Stem Cells Express, published online August 11, 2005; doi:10.1634/stemcells.2005-0070
Original Article
Isolation and angiogenesis by endothelial progenitors in the fetal liver Running title: Characterization of fetal liver endothelial progenitors
Stephanie Cherqui1, Sunil M. Kurian1, Olivier Schussler1, Johannes A. Hewel2, John R. Yates III2 and Daniel R. Salomon1 1 2
Department of Molecular and Experimental Medicine Department of Cell Biology
The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, California 92037, USA. *Corresponding author: Daniel R. Salomon, M.D. Department of Molecular and Experimental Medicine The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, California 92037, USA. Phone: 858 784 9381 Fax: 858 784 2121
[email protected] Received February 18, 2005; accepted for publication June 21, 2005. ©AlphaMed Press 1066-5099 doi: 10.1634/stemcells.2005-0070 TSRI Manuscript #: 16902-MEM Word Count: 5240
Financial Statement: This work was funded by the National Institutes of Health, R21 DK62598, the Juvenile Diabetes Research Foundation, 3-2003-738 and the Molly Baber Reseach Fund. No support for this work was derived from any commercial source and the authors have no direct financial interest in any aspect of the manuscript.
1 Copyright © 2005 AlphaMed Press
Abstract
Endothelial progenitor cells (EPC) have significant therapeutic potential. However, the low quantity of such cells available from bone marrow and their limited capacity to proliferate in culture make their use difficult. Here, we present the first definitive demonstration of the presence of true EPC in murine fetal liver capable of forming blood vessels in vivo connected to the host’s vasculature after transplantation. This population is particularly interesting because it can be obtained at high yield and has a high angiogenic capacity as compared to bone marrow-derived EPC. The EPC capacity is contained within the CD31+Sca1+ cell subset. We demonstrate that these cells are dependent for survival and proliferation on a feeder cell monolayer derived from the fetal liver. In addition, we describe a novel and easy method for the isolation and ex vivo proliferation of these EPC. Finally, we used gene expression profiling and tandem mass spectrometry proteomics to examine the fetal liver endothelial progenitors and the feeder cells to identify possible proangiogenic growth factor and endothelial differentiationassociated genes.
Word Count = 169
2
Introduction
Endothelial progenitor cells (EPC) have the capacity to proliferate and differentiate into mature endothelial cells. An unexpected and exciting development was the discovery that endothelial progenitors, resident in peripheral blood [1-3] and bone marrow [4-7], can be recruited from the circulation and participate in angiogenesis at sites of tissue injury and/or ischemia [8, 9]. Vascular progenitors can also be isolated from skeletal muscle and can differentiate into endothelial cells during ischemic injuryinduced neovascularization [10]. Similarly, embryonic lung mesenchyme contains endothelial precursors [11]. Many have suggested the therapeutic potential of progenitor-driven angiogenesis [9]. However, the differentiation of EPC into functional blood vessels in vivo is complex and incompletely understood. For example, what is the biological significance and regulation of angiogenesis mediated by EPC at sites of tissue injury in contrast to angiogenesis mediated by local endothelial cells? Moreover, the quantity of EPC within the circulation, even mobilized from the bone marrow, is low and only a small percentage of CD34+ hematopoietic stem cells have endothelial progenitor capacity [12, 13]. Therefore, understanding growth factor and cell signal pathways that direct EPC proliferation, survival and differentiation is an important strategy to enrich for angiogenesis-competent cells suitable for clinical applications. Fetal liver is a source of stem cells that can give rise to hepatocytes and biliary epithelial cells [14, 15]. It is also well established that fetal liver contains Sca1+ hematopoietic stem cells capable of differentiation to myeloid and lymphoid lineages
3
[16-18]. A subset of fetal liver stem cells has been shown to express endothelial progenitor cell makers in vitro [2, 9, 12] suggesting that they might be EPC. However, this commonly accepted fact has never been proved by demonstration of angiogenesis in vivo mediated directly by participation of these putative EPC. Our interests in the potential of manipulating tissue compartment-specific progenitors as a means of enhancing revascularization of cell transplants during tissue engineering led us to develop a new method to purify stem cells from murine fetal liver. We characterized a CD31+Sca1+ population of cells that contains the EPC. While it is certainly possible that some hematopoietic stem cell activity is also contained within this population, the present work is focused on their endothelial progenitor and angiogenic potential. Thus, we established that the CD31+Sca1+ cells have a high efficiency of angiogenesis in vivo. We then used biology, genomics and proteomics to better characterize these EPC and possible growth factors and receptors required for survival, proliferation and maturation.
