice to retain fertility, permitting transmission of the targeted gene to subsequent generations. Four targeted ES cell lines were used to generate chimaeric, floxed Ahch male mice (Ahchflox2/Y). Transmission of the floxed Ahch second exon was confirmed in the offspring of chimaeric animals by PCR (data not shown) and Southern-blot analyses (Fig. 1c). We saw no phenotypic abnormalities in mice heterozygous or homozygous for the loxP-modified Ahch locus. Mating with CMV-Cre mice resulted in deletion of the Ahch second exon in preimplantation embryos (Fig. 1b,c). Female offspring carry both normal and Ahch-deleted alleles (AhchAhch/∆2), along with the autosomal Cre transgene. Male offspring have only a single Ahch-deleted allele (Ahch∆2/Y). The CMV-Cre transgene effectively removes the floxed second exon. There is no detectable expression of full-length Ahch transcript in tissues in which it is Fig. 3 Effect of Ahch mutation on testicular histology and spermatogenesis. Testes of wild-type and Ahch-deleted 6-week-old mice (a) are shown, as well as testes from wild-type (b, newborn; d, 2 weeks; f, 10 weeks) and Ahch-deleted mice (c, newborn; e, 2 weeks; g, 10 weeks) of various ages at ×200 magnification. Note the progressive loss of the germinal epithelium during postnatal testicular maturation. Sertoli cells are retained. Immunohistological staining for P450 side chain cleavage enzyme in 10-week-old mice is shown (h, wild-type; i, mutant). Interstitial Leydig cells demonstrate cellular hypertrophy and hyperplasia adjacent to severely degenerated tubules.

354

Fig. 2 Adrenal gland histology in Ahch-deleted mice. Adrenal gland histology (×200 magnification) in male wild-type (a,c, 10 weeks) or Ahch-deleted mice (b,d, 10 weeks). Note the persistence of the fetal zone of the adrenal cortex in the Ahch-deleted mice (white bar). Haematoxylin and eosin stains are shown in (a) and (b). Immunohistological staining for P450 side chain cleavage enzyme is shown in (c) and (d).

normally produced (Fig. 1d), and the deleted gene is transmitted through the germ line. Ahch∆2/Y mice are externally indistinguishable from their wildtype littermates and are similar in size (data not shown). Development of the fetal and adult cortical zones in Ahch∆2/Y adrenal glands are similar to wild-type mice until sexual maturation (Fig. 2a,b). The outer adult cortical zone of Ahch∆2/Y mice have normal zonae glomerulosa and fasciculata, but the fetal X-zone fails to regress as normally occurs after puberty18. The retention of the fetal zone in Ahch∆2/Y males resembles the adrenal defect in humans with ACH, in that the adrenal cortex contains fetal-type cells, but it differs in that the adult zone is absent in humans with ACH (ref. 4). Immunohistochemical staining of P450 side-chain cleavage enzyme is present in both wild-type and mutant adrenal glands, but the reaction is weaker in the less well-developed zona fasciculata of mutant mice (Fig. 2c,d). Consistent with the relatively normal structure of the adrenal gland in mutant mice, the serum corticosterone levels are similar to those of wild-type animals (data not shown). These results suggest that Ahch function is required for the initiation of fetal adrenal degeneration, but it is not necessary for the formation of the definitive cortex or steroidogenesis in mice. Ahch∆2/Y

wild-type

a

Ahch∆2/Y

wild-type

b

c

d

e

f

g

h

i

newborn

2 weeks

10 weeks

10 weeks

nature genetics volume 20 december 1998

letter


Ahch∆2/∆2


wild-type

a

c

b

d

Fig. 4 Formation of abnormal ovarian follicles in Ahch mutant mice. Follicles from an 8-week-old wild-type mouse at ×200 (a) and ×400 (b) magnification. Follicles from an 8-week-old Ahch-deleted mouse at ×200 (c) and ×400 (d) magnification. Although Ahch has been suggested as a candidate ovarian determination gene, homozygous deletion mutation of Ahch in females does not result in the absence or alteration of ovary formation. Note the presence of three ova in a single follicular structure (d).

