MBE Advance Access published February 4, 2003
Vege and Mar:
Two novel hAT MITE families from Drosophila willistoni
Department of Ecology and Evolutionary Biology, The University of Arizona, Tucson AZ 85721, USA
Address for correspondence and reprints: Dr. Margaret G. Kidwell, Department of Ecology and Evolutionary Biology, The University of Arizona, Tucson, AZ 85721, USA. Email:
[email protected]; Phone: (520) 621-1784; Fax: (520) 621-9190
KEYWORDS: Drosophila willistoni, transposons, MITEs, hAT elements
1 Copyright (c) 2003 Society for Molecular Biology and Evolution
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
Andrew J. Holyoake and Margaret G. Kidwell
Abstract
Two novel families of miniature inverted repeat transposable elements (MITEs), Vege and Mar, are described from Drosophila willistoni. Based on their structures, both element families are hypothesized to belong to the hAT superfamily of transposable elements. Both elements have perfect, inverted terminal repeats, 8-bp target site duplications and were found to have inserted
populations, and appears to have a relatively low copy number. Mar was identified in only a single D. willistoni population and its copy number is presently unknown. Although MITEs occupy relatively large proportions of the genomes of a broad range of organisms, this may be their first unambiguous identification in any species of the genus Drosophila.
Introduction
Although a large array of transposable elements (TEs) have been described from Drosophila genomes, miniature inverted repeat transposable elements (MITEs) are rare or absent in most species of this genus that have been examined, including Drosophila melanogaster. In contrast, MITEs make up large proportions of many other host genomes and are present across a broad taxonomic range of organisms. MITEs were first discovered about ten years ago in maize (Bureau and Wessler 1992) and have subsequently been identified in many animals and plants, including Homo sapiens,
2
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
within fixed copies of nonautonomous P elements. Vege is present in all studied D. willistoni
Caenorhabditis elegans, fish and Xenopus species, Arabidopsis thaliana and a variety of other plants (Feschotte, Zhang, and Wessler 2002). Within Diptera, MITEs appear to be abundant in the mosquito species Anopheles gambiae, Aedes aegypti and Culex pipiens. Ten MITE families have been reported to date in Anopheles gambiae (Besansky et al. 1996; Tu 2001), and one in Anopheles stephensi (Luckhart and Rosenberg 1999). Twelve families have been described in Aedes aegypti (Tu 1997; Tu 2000; Tu and Orphanidis 2001) and three families in Culex pipiens (Feschotte and Mouches 2000; Feschotte, Zhang, and Wessler 2002).
(>1,000) per family per genome. These elements can occupy significant portions of their host genomes, and can insert close to structural genes, potentially influencing gene action. MITEs have terminal inverted repeats (TIRs), or subterminal inverted repeats (IRs), and are typically smaller than 1,000 bp. They have no coding potential, are AT rich, and may have a stable secondary structure. Different families of MITEs have common structural features, but little if any sequence similarity. Until recently, it was not obvious to which class of transposons (I, or II) they should be assigned, nor how they attained such high copy numbers. It is now apparent that MITEs are nonautonomous DNA (class II) elements that originated from a subset of autonomous DNA transposons (Feschotte, Zhang, and Wessler 2002). MITEs are distinct from internally deleted class II elements in that they have no internal homology to their derivative transposons. Instead, they seem to have a propensity for including nonhomologous sequences in their internal regions. Investigations within plants and other organisms have demonstrated that MITEs are active, and may be transposed by their parent DNA transposons (Feschotte, Zhang, and Wessler 2002). MITEs derived from the same superfamily of class II elements are generally similar in size.