4
Methods
Animals. Balb/c and C57BL/6 mice were obtained from The Scripps Research Institute’s animal facility. NOD/SCID mice were obtained from our own colony. Transgenic Tie2GFP
mice
were
purchased
from
Jackson
Laboratory
(strain
FVB/N-
TgN(Tie2GFP)287Sato). Protocols were approved by the Institutional Animal Care and Use Committee. This program is AAALAC accredited and conforms to all USDA and OPRR guidelines.
Liver Endothelial Progenitors (LEP) isolation. Livers obtained from 5 to 7 fetal embryos (15-21 days post-implantation) were dissected, minced and washed. After spinning 30 seconds at 99 xg, the tissue was digested with 3 mg/ml collagenase P (Sigma, St Louis, Missouri) in 4 ml of HBSS with 1M CaCl2 and hand-agitated at 37 oC for 3.15 minutes. Digestion was stopped by adding 20 ml of HBSS with BSA 0.35% and cooling in ice 10 minutes. After discarding 20 ml of supernatant and adding 5 ml of HBSS+BSA, the pieces were triturated 6 times using a 14G needle attached to a 10 ml syringe. The mixture was then pelleted by centrifugation (99 xg for 30 seconds), 5 ml of buffer was replaced and this entire procedure was repeated twice. The digested tissue pellet was then resuspended in 30 ml of complete RPMI-1640 medium (Cambrex, East Rutherford, New Jersey), 10% fetal calf serum, 4 mM glutamine, 1 mM sodium pyruvate, 100U penicillin/streptomycin (Invitrogen, Carlsbad, California), split in a 6-well plate with 5 ml per well and cultured at 37 oC and 7% CO2. The media was changed every two days. We performed all our studies with cells harvested at 8 days.
5
Bone marrow stem cell isolation. Bone marrow cells were extracted by flushing from the tibias and femurs of C57Bl/6 mice at 6 to 10 weeks of age.
Sorting of Sca1+ stem cells. Sorting of both fetal liver and adult bone marrow cells was performed using anti-Sca1 antibody conjugated to mini-magnetic beads (Miltenyi Biotec, Inc., Auburn, California) according to the manufacturer’s instructions. Sca1+ cells are eluted with a purity of better than 90% by flow cytometry and >99% viability by vital dye exclusion.
Proliferation and survival assay. 105 cells per well were seeded in triplicate in 96-well plates and cultured for 3 days in medium or supplemented with 10%, 20% and 40% of 48 h conditioned supernatants harvested from a feeder cell monolayer. The cells were harvested with trypsin-EDTA and counted. Apoptosis and cell viability were measured using annexin V and propidium iodide according to manufacturer’s protocols (Molecular Probes, Eugene, Oregon). Proliferation was measured with [3H]thymidine in round bottom 96-well plates added at 48 h [1 µCi ml-1] and 16 h later the cells were harvested onto glass fiber filters and counted by liquid scintillation (MicroBeta, Wallac).
Matrigel Vascular-like Tube-Forming Assay. Matrigel (BD Biosciences, San Jose, California) was added to the wells of a 24-well plate in a volume of 300 µl and allowed to solidify at 37oC for 30 min. After the Matrigel solidified, LEP (1x106 cells) were added in 1 ml of media: EBM-2 supplemented with FCS 2%, hydrocortisone, hFGFb,
6
VEGF, IGF1, hEGF, ascorbic acid and heparin (EGM-2 Bulletkit, Cambrex). The cells were incubated at 37oC, 7% CO2 for 7 days and then photographed.