Ahch∆2/Y males are hypogonadal, and paired testicular weights are reduced by approximately one-half in comparison with wildtype males (wild type, 0.17g±0.02; mutant, 0.09g±0.01; Fig. 3a). Cryptorchidism does not occur and reproductive organs other than the testes are normal. Testosterone production during embryonic and early postnatal development is sufficient for the formation of male internal and external genitalia, for testicular descent and for the normal development of the testosterone-sensitive seminal vesicles. Testes from immature Ahch∆2/Y animals demonstrate a lack of stratification of the germinal epithelium (Fig. 3e). Early pachytene stage spermatocytes fill the tubules, obscuring the central lumen. At 10 weeks, seminiferous tubules exhibit a spectrum of epithelial dysgenesis and degeneration (Fig. 3g). Some tubules show thin, irregular epithelia with sloughing of germ cells into the lumen, and a small number of type A spermatogonia and Sertoli cells are retained. Occasional seminiferous tubules exhibit active spermatogenesis with stratified germinal layers and a relatively normal appearance. Complete loss of germ cells is evident after 14 weeks. Ahch function is therefore not required for the initiation of spermatogenesis, but it is essential for the maintenance of germinal epithelial integrity and gametogenesis in the adult. The degeneration of large segments of the seminiferous tubules may reflect a primary Sertoli cell defect, consistent with the proposed role of Dax-1 function in the regulation of spermatogenesis19. Leydig cell hyperplasia and hypertrophy are also observed adjacent to severely degenerated tubules (Fig. 3i), suggesting either a primary defect due to loss of Dax-1 function in Leydig cells or a secondary Leydig cell response to the inactivation of Ahch in Sertoli cells. The spermatogenic defect could also arise from altered production of hypothalamic gonadotropin-releasing hormone (GnRH), or from deficiencies of the pituitary gonadotropins, luteinizing hormone (LH) and follicle-stimulating hormone16 (FSH). Pituitary glands from wild-type and mutant animals are identical in size and there are no differences in the number of cells or intensity of immunohistochemical staining for LHβ, FSHβ, glycoprotein hormone α-subunit, or ACTH (data not shown). In contrast to human males with AHC mutations15, serum hormone measurements of LH (wild type, 0.12 ng/ ml±0.06; mutant, 0.12 ng/ml±0.04) and FSH (wild type 19.6 nature genetics volume 20 december 1998

ng/ml±2.2; mutant, 19.7 ng/ml±4.6) from Ahch∆2/Y males are indistinguishable from those of wild-type mice. Hypogonadism is therefore unlikely to reflect deficiencies of LH or FSH, but rather stems from primary testicular failure. We generated homozygous mutant females (Ahch∆2/∆2) by mating females heterozygous for the Ahch deletion and hemizygous for the Cre transgene with males carrying the loxP-modified Ahch locus. Disruption of Ahch function in females does not affect sexual maturation, ovulation or fertility. The macroscopic appearance of the female internal reproductive organs, including the ovaries, is normal. Histological analyses of ovaries from mature, Ahch∆2/∆2 females show a normal complement of follicles at different stages of maturation (Fig. 4c), as well as the presence of corpora lutea. Ahch∆2/∆2 females mated with wild-type males produce normal litter sizes with equal transmission of the mutation to male and female offspring (data not shown). Despite apparently normal fertility in females, a subset of follicles exhibit an abnormality characterized by the presence of multiple oocytes (Fig. 4d). A single thecal layer is present and surrounds the proliferating granulosa cell layers and oocytes. These results implicate Ahch in follicular recruitment, granulosa cell proliferation, or in the formation of structures that normally segregate different follicles. It is possible that the abnormal granulosa cell organization surrounding the oocyte is functionally related to a defect in Sertoli cell support of germ cells in the male. Ahch function is not required for ovarian formation and it is not an ovarian determining factor3. As Ahch mutations are transmitted in vivo, it is an unexpected result that targeted disruption of the Ahch locus impairs the survival of undifferentiated ES cells. RT-PCR analysis of RNA isolated from wild-type ES cells reveals abundant Ahch mRNA (data not shown), suggesting that Dax-1 may function in the survival of ES cells. The Cre-loxP strategy provides an approach to bypass this barrier to ES cell selection and to circumvent predicted reproductive defects in chimaeric males with an Ahch mutation by maintaining normal Ahch expression after gene targeting. This approach may prove useful for the conditional disruption of other X- or Y-linked genes involved in reproduction and fertility. The design of the conditional mutation of the second exon of Ahch was based on reports indicating that frameshift or nonsense mutations of the C-terminal region of Dax-1 (which is encoded by the second exon) are sufficient to cause fully penetrant AHC-