3
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
MITEs are very short nonautonomous elements that are often present in high copy number
In the first systematic attempt at classification (Feschotte, Zhang, and Wessler 2002), MITEs have been grouped into superfamilies based on their association with superfamilies of transposases. Possible superfamilies of transposase (and MITEs) include Tc1/mariner, PIF/Harbinger, piggyBac/TTAA and hAT. The hAT superfamily of autonomous transposons is so named because members all share homology and transposition characteristics with hobo from Drosophila, Ac from Maize and Tam3 from the snapdragon (Atkinson, Warren, and O'Brochta 1993; Calvi et al. 1991). They are class II
wide variety of eukaryotic taxa, with many described from plants, nematodes, and fungi. They typically have short TIRs and duplicate 8 bp of host target site DNA (TSD) upon transposition. Within insects, a number of hAT superfamily members have been identified. Members of this superfamily include Homer, and the non-autonomous element HLE, from the tephritid fly Batrocera tryoni (Pinkerton et al. 1999). Hermes from the housefly Musca domestica (Warren, Atkinson, and O'Brochta 1994), Hermit from the blowfly Lucilia cuprina (Coates et al. 1996), and the ancestral element hopper from the tephritid Batrocera dorsalis (Handler and Gomez 1997). Partial hAT-like sequences have also been derived from the Australian bushfly Musca vetustissima (Warren, Atkinson, and O'Brochta 1995) and the Lepidopterans Heliothis virescens and Helicoverpa zea (DeVault and Narang 1994). Within the genus Drosophila, the hobo element (McGinnis, Shermoen, and Beckendorf 1983) is the only hAT element thus far identified. Daniels et al. (1990) performed a Southern hybridization screen of hobo elements from 134 taxa within the genus Drosophila and found hobo elements restricted to the melanogaster and montium subgroups of the melanogaster species group. Only D. melanogaster and its sibling species D. simulans and D. mauritiana contained
4
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
DNA transposable elements, which transpose with a cut and paste mechanism and are found in a
potentially complete hobo elements. This observation provides additional evidence for a recent origin of hobo within the melanogaster species group, perhaps by horizontal transfer, akin to the recent acquisition of P elements by D. melanogaster (Anxolabéhère, Kidwell, and Périquet 1988). This scenario is also supported by the presence of both H (hobo+) and E (hobo-) strains in D. melanogaster (Boussy and Daniels 1991; Pascual and Periquet 1991; Periquet et al. 1989; Streck , MacGaffey, and Beckendorf 1986) and D. simulans (Boussy and Daniels 1991). Furthermore, the hobo element appears to have transferred horizontally within the species group (Simmons 1992).
willistoni. Although our repeated attempts to isolate hobo from this species have been unsuccessful (A. J. Holyoake and M. G. Kidwell, unpublished results), recent studies in another laboratory suggest the presence of multiple copies of this TE family (V. Valente, V. Valiati and C. C. Klein, pers. comm.). Evidence that hobo-like sequences are an ancient component of Drosophila genomes is provided by the presence of divergent hobo-homologous sequences in the genomes of D. melanogaster E strains (Galindo et al. 2001) and of coding genes with hobo homology in the D. melanogaster genome (Adams et al. 2000; Robertson 2002). Within plants, and indeed many other organisms, class II TEs are seldom complete, the vast majority being internally deleted forms, created by imprecise transposition (Robertson 2002). These still have the ability to transpose, as long as an alternative source of transposase, provided by autonomous elements in trans, is available. Many of these, such as naturally deleted forms of hobo (Streck, MacGaffey, and Beckendorf 1986) and the P element (O'Hare and Rubin 1983), do not qualify as MITEs because they do possess internal homology to their derivative transposons.
5
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
Using squash and dot blotting, Loreto et al. (1997), detected hobo signal from isolated lines of D.
