Molecular Markers Discriminate Closely Related ... - PubAg - USDA

MOLECULAR ENTOMOLOGY

Molecular Markers Discriminate Closely Related Species Encarsia diaspidicola and Encarsia berlesei (Hymenoptera: Aphelinidae): Biocontrol Candidate Agents for White Peach Scale in Hawaii ´ N,1 GABOR NEUMANN,2 PETER A. FOLLETT,2 JESSE H. DE LEO 2 AND ROBERT G. HOLLINGSWORTH

J. Econ. Entomol. 103(3): 908Ð916 (2010); DOI: 10.1603/EC09316

ABSTRACT We genetically characterized Encarsia diapsidicola Silvestri and Encarsia berlesei Howard (Hymenoptera: Aphelinidae) by two molecular methods: phylogenetic analysis of the cytochrome oxidase subunit I gene (COI) and intersimple sequence repeat-polymerase chain reaction (ISSR-PCR) DNA Þngerprinting. These two closely related endoparasitoids are candidate biological control agents for the white peach scale, Pseudaulacaspis pentagona Targioni-Tozetti (Hemiptera: Diaspididae), in Hawaii. We developed species-speciÞc COI molecular markers that discriminated the two species, and we tested the utility of the E. diaspidicola-speciÞc COI marker to detect parasitism of white peach scale. The COI sequence data uncovered 46-bp differences between the two Encarsia spp. The level of COI genetic divergence between the two species was 9.7%, and the two clustered into their own clade on a parismonious phylogram. ISSR-PCR readily discriminated the two Encarsia spp. because each was observed with Þxed species-speciÞc banding patterns. The COI molecular markers were speciÞc for each species because cross-reactivity was not observed with nontarget species. The E. diaspidicola-speciÞc COI markers were successful at detecting parasitism of white peach scale by E. diaspidicola by 24 h. Both molecular marker types successfully discriminated the two Encarsia spp., whereas the COI markers will be useful as tools to assess levels of parasitism in the Þeld and to study competitive interactions between parasitoids. KEY WORDS biocontrol, molecular markers, DNA Þngerprinting, cytochrome oxidase subunit I gene, endoparasitoids

The white peach scale, Pseudaulacaspis pentagona Targioni-Tozetti (Hemiptera: Diaspididae), is a serious economic pest on many different species of woody plants worldwide (Bennett and Brown 1958, Clausen et al. 1978). In Samoa, it is an invasive pest on yellow passion fruit, Passiflora edulis variety flavicarpa Deg. (Peters et al. 1985), and in Hawaii it has become a serious economic pest of papaya, Carica papaya L. (Follett 2000). Biological control programs have targeted the white peach scale on different host plants in several countries, with Encarsia berlesei Howard (Hymenoptera: Aphelinidae) being one of the most effective agents (Collins and Whitcomb 1975, Clausen et al. 1978). In 1986 in Samoa, two morphologically similar species, E. berlesei and closely related Encarsia diaspidicola Silvestri were introduced as biological Mention of trade names or commercial products in this article is solely for the purpose of providing speciÞc information and does not imply recommendation or endorsement by the U.S. Department of Agriculture. 1 Corresponding author: USDAÐARS, Kika de la Garza Subtropical Agricultural Research Center, BeneÞcial Insects Research Unit, 2413 E. Hgwy. 83, Weslaco, TX 78596 (e-mail: [email protected]). 2 USDAÐARS, U.S. PaciÞc Basin Agricultural Research Center, P.O. Box 4459, Hilo, HI 96720.

control agents for white peach scale on passion fruit. Both Encarsia spp. were initially present at two sampling sites 8 mo after the parasitoids were introduced, but subsequently only E. diaspidicola was recovered and this species seemed to be an effective biological control agent (Liebregts et al. 1989). In 2006, a biological control program was initiated against the white peach scale in Hawaii. E. diaspidicola was collected and imported from Samoa into quarantine to conduct host speciÞcity studies. After completion of host speciÞcity studies, a permit for release of this endoparasitoid was submitted and is under review. E. berlesei remains a potential candidate and may be imported and tested in the future. E. diaspidicola has been considered a synonym of E. berlesei by Flanders (1960) and Greathead (1976). In addition, Sands et al. (1990) speculated that the identiÞcation of these two parasitoids of white peach scale may have been confused in previous biological control programs. They also speculated that some of the successes attributed to E. berlesei in biological control programs around the world may actually have been due to E. diaspidicola. The objectives of the current study were to 1) genetically characterize both Encarsia spp. by two