testis development

Sox9

Sry

spermatogenesis

Dax-1 Sertoli

MIS

Sf-1 Wt-1 Leydig

steroidogenesis

Fig. 5 Model for Ahch control of testicular development. In a dose-dependent manner, Ahch (encoding Dax-1) is proposed to inhibit the actions of both the testis-determination factor Sry and the urogenital ridge/steroidogenic enzyme regulator Sf-1, thereby modulating the actions of gene products involved in development of the male reproductive system. Ahch function is also required for the maintenance of spermatogenesis. MIS, Müllerian inhibiting substance.

355


letter


HHG (refs 9,15,20). Cre-mediated excision of the floxed second exon also ablates the intronic splice acceptor site and the downstream polyadenylation signal, resulting in low levels of an abnormal, unspliced transcript (data not shown). As some residual Ahch transcript remains, we cannot entirely rule out the possibility that a truncated Dax-1 is produced that might exhibit partial or altered function. Such a protein product might account for the incomplete adrenal insufficiency and retained gonadotropin and ovarian function in mice. There is no evidence to date, however, for a correlation of AHC phenotype with the locations of AHC mutations15, suggesting that N-terminal Dax-1 protein products are unlikely to be functional. Our data indicate that Ahch is essential for the integrity of the testicular germinal epithelium, which ultimately affects gametogenesis and fertility. Spermatogenesis is not severely impaired until later in adulthood, raising the possibility that alterations in Ahch function might represent one of several factors that cause defects in spermatogenesis and male infertility. Dax-1, acting in a dose-dependent manner, may function to restrict the inductive activity of testis-promoting factors such as Sry (ref. 6) and Sf-1 (ref. 9), thereby modulating their effects during testicular development (Fig. 5). In addition, our finding that Ahch is not required for ovarian development, in combination with the reported sex-reversal phenotype that results from Ahch overexpression, supports a role for Ahch as an ‘anti-testis’ factor6 as opposed to an ovarian determination gene.