We describe here, two new MITE families, Vege and Mar, from Drosophila willistoni, that are associated with the hAT super family of TEs. These may be the first true MITEs identified from Drosophila. Materials and Methods PCR and sequence analysis Vege and Mar sequences were discovered incidentally during routine PCR screening for P element deletion derivatives. Briefly, genomic DNA was extracted from 30 adult flies using
genomic DNA using Taq DNA polymerase (Invitrogen) under standard conditions with the MIR primer (5’ cataaggtggtcccgtcg) homologous to nucleotides 14-31 and 2877-2894 of the P element TIR (Haring, Hagemann and Pinsker 1995). MIR is specific to M-type and canonical P elements. After size fractionation on agarose gels, bands smaller than the full sized potentially autonomous canonical P element (2907 bp) were gel extracted (Gibco-BRL concert band purification kit), and directly ligated into pCRtopo2.1 using the TopoTA cloning kit (Invitrogen). Potential positives were color selected, and PCR amplified from colonies directly using M13 F/R vector primers. Sequences were generated from positive PCR products on an ABI 3100 at the GATC core facility (ARL, University of Arizona). During alignments of all P element deletion derivatives, it was noted that some clones contained regions that were not homologous to P elements in either the forward or reverse orientation. Subsequent Genbank searches using BLAST tools revealed these sequences had little homology to any banked sequences. Southern Hybridisations Two micrograms of pooled genomic DNA from ~30 flies was digested to completion using PvuII (Gibco-BRL) a null cutter within the two sequenced MITEs. Restricted DNA was
6
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
standard protocols (Sambrook, Fritsch and Maniatis 1989). P elements were amplified from
elecrophoresed and transferred to nylon membrane (Amersham) using a modified capillary transfer protocol (Sambrook, Fritsch and Maniatis 1989). Radioactive probes were generated from PCR derived template amplified from the reference sequences, using Radprime DNA labeling (Gibco-BRL). Membranes were hybridized overnight, before being washed at high stringency (final wash 65˚C, 0.1XSSC, 20 mins). Membranes were exposed to Xomat-AR film (Kodak), and scored manually.
The initial Vege sequence was found inserted between nu 62 and 63 of a P element (Genbank accession X06779.1). Sequence analysis demonstrates that this MITE duplicates 8 bp of host DNA (canonical P nu 55-62) as a TSD, and has 12 bp perfect TIRs. The complete copy isolated has 33% GC with a size of 884 bp. The sequence has been deposited in Genbank under accession number AF518730. TBLASTn searches indicates that Vege has no coding capacity, and BLASTx (Altschul et al. 1990) searches found no significant homology between Vege, and Genbank sequences. The orientation of the MITE is ascribed by placing the newly duplicated 8 bp-target site at the 3’ end of the element (as assigned by comparing this locus with an orthologous locus lacking the insert). The copy of Vege at this locus is fixed across all populations of D. willistoni sampled (A. J. Holyoake, J. K. Hall and M. G. Kidwell, unpublished results). Interestingly this locus is polymorphic for an additional insertion of a mini-me TE at nucleotide position 58 of Vege. By using both inverse PCR and Southern blotting analysis, it was demonstrated that Vege is present in 6-7 copies in the D. willistoni haploid genome. Additionally, Vege hybridization patterns are found in D. nebulosa and D. tropicalis, sister species to D. willistoni, but not in D. melanogaster. Internal PCR of the Vege element indicated that it is
7
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
Results and Discussion
extremely heterogeneous both in size and sequence, indicating that these copy numbers may be gross underestimates. Mar is similar to Vege, in that it has 8-bp TSDs and 11-bp perfect TIRs. Mar has 38% GC over 610 bp. The Mar sequence is deposited in Genbank under accession AF518731. Mar is also inserted within a non-autonomous P element, and has been detected in a single population of D. willistoni. The Mar insertion is between nu 58 and 59 of the canonical P element, with the TSD of nu 50-58. Interestingly, the Mar insertion included a loss of 7 bp of P element sequence