June 2010

DE

´ ET AL.: DIAGNOSTIC MARKERS FOR Encarsia ENDOPARASITOIDS LE ON

molecular methods: sequencing of the mitochondrial cytochrome oxidase subunit I gene (COI) and by DNA Þngerprinting (intersimple sequence repeatpolymerase chain reaction [ISSR-PCR]). ISSR-PCR is a sensitive method because it targets simple sequence repeats or microsatellites (Zietkiewicz et al. 1994); 2) develop species-speciÞc COI molecular markers that discriminate the two closely related Encarsia spp. In addition, develop COI markers toward Arrhenophagus albitibiae (Girault) (Hymenoptera: Encyrtidae). This endoparasitoid is a natural enemy of white peach scale in Hawaii (G.N., unpublished data); 3) test the efÞciency of one of the COI markers (E. diaspidicolaspeciÞc) for detecting parasitism in white peach scale; and 4) determine whether ISSR-PCR could be used as a molecular tool to discriminate the two Encarsia spp. We have used this method extensively because of its increased power to resolve genetic relationships (Zietkiewicz et al. 1994; de Leo´ n et al. 2004a, 2006b, 2008; de Leo´ n and Morgan 2007; Triapitsyn et al. 2008). Materials and Methods Insect Collection and Rearing. White peach scale was propagated on butternut squash, Cucurbita moschata Duchesne ex Lam. For E. diaspidicola rearing, a squash infested with ⬇500 settled white peach scale crawlers was placed into a 1-gallon wide-mouthed transparent plastic jar (14 cm in diameter, 25 cm in height, 10-cm opening diameter:). When the scales were 14 d old (second instar), 30 Ð 40 E. diaspidicola were introduced to the jar. The wasps were provided with honey solution in a small, sealed plastic container with a wick made out of Þlter paper. The wasps were allowed to parasitize white peach scale for their entire life span. A. albitibiae was reared similarly on white peach scale, except Þrst-instar white peach scales were provided to the wasps for parasitism. For molecular studies, second instar white peach scales and adult specimens of E. diaspidicola and A. albitibiae were collected from laboratory colonies. Field-collected adult E. berlesei were provided by Christine A. Nalepa (Biological Control Laboratory, North Carolina Department of Agriculture) preserved in 90% ethanol. E. diaspidicola was identiÞed by Gregory A. Evans (USDAÐAPHISÐPPQ National IdentiÞcation Services (Beltsville, MD). Voucher specimens were deposited at the USDAÐAPHISÐPPQÐNIS (Beltsville, MD), and voucher specimens for both species were also deposited at the USDAÐARS in Hilo, HI. Colobopyga pritchardiae (Stickney) (Hempitera: Halimoccidae) (native palm scale) specimens were collected from mature Pritchardia palms from the Waiakea Forest Reserve near Hilo, HI. These specimens were included for cross-reactivity experiments. Fruiting branches on the palms were inspected for the presence of C. pritchardiae and if present, the entire fruiting branches were cut from the palms. The cuttings were transferred into water bottles and transported into the USDA Forestry Service Quarantine Facility in Hawaii Volcanoes National Park immediately after collection.

909

Detection of Parasitism and Time of Detection Experiments. For parasitism rate experiments, second instar white peach scales were exposed to E. diaspidicola as follows. An area of white peach scale-infested butternut squash, Cucurbita moschata (Duchesne ex Lam.) Duchesne ex Poir., was randomly selected. The cluster size was adjusted to ⬇2.5 cm in diameter by wiping off insects from the squash leaving only the chosen cluster. The number of individuals in the cluster was adjusted to 20 by removing excess numbers using a dissecting needle. A test arena was constructed from a plastic vial (2 cm in diameter, 5 cm in height). The lid was removed from the top of the vial and was discarded. A hole (1 cm in diameter) was drilled into the bottom as an introduction opening for E. diaspidicola. The plastic vial arena was then placed over the cluster and secured on the squash using modeling clay. Five E. diaspidicola, ⬍2 d old, previously kept for one day without hosts with honey solution provided were transferred into the test arena. After parasitoid introduction, the introduction hole was closed with a small piece of sponge and the exposure time was 48 h. After exposure, the arena was removed from the squash and the squash with the exposed scale insects was incubated for 72 h at 20 Ð23⬚C in quarantine. After incubation, the scale insects were removed from the squash and were transferred into 95% ethanol. The scales in the ethanol were then frozen at ⫺20⬚C for 5Ð7 d before shipping them to Weslaco, TX, for molecular analysis. White peach scale individuals not exposed to E. diaspidicola were set up similarly as negative controls. Parasitism detection time point experiments were set up similarly, except white peach scale cluster sizes of Þve individuals were exposed to a single E. diaspidicola. Scales were collected after 24, 48, and 72 h of exposure. Genomic DNA Isolation. A rapid crude DNA extraction procedure was used as described in de Leo´ n et al. (2006a) and de Leo´ n and Morgan (2007). In brief, individual specimens were homogenized on ice in 1.5-ml microfuge tubes in 40 ␮l of lysis buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, pH 8.0, 1% IGEPAL CA-630, and 100 ␮g/ml proteinase K) with one 30-s burst on ice (Pellet Pestle Motor, Bel-Art Products, Pequannock, NJ). To avoid cross-contamination between samples, a separate sterile plastic pestle was used for each insect. The samples were incubated at 95⬚C for 5 min, followed by 1 min on ice. The samples were centrifuged for 10 min at 16,110 ⫻ g at 4⬚C. The supernatant was transferred to fresh microfuge tubes and stored at ⫺20⬚C. In the native palm scale, total genomic DNA was extracted using a longer procedure according to standard methods, as described previously (de Leo´ n et al., 2004a,b, 2006b). In brief, individual specimens were homogenized on ice in 1.5-ml microfuge tubes in 40 ␮l of lysis buffer (10 mM TrisHCl, pH 7.5, 1 mM EDTA, pH 7.5, and 1% IGEPAL CA-630) with two 20-s bursts with 10-min intervals on ice (Pellet Pestle Motor, Bel-Art Products). To conÞrm for the presence of genomic DNA, ampliÞcation reactions were performed with 1 ␮l of stock DNA and 28S primers at an annealing temperature of 65⬚C (for-