Methods Targeted mutagenesis. Mouse Ahch was isolated from a 129Sv/J genomic library (Stratagene) by screening with a full-length human AHC cDNA probe9. Two phage clones (2-1mDax and 5-1mDax) were identified, containing inserts of 16 kb and 18 kb, respectively. Inserts were excised with NotI and subcloned into the NotI site of pGEM5Zf(+) (Promega) to obtain plasmids pGEM5Zf-2-1mDax and pGEM5Zf-5-1mDax, respectively. A 5.5-kb EcoRI fragment containing the intron, both exons and a 3.1-kb EcoRI fragment downstream from the 5.5-kb fragment were subcloned into pGEM7Zf(+) (Promega) to generate plasmids pGEM7Zf(+)2Ec5500mDax and pGEM7Zf(+)-5Ec3100mDax, respectively. For construction of the loxP-flanked second exon, we isolated a 1.7-kb XbaI/EcoRI fragment containing partial 3´ intronic sequence and exon 2 from pGEM7Zf(+)-2Ec5500mDax and subcloned it into the XbaI/EcoRI site of pGEM7Zf(+), resulting in plasmid pGEM7Zf(+)-2XEc1700mDax. We introduced a single loxP site 140 bp upstream of the splice acceptor signal in the intronic sequence using overlapping PCR primers containing the loxP site (mDXiloxP/rev, 5´−CGTATAATGTATGCTATACGAAGTTATATGGACTGAAATAAGTTCTAA−3´; mDXiloxP/for, 5´−TCGTATAGCATACATTATACGAAGTTATTATTTTAGGCCCCAGAAAC−3´) and T7 and SP6 primers for amplification, resulting in plasmid pGEM7Zf(+)iloxP1700mDax. The PGK-neo cassette from the pPNT targeting vector21 was subcloned into pGEM5Zf(+) and loxP sites were introduced upstream and downstream of the PGK-neo cassette using annealed oligonucleotide primers containing the loxP sequence and unique restriction site ends, resulting in the floxed PGK-neo plasmid pGEM5Zf(+)-floxPGKneo (LP1). We subcloned the pPNT PGK-tk cassette into pCRscript SK(+) (Stratagene) to create pSK(+)-PGK-tk, which we then used as the vector for final construction of the targeting plasmid. A five-piece ligation was performed using the following restriction enzyme-digested DNA fragments: a 3.8-kb EcoRI/XbaI fragment from pGEM7Zf(+)-2Ec5500mDax; a 1.7-kb XbaI/HindIII fragment from pGEM7Zf(+)-iloxP1700mDax; a 1.8-kb HindIII/XhoI fragment from pGEM5Zf(+)-floxPGKneo (LP1); a 3.1-kb XhoI/BamHI fragment from pGEM7Zf(+)-5Ec3100mDax; and a 6.0-kb EcoRI/BamHI-digested pGEM11Zf(+)-PGK-tk vector. The three loxP sites are oriented in the same direction for excision. This final targeting vector, pSK(+)-mDax/flox2NTK, was confirmed by automated DNA sequencing (Perkin-Elmer). R1 ES cells22 were electroporated with the NotI linearized pSK(+)-mDax/floxNTK targeting vector, and we identified targeted ES cells by genotyping using HindIII digestion and Southern-blot analysis23.