indicate that like Vege, Mar has neither coding capacity, nor significant sequence homology to known published sequences. We hypothesize that both Vege and Mar are MITE members of the hAT superfamily of TEs. Although autonomous dipteran hAT members (and the non-autonomous HLE element) have different length TIRs, and sequence specific TSDs, there are distinct areas of homology between them (Tables 1 and 2). These homologous nucleotides frequently extend to other, more diverged, members of the hAT superfamily from vertebrates and plants (Rubin, Lithwick, and Levy 2001). MITE sequences that have been previously linked to the hAT superfamily of TEs have been done so based on a combination of the TIR and TSD similarities. hAT-like MITEs have previously been found in the rice and Arabidopsis genomes (Kapitonov and Jurka 2002a; Surzycki and Belknap 1999), Anopheles gambiae (Besansky et al. 1996; Tu 2001; Tu and Orphanidis 2001) Xenopus (Lepetit et al. 2000; Morgan and Middleton 1990) and humans (Smit and Riggs 1996). Each of these (with the exception of Vision) share 8-bp TSDs (Table 2) and have TIRs sharing the consensus sequence specific to hAT elements (Table 1). Other Dipteran MITEs such as TA-IV-Ag from Anopheles gambiae (Tu 2001) share similarities with hAT MITE
8
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
immediately adjacent to the 3’ insertion site (but after the TSD). TBLASTn and BLASTx analysis
TIRs, but have a dinucleotide (TA) TSD placing them as pogo-like MITEs in the Tc1/Mariner superfamily (Feschotte, Zhang, and Wessler 2002). The apparent rarity of Drosophila MITEs may well be related to the relative paucity of class II transposon sources. In contrast to some other taxa, relatively few class II TEs are present within the genus Drosophila (Robertson 2002). In the euchromatic portion of the D. melanogaster genome that has been sequenced, only 10 out of 54 families are identified as class II transposons (Rizzon et al. 2002). Those present in chromosomes 2R, X and 4 are limited to 1360, BariI,
2002). A shortage of transposase sources may have limited the formation and expansion of MITElike elements within this and related species. Feschotte, Zhang and Wessler (2002) list Dm-mPogo and SGM-IS as the only known Drosophila MITEs. Dm-mPogo, with dinucleotide (TA) TSDs, and perfect 21 bp (or imperfect 25 bp) long TIRs are essentially identical over their length to the sequence of the autonomous Pogo element, and may actually be considered severely truncated non-autonomous versions of these elements (Kapitonov and Jurka 2002b). Likewise, SGM-IS sequences have recently been identified as members of the Mini-me element family, common among species of the genus Drosophila (Wilder and Hollocher 2001). Mini-me TEs have one terminal, and one sub-terminal repeat, have no TSDs, and may have hairpin formation at the 5’ terminus when single stranded. These and other factors, lead the authors to conclude that these elements may be a new group of non-LTR retroposon (Wilder and Hollocher 2001). It may be, therefore, that there are no previously described true MITEs in the genus Drosophila. Within the willistoni species group of Sophophora, no hAT TE members are known, although recent studies have indicated the presence of hobo-related elements in this group (V.
9
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
Foldback, HB1, hobo, hopper, pogo and the S element (Bartolome, Maside, and Charlesworth
Valente, V. Valiate, and C. C. Klein pers. comm.). The presence of hAT-related MITEs and the polytypic insertion pattern of the Mar element suggest that D. willistoni does have hAT elements and that they may have provided a transposase source for the movement of hAT-related MITEs in recent times. Given that hAT elements have been shown to cross mobilize other hAT sequences in vivo (Sundararajan, Atkinson, and O'Brochta 1999) it is plausible that any hAT element present in this species could mobilize Vege and Mar. Presently, it is not possible to say if Vege and Mar are closely related to any one of the
share 100% similarity over their overlapping TIRs, However, Pegasus TSDs don’t conform well to the Dipteran consensus (Besansky et al. 1996). To conclude, we have described here what may be the first true MITEs from a Drosophila genome. We hypothesize, based on TIR and TSD similarities, that both Vege and Mar belong to a hAT superfamily of MITEs, found across a broad taxonomic range of organisms. Although the current absence of hAT autonomous TEs within the willistoni species group of Drosophila is not consistent with this finding, we predict that hAT elements will eventually be found in these species.
Acknowledgements. We thank Cédric Feschotte for comments and insights into the identity of these sequences. We are grateful to Vera Valente, Victor Valiate, Chirlei C. Klein and Zhijian Tu for access to unpublished results. This work was supported by National Science Foundation Grant DEB9815754 awarded to MGK.