910

JOURNAL OF ECONOMIC ENTOMOLOGY

Vol. 103, no. 3

Table 1. Summary of species-specific primer sequences and assays conditions. Edia-F/R, Eber-F/R, and Aalb-F/R were designed toward E. diaspidicola, E. berlesei, and A. albitibiae, respectively Primer

5⬘-sequence-3⬘

Tm (⬚C)

MgCl2 (mM)

Cycle no.

Expected size (bp)

Edia-F Edia-R Eber-F Eber-R Aalb-F Aalb-R

GTTGGGACAGGAACAGGT TGGATCACCTCCCCCAGC GTAGGTAATGGTACTGGT AGGATCCCCCCCTCCAGA GGAACAGGATCAGGAACAGGA CCCAGCTAAGACAGGAAGTGAC

63

1.5

40

326

56

1.5

40

326

65

1.5

30

251

ward, 5⬘-CCCTGTTGAGCTTGACTCTAGTCTGGC-3⬘ and reverse, 5⬘-AAGAGCCGACATCGAAGGATC-3⬘) (Werren et al. 1995) with 1.5 mM MgCl2 and the ampliÞcation conditions described below. The 28S assay was also used as an internal control in subsequent PCR reactions to test for the presence of PCR inhibitors or failures (Pooler et al. 1997, Vega et al. 1993, de Leo´ n et al. 2006a, Fournier et al. 2008). COI Amplification. The general primers C1-J-1718 (forward, 5⬘-GGAGGATTTGGAAATTGATTAGTTCC-3⬘) and C1-N-2191 (reverse, 5⬘-CCCGGTAAAATTAAAATATAAACTTC-3⬘) of Simon et al. (1994) were used (Tm of 58⬚C; 2.0 mM MgCl2 and 2 U of TaqDNA polymerase; 40 cycles) to amplify part of the COI gene. AmpliÞcation products were subcloned with the TOPO cloning kit (Invitrogen, Carlsbad, CA), plasmid minipreps were prepared by the QIAprep spin miniprep kit (QIAGEN, Valencia, CA), and sequencing was performed by Genewiz Inc. (North Brunswick, NJ) as described previously (de Leo´ n et al. 2006b, 2008). GenBank accession numbers for the partial COI gene are as follows: E. diaspidicola, GQ922196 Ð198; E. berlesei, GQ922199 Ð201; A. albitibiae, GQ922202Ð204; and C. pritichardiae, GQ922205Ð207. Internal Transcribed Spacer Region (ITS) 2 Amplification. The following primers 5.8S-F (forward, 5⬘-TGTGAACTGCAGGACACATGAAC-3⬘) and 28SR (reverse, 5⬘-ATGCTTAAATTTAGGGGGTA-3⬘) (Porter and Collins 1991) were used as described in previous work (de Leo´ n et al. 2004a, 2006b; de Leo´ n and Morgan 2007; Triapitsyn et al. 2008). The cycling parameters were one cycle for 3 min at 94⬚C followed by 45 cycles at 94⬚C for 20 s, 45⬚C for 20 s, and 72⬚C for 60 s. Attempts to amplify the ITS2 fragment from E. berlesei with the same primers were unsuccessful, so this gene fragment was not used to design molecular markers. The GenBank accession numbers for the ITS2