356

Generation of Ahch exon 2-deleted mice. Targeted ES cells were used to generate chimaeras by microinjection at the University of Michigan Transgenic Animal Model Core Facility. Germline transmission was determined by Southern-blot analysis after HindIII digestion and by PCRbased screening to detect the intronic loxP site. Animals were bred to the 129Sv/J(+p+c+mgf ) mouse strain (JAX) to obtain F1 offspring. Animals with the loxP-modified Ahch were mated with 129Sv/J mice harbouring the CMV-driven, Cre recombinase transgene17 to effect deletion of the second coding exon of Ahch. Specifically, female mice homozygous for loxP-modified Ahch (Ahchflox2/flox2) were mated with CMV-Cre transgenic males to generate both Ahch-deletion carrier females (AhchAhch/∆2) and mutant males (Ahch∆2/Y). Carrier females were then mated with males hemizygous for the loxP-modified Ahch (Ahchflox2/Y) to obtain mutant female offspring (Ahch∆2/∆2). RT-PCR analyses. Tissues from both wild-type and mutant animals were rapidly dissected, frozen on dry ice and stored at −80 °C. Total RNA was extracted using TRIzol reagent (Gibco BRL) according to the manufacturer’s protocol. For each tissue type, RNA (2 µg) was treated with DNase 1 (Promega) in a reaction volume (10 µl). We generated first-strand cDNA using DNase 1-treated RNA (5 µl; 1 µg), avian myeloblastosis virus reverse transcriptase (AMV-RT), 1×buffer (Promega), a dATP, dCTP, dTTP, dGTP nucleotide mixture (1 µl; 10 mM each) and random hexamer oligonucleotides in a reaction volume (20 µl). The PCR amplification reaction was performed with reverse-transcribed cDNA product (1 µl), forward and reverse primers (50 pmol each), a dATP, dCTP, dTTP, dGTP nucleotide mixture (5 µl; 10 mM each), 1×MI-PCR buffer (67 mM Tris, pH 8.8, 6.7 mM MgCl2, 16 mM (NH4)2SO4, 10 mM β-mercaptoethanol, 10% DMSO) and DNA Taq Polymerase (5 U; Promega). Primers specific for Ahch exons 1 and 2 (mDX1154/for, 5´−AGATGATGGAGATCCCGGAG−3´ and mDXcDNA/rev, 5´−TCACAGCTTTGCACAGAGCA−3´ sequences, respectively) or GAPD (GAPDH-5´, 5´−CCCTTCATTGACCTCAACTA−3´ and GAPDH-3´, 5´−CCAAAGTTGTCATGGATGAC−3´) coding sequences were used for amplification. PCR cycles (30−34) were performed at 94 °C for 1 min, 55 °C for 1 min and 72 °C for 75 s (MJ Research). PCR products were analysed on a 1% agarose-0.5×TBE gel and visualized with ethidium bromide. Serum hormone measurements. Radioimmunoassays (RIAs) for testosterone were performed using an 125I RIA kit according to the manufacturer’s protocols (ICN Biomedicals). LH and FSH RIAs were performed using antibodies and reference preparations from the National Hormone Pituitary Program. Histological and immunohistological analysis. Tissues from both wildtype and mutant animals were rapidly dissected and placed in fresh Bouin’s fixative overnight at 4 °C. Excess fixative was removed with a 70% ethanol/NH4OH solution. Tissues were then dehydrated and embedded in paraffin for microtome sections. Haematoxylin-eosin staining procedures were performed according to the manufacturer’s protocol (Shandon-Lipshaw). P450 side chain cleavage enzyme immunohistochemistry was performed on sections (7 µm) of paraffin-embedded adrenal glands and testes using an immunohistological staining system (Zymed) and a 1:200 dilution of a P450scc antibody (Research Diagnostics). Acknowledgements

We thank L. Samuelson and P. Gillespie for invaluable instruction in ES cell techniques and gene targeting; A. Nagy, R. Nagy and W. Abramow-Newerly for providing the R1 ES cells; R. Mulligan for providing the pPNT targeting vector; K. Foley and R. Eisenman for providing the CMV-Cre transgenic mice; B. Mann for performing the serum hormone radioimmunoassays; A. Parlow for the FSH and LH radioimmunoassay reagents; T. Woodruff, E.-J. Lee, Y. Park, J. Achermann, W. Duan, J. Rutishauser and P. Kopp for helpful discussions; J. Shavit and H. Burrows for experimental advice and reagents; and T. Kotlar, L. Sabacan and K. Stanfield for excellent technical assistance. This work was supported by the NICHD National Cooperative Program for Infertility Research (NIH grant U54-HD-29164), PO1-HD-21921, P30-HD28048 and by NIH training grant (T32-DK-07169) to R.N.Y. Received 25 September; accepted 30 October 1998.



1.