10
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
sequenced hAT elements from other species. Vege and the Anopheles gambiae MITE Pegasus
LITERATURE CITED Adams, M. D. S. E. Celniker R. A. Holt et al. 2000. The genome sequence of Drosophila melanogaster. Science 287:2185-2195. Altschul, S. F., W. Gish, W. Miller et al. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410. Anxolabéhère, D., M. G. Kidwell, and G. Périquet. 1988. Molecular characteristics of diverse populations are consistent with the hypothesis of a recent invasion of Drosophila
Atkinson, P. W., W. D. Warren, and D. A. O'Brochta. 1993. The hobo transposable element of Drosophila can be cross-mobilized in houseflies and excises like the Ac element of maize. Proc. Natl. Acad. Sci. U S A 90:9693-9697. Bartolome, C., X. Maside, and B. Charlesworth. 2002. On the abundance and distribution of transposable elements in the genome of Drosophila melanogaster. Mol. Biol. Evol 19:926-937. Besansky, N. J., O. Mukabayire, J. A. Bedell et al. 1996. Pegasus, a small terminal inverted repeat transposable element found in the white gene of Anopheles gambiae. Genetica 98:119-129. Boussy, I. A. and S. B. Daniels. 1991. hobo transposable elements in Drosophila melanogaster and D. simulans. Genet .Res. 58:27-34. Bureau, T. E. and S. R. Wessler. 1992. Tourist: a large family of small inverted repeat elements frequently associated with maize genes. Plant Cell 4:1283-1294.
11
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
melanogaster by mobile P elements. Mol. Biol. Evol 5:252-269.
Calvi, B. R., T. J. Hong, S. D. Findley et al. 1991. Evidence for a common evolutionary origin of inverted repeat transposons in Drosophila and plants: hobo, Activator and Tam3. Cell 66:465-471. Coates, C. J., K. N. Johnson, H. D. Perkins et al. 1996. The hermit transposable element of the Australian sheep blowfly, Lucilia cuprina, belongs to the hAT family of transposable elements. Genetica 97:23-31. Daniels, S. B., K. R. Peterson, L. D. Strausbaugh et al. 1990. Evidence for horizontal
124:339-355. DeVault, J. D. and S. K. Narang. 1994. Transposable elements in lepidoptera: hobo-like transposons in Heliothis virescens and Helicoverpa zea. Biochem. Biophys. Res. Commun. 203:169-175. Feschotte, C. and C. Mouches. 2000. Recent amplification of miniature inverted-repeat transposable elements in the vector mosquito Culex pipiens: characterization of the Mimo family. Gene 250:109-116. Feschotte, C., X. Zhang, and S. R. Wessler. 2002. Miniature inverted repeat transposable elements and their relationship to established DNA transposons. In Mobile DNA II (eds. N.L. Craig R. Craigie M. Gellert, and A.M. Lambowitz). ASM Press, Washington, D.C. Galindo, M. I., Y. Bigot, M. D. Sanchez et al. 2001. Sequences homologous to the hobo transposable element in E strains of Drosophila melanogaster. Mol. Biol. Evol 18:15321539.
12
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
transmission of the P transposable element between Drosophila species. Genetics
Haring, E., Hagemann, S. and Pinsker, W. 1995. Different evolutionary behaviour of P element subfamilies: M-type and O-type elements in Drosophila bifasciata and D. imaii. Gene 63:197-202. Handler, A. M. and S. P. Gomez. 1997. A new hobo, Ac, Tam3 transposable element, hopper, from Bactrocera dorsalis is distantly related to hobo and Ac. Gene 185:133-135. Kapitonov, V. V. and J. Jurka. 2002a. Distribution of transposable and repetitive elements in the A. thaliana chromosomes,. www.girinst.org/server/AT.
Reports 2:7. Lepetit, D., S. Pasquet, M. Olive et al. 2000. Glider and Vision: two new families of miniature inverted-repeat transposable elements in Xenopus laevis genome. Genetica 108:163-169. Loreto, E. L., L. B. da Silva, A. Zaha et al. 1997. Distribution of transposable elements in neotropical species of Drosophila. Genetica 101:153-165. Luckhart, S. and R. Rosenberg. 1999. Gene structure and polymorphism of an invertebrate nitric oxide synthase gene. Gene 232:25-34. McGinnis, W., A. W. Shermoen, and S. K. Beckendorf. 1983. A transposable element inserted just 5' to a Drosophila glue protein gene alters gene expression and chromatin structure. Cell 34:75-84. Morgan, G. T. and K. M. Middleton. 1990. Short interspersed repeats from Xenopus that contain multiple octamer motifs are related to known transposable elements. Nucleic Acids Res 18:5781-5786. O'Brochta, D. A., W. D. Warren, K. J. Saville et al. 1994. Interplasmid transposition of Drosophila hobo elements in non-drosophilid insects. Mol. Gen. Genet. 244:9-14.
13
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
---. 2002b. POGON1, a "bona fide" family of nonautonomous DNA transposons. Repbase
EN.REFLISTPascual, L. and G. Periquet. 1991. Distribution of hobo transposable elements in natural populations of D. melanogaster. Mol. Biol. Evol. 8:282-296. Periquet, G., M. H. Hamelin, Y. Bigot et al. 1989. Presence of the deleted hobo element Th in Eurasian populations of Drosophila melanogaster. Genet. Sel. Evol.. 21:107-111. Pinkerton, A. C., S. Whyard, H. A. Mende et al. 1999. The Queensland fruit fly, Bactrocera tryoni, contains multiple members of the hAT family of transposable elements. Insect
Rizzon, C., G. Marais, M. Gouy et al. 2002. Recombination rate and the distribution of transposable elements in the Drosophila melanogaster genome. Genome Res. 12:400407. Robertson, H. M. 2002. Evolution of DNA transposons in eukaryotes. In Mobile DNA II (eds. N.L. Craig R. Craigie M. Gellert, and A.M. Lambowitz). ASM Press, Washington, D.C. Rubin, E., G. Lithwick, and A. A. Levy. 2001. Structure and evolution of the hAT transposon superfamily. Genetics 158:949-957. Sambrook, J, Fritsch, E.F. and Maniatis, T. 1989. Molecular Cloning: A laboratory Manual. Second edition. Cold Spring Harbor Press. Sarkar, A., K. Yardley, P. W. Atkinson et al. 1997. Transposition of the Hermes element in embryos of the vector mosquito, Aedes aegypti. Insect Biochem. Mol. Biol. 27:359-363. Simmons, G. M. 1992. Horizontal transfer of hobo transposable elements within the Drosophila melanogaster species complex: evidence from DNA sequencing. Mol. Biol. Evol. 9:1050-1060. Smit, A. F. and A. D. Riggs. 1996. Tiggers and DNA transposon fossils in the human genome. Proc. Natl. Acad. Sci. U S A 93:1443-1448. 14
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
Mol. Biol. 8:423-434.
Streck , R. D., J. E. MacGaffey, and S. K. Beckendorf. 1986. The structure of hobo transposable elements and their insertion sites. EMBO J. 5:3615-3623. Sundararajan, P., P. W. Atkinson, and D. A. O'Brochta. 1999. Transposable element interactions in insects: crossmobilization of hobo and Hermes. Insect Mol. Biol. 8:359-368. Surzycki, S. A. and W. R. Belknap. 1999. Characterization of Repetitive DNA Elements in Arabidopsis. J Mol. Evol. 48:684-691. Tu, Z. 1997. Three novel families of miniature inverted-repeat transposable elements are
U S A 94:7475-7480. ---. 2000. Molecular and evolutionary analysis of two divergent subfamilies of a novel miniature inverted repeat transposable element in the yellow fever mosquito, Aedes aegypti. Mol. Biol. Evol. 17:1313-1325. ---. 2001. Eight novel families of miniature inverted repeat transposable elements in the African malaria mosquito, Anopheles gambiae. Proc. Natl. Acad. Sci. U S A 98:1699-1704. Tu, Z. and S. P. Orphanidis. 2001. Microuli, a family of miniature subterminal inverted-repeat transposable elements (MSITEs): transposition without terminal inverted repeats. Mol. Biol. Evol. 18:893-895. Warren, W. D., P. W. Atkinson, and D. A. O'Brochta. 1994. The Hermes transposable element from the house fly, Musca domestica, is a short inverted repeat-type element of the hobo, Ac, and Tam3 (hAT) element family. Genet. Res. 64:87-97. ---. 1995. The Australian bushfly Musca vetustissima contains a sequence related to transposons of the hobo, Ac and Tam3 family. Gene 154:133-134.
15
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
associated with genes of the yellow fever mosquito, Aedes aegypti. Proc. Natl. Acad. Sci.
Wilder, J. and H. Hollocher. 2001. Mobile elements and the genesis of microsatellites in dipterans. Mol. Biol. Evol. 18:384-392.
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
16
Table 1. 5’ TIR Sequences of MITEs Derived from hAT Superfamily TEs and the P Element 5’ TIRc
Accession # or reference
Hermes
CAGAGAACAACAACAAG
L34807
HLE
CAGAGAACGTCA
AF110403
hobo
CAGAGAACTGCA
M69216
Homer
CAGAGATCTGCA
AF110403
Hermit
CAGAGATGTGCATGA
U22467
Hopper
TAGTGTTGGGGACTATCGA
U70428
Ac
CAGGGATGAAAA
X05424
Tam3
TAAAGATGTGAA
AB038406
8bp-I-Ag
CAGGGGTCTCCAAACT
Tu (2001)
Pegasus
CAGTGTTG
U29484
Vege
CAGTGTTGCCAA
AF518730
Mar
CAGAGGTAGGC
AF518731
MER30
CAGGGGTGTCCAATC
Tu (2001)
Ocr
TAGGGATGCACCGAATCCA
S80540
CATGATGAAATAACATAAAGGTGGTCCCGTCG
X06779
Element hATa
P a
Non dipteran hAT elements represented are the Ac element of maize, and the Tam3 element of the snapdragon.
b
MER30 is a human MITE, and Ocr is a MITE from Xenopus laevis.
c
The 5’ TIRs have been aligned. In most cases the 5’ and 3’ TIRs are identical or nearly so, except in the HLE element, which in the sequenced copy did not have a 3’ TIR. In bold, are nucleotides that appear to be highly conserved in hAT evolution.
17
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
MITEb
Table 2. 8 bp 5’ TSDs of Dipteran hAT Superfamily Transposons and Derived MITEs in Comparison with that of the P Element 5’ TSDa
Reference
Hermes
A T A Y T A A C
Sarkar et al. (1997)
HLE
A T A T A T A G
Pinkerton et al. 1999)
hobo
C T T T A A A
O'Brochta et al. (1994)
Homer
G T R Y R T A Y
Pinkerton et al. (1999)
Hermit
G T T G C A A
Coates et al. (1996)
Hopper
C T T C G T A C
Handler and Gomez (1997)
8bp-I-Ag
N T T T A N A
Tu (2001)
Mar
G T A T A C A C
Present study
Vege
A C A C T T A
Present study
G G C C A G A C
O'Hare and Rubin (1983)
Element hAT
P a
Hermes, hobo, Homer and 8bp-I-Ag TSDs are consensus sequences based on multiple loci. HLE, Hermit, Hopper, Mar and Vege TSDs are based on single loci. The Hopper 3’ TSD has only 4/8 sequence similarity to the 5’ TSD. In bold are the conserved nucleotides as suggested by Pinkerton et al. (1999).
18
Downloaded from http://mbe.oxfordjournals.org/ by guest on June 3, 2013
MITE