Endothelial Progenitor Colony-Forming Unit (EP-CFU) Assay. 5 x 106 LEP/well were resuspended in 2 ml of Endocult Liquid Medium (StemCell Technologies, Vancouver, British Colombia), plated on fibronectin-coated 6-well culture dishes (BD Biosciences) and incubated for 2 days at 370C, 7% CO2. The non-adherent cells were then collected and plated at 5 x 105 cells/well on fibronectin-coated 24-well culture dishes in 1ml of Endocult Liquid Medium. After three days the CFU were counted and photographed.
Transplantation of Matrigel Templates. 106 cells were mixed in 500 µl of iced Matrigel Basement Membrane Matrix to prevent gelification and injected subcutaneously into the flank of mice using a 23G needle.
Estimation of Blood Vessels. Mouse tissues or Matrigel templates explanted 2 weeks post transplant, were minced and digested in collagenase P (1.6 mg/ml; Sigma) and DNaseI (10 U/ml; Roche Biochemicals, Indianapolis, Indiana) for 2 hours at 37 oC and resuspended by pipetting every 30 minutes. After filtering through a 70 µm filter (BD Biosciences), cells were collected and stained with blood vessel-specific antibody: PhycoErythrin (PE) anti-CD31 antibody, a PE-conjugated rat IgG2a was used as the isotype control (Caltag, Burlingame, California). A PE-labeled anti-αIIbβ3 antibody (EMFRET Analytics, Wurzbug, Germany) and the corresponding PE-Rat IgG2b isotype control was used to determine the quantity of platelets in the CD31+ subset. PE-
7
streptavidin was used to reveal binding of biotinylated Griffonia simplicifolia lectin I isolectin B4 (Vector, Burlingame, California). The lectin (25 µg) was injected in the tail vein of NOD/SCID mice 20 minutes before harvesting the transplanted Matrigel templates.
Antibody phenotyping of LEP. Anti-mouse FcR CD16/CD32 (BD Biosciences) at 1 µg per 106 cells incubated 10 minutes on ice was used as a blocking step. The following directly conjugated anti-mouse antibodies were used at 1 µg per 106 cells and incubated 1 hour on ice: Fluoroscein IsoThioCyanate (FITC)-anti-Sca1 (D7 Ly-6A/E, eBioscience, San Diego, California), FITC-anti-CD45R/B220 (BD Biosciences) and the isotype control, FITC-Rat IgG2a. Similarly, we used PE-anti-CD31 (Caltag) with PE-Rat IgG2a as isotype control and FITC-anti-F4/80 (Caltag) with FITC-Rat IgG2b as isotype control.
Histology. Explanted Matrigel templates were fixed in 4% Paraformaldehyde 4 hours at room temperature and incubated overnight in 10% sucrose at 4 °C. Specimens were frozen in embedding medium (O.C.T, Tissue-Tek, Redding, California) at –80 oC and 8 µm thick frozen sections made. After blocking with 1% BSA, 10% donkey serum in PBS for 1 hour at room temperature, sections were stained with rabbit anti-human von Willebrand Factor (vWF) (Dako, Carpinteria, California) at 1:200 dilution for 1 h at room temperature, followed by donkey anti-rabbit IgG conjugated with Cy5 (Jackson ImmunoResearch, West Grove, Pennsylvania) at 1:200 dilution for 1 h at room temperature. Cy5-streptavidin (1:100 dilution) identified biotinylated Griffonia
8
simplicifolia isolectin. Sections were visualized using a BIO-RAD MRC1024 laser scanning confocal microscope (Hercules, California).
RT-PCR. Total RNA was prepared in 1 ml of Trizol (Invitrogen), purified using RNeasy columns (Qiagen, Valencia, California) and quality confirmed on an Agilent 2100 BioAnalyzer. Five µg of total RNA, treated with DNase (DNA-free; Ambion, Austin, Texas), was reverse transcribed using the SuperScript First-Strand Synthesis System with oligo dT primers (Invitrogen). First strand DNA was treated with DNase-free RNase (Invitrogen). PCR was performed as follows: 94 °C, 30 seconds; 55-60 °C, 1 minute; 72 °C, 1 minute for 40 cycles. Primer sequences for the following genes are published: Angiopoietin-1 (Ang-1), Angiopoietin-2 (Ang-2), Tie-1, Tie-2, Flk-1 and Flt-1 [5], Flt-4 [19], Cd34 [20], Endoglin [21], c-kit [22], Aa4 [23], Vcam-1 [24]. We also designed primers
for:
Hhex,
5’-ATCTCAGAGGATTCCGACCAGG-3’
ATTCCCCAATGTTGCCCCCAC-3’
reverse
(513
bp);
forward,
5’-
Cd133,
5’-
GGAAAAGTTGCTCTGCGAACC-3’ forward, 5’- TGCTTGTTTGCTGGAGGGTC-3’ reverse (608 bp); and Tal1, 5’-GCCCAAAGATTTCCCCAATG-3’ forward, 5’AAACCCAGTGCCCCAAACAC
-3’
reverse
(543
bp);
VE-Cadherin
5’
-
CAGCCAGCATCTTGAACCTG – 3’ forward, 5’ - GAGATTCACGAGCAGTTGGT 3’ reverse (506 bp) and vWF 5’ - TGTTTTGTGGCGTGTATGTGAGG - 3’ forward, 5’ - GTGTTCTGGGTTTTCTGGAGTTTG - 3’ reverse (584 bp).
DNA Microarrays. Affymetrix GeneChip (Santa Clara, California) protocols were used for all hybridizations. Samples were hybridized to MOE430A GeneChip arrays. Data was
9
analyzed using GeneChip Operating Software (GCOS) Version 1.0 from Affymetrix, which computes signal intensity and P values for each probe set (Wilcoxon Rank Sum test) and generates Present/Absent calls. We used RMA Express for signal normalization [25] and BRB ArrayTools for class comparisons (http://linus.nci.nih.gov/BRBArrayTools.html) and Cluster/TreeView for creation of heat map displays [26]. Microarray data for all the GeneChips are available at the Gene Expression Omnibus (GEO) website (www.ncbi.nlm.nih.gov/geo) under the series ID GSE1727.
Protein extraction. Proteins were extracted with isopropyl alcohol from phenol-ethanol supernatants of Trizol extracts after RNA was removed. Samples were allowed to precipitate for 10 min (25 °C) and sedimented at 12,000 xg (10 min, 4°C). The protein pellet was washed three times in two volumes 0.3 M guanidine hydrochloride in 95% ethanol for 20 minutes at 25 °C and then centrifuged at 7,500 xg (5 min, 4 °C). The pellet was then vortexed in 2 ml of 80% ethanol and centrifuged at 7,500 xg (5 min, 4 °C). The protein pellet was dried at room temperature for 10 min and stored at –20 °C.
Multidimensional
protein
identification
technology
(MudPIT).
We
used
multidimensional protein identification technology (MudPIT) for this analysis as described previously [27]. Protein samples were analysed using two different techniques for cleavage. One replicate from each sample was enzymatically cleaved using Endoproteinase Lys-C (Roche Biochemicals) followed by digestion with sequencing grade modified Trypsin (Promega, Madison, Wisconsin). The other replicate was
10
chemically cleaved with Cyanogen Bromide (CnBr) in addition to enzymatic cleavage with Trypsin and Endoproteinase Lys-C.
Analysis of tandem mass spectra. MS/MS spectra were analyzed using the SEQUEST software analysis protocol as described [28]. A filter, called 2to3 [29], determined the charge state (+2 or +3) of multiple peptide spectra and poor-quality spectra were deleted. Each MS/MS spectrum after analysis and filtering was searched against the SwissProt database (Release 42.0) and EntrezProtein (July 24) using SEQUEST [28]. DTASelect was used to filter peptide identifications. Filter criteria were set to Xcorr values >2.2 for 1+ spectra, >2.5 for 2+ spectra and >3.5 for 3+ spectra with DeltCn of 0.1. For the proteins hits of mRNA microarray data, moderate stringency was applied with Xcorrs of >0.8 and Delta Cn of 0.01 followed by manual validation of each peptide spectrum based on two main criteria: 1) more than 3 of the most intense fragment ions must show a match and, 2) the b and y ion series must show continuity for at least 3 fragment ions above background noise.
Statistical analysis. Data are expressed as mean ± standard error (SE) of at least 3 independent experiments. ANOVA was used to detect differences in cells survival and proliferation.
A
P
value
of