Bardoni, B. et al. A dosage sensitive locus at chromosome Xp21 is involved in male to female sex reversal. Nature Genet. 7, 497–501 (1994). Swain, A., Zanaria, E., Hacker, A., Lovell-Badge, R. & Camerino, G. Mouse Dax1 expression is consistent with a role in sex determination as well as in adrenal and hypothalamus function. Nature Genet. 12, 404–409 (1996). 3. Swain, A. & Lovell-Badge, R. A molecular approach to sex determination in mammals. Acta Paediatr. Suppl. 423, 46–49 (1997). 4. Zanaria, E. et al. An unusual member of the nuclear hormone receptor superfamily responsible for X-linked adrenal hypoplasia congenita. Nature 372, 635–641 (1994). 5. Muscatelli, F. et al. Mutations in the DAX-1 gene give rise to both X-linked adrenal hypoplasia congenita and hypogonadotropic hypogonadism. Nature 372, 672–676 (1994). 6. Swain, A., Narvaez, V., Burgoyne, P., Camerino, G. & Lovell-Badge, R. Dax1 antagonizes Sry action in mammalian sex determination. Nature 391, 761–767 (1998). 7. Ikeda, Y. et al. Steroidogenic factor 1 and Dax-1 colocalize in multiple cell lineages: potential links in endocrine development. Mol. Endocrinol. 10, 1261–1272 (1996). 8. Yu, R.N., Ito, M. & Jameson, J.L. The murine Dax-1 promoter is stimulated by SF-1 (steroidogenic factor- 1) and inhibited by COUP-TF (chicken ovalbumin upstream promoter- transcription factor) via a composite nuclear receptor-regulatory element. Mol. Endocrinol. 12, 1010–1022 (1998). 9. Ito, M., Yu, R. & Jameson, J.L. DAX-1 inhibits SF-1-mediated transactivation via a carboxy-terminal domain that is deleted in adrenal hypoplasia congenita. Mol. Cell. Biol. 17, 1476–1483 (1997). 10. Nachtigal, M.W. et al. Wilms’ tumor 1 and Dax-1 modulate the orphan nuclear receptor SF-1 in sex-specific gene expression. Cell 93, 445–454 (1998). 11. Crawford, P.A., Dorn, C., Sadovsky, Y. & Milbrandt, J. Nuclear receptor DAX-1 recruits nuclear receptor corepressor N-CoR to steroidogenic factor 1. Mol. Cell. Biol. 18, 2949–2956 (1998). 12. Luo, X., Ikeda, Y. & Parker, K.L. A cell-specific nuclear receptor is essential for

adrenal and gonadal development and sexual differentiation. Cell 77, 481–490 (1994). 13. Sadovsky, Y. et al. Mice deficient in the orphan receptor steroidogenic factor 1 lack adrenal glands and gonads but express P450 side-chain-cleavage enzyme in the placenta and have normal embryonic serum levels of corticosteroids. Proc. Natl Acad. Sci. USA 92, 10939–10943 (1995). 14. Parker, K.L. & Schimmer, B.P. Steroidogenic factor 1: a key determinant of endocrine development and function. Endocr. Rev. 18, 361–377 (1997). 15. Yu, R.N., Achermann, J.C., Ito, M. & Jameson, J.L. The role of DAX-1 in reproduction. Trends Endocrinol. Metab. 9, 169–175 (1998). 16. Habiby, R.L. et al. Adrenal hypoplasia congenita with hypogonadotropic hypogonadism: evidence that DAX-1 mutations lead to combined hypothalmic and pituitary defects in gonadotropin production. J. Clin. Invest. 98, 1055–1062 (1996). 17. Rossant, J. & Nagy, A. Genome engineering: the new mouse genetics. Nature Med. 1, 592–594 (1995). 18. Dunn, T.B. Normal and pathologic anatomy of the adrenal gland of the mouse, including neoplasms. J. Natl Cancer Inst. 44, 1323–1389 (1970). 19. Tamai, K.T. et al. Hormonal and developmental regulation of DAX-1 expression in Sertoli cells. Mol. Endocrinol. 10, 1561–1569 (1996). 20. Lalli, E. et al. A transcriptional silencing domain in DAX-1 whose mutation causes adrenal hypoplasia congenita. Mol. Endocrinol. 11, 1950–1960 (1997). 21. Tybulewicz, V.L., Crawford, C.E., Jackson, P.K., Bronson, R.T. & Mulligan, R.C. Neonatal lethality and lymphopenia in mice with a homozygous disruption of the c-abl proto-oncogene. Cell 65, 1153–1163 (1991). 22. Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W. & Roder, J.C. Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc. Natl Acad. Sci. USA 90, 8424–8428 (1993). 23. Wurst, W. & Joyner, A.L. Production of targeted embryonic stem cell clones. in Gene Targeting, a Practical Approach (ed. Joyner, A.L.) 33–61 (IRL Press, Oxford, 1993).


2.

letter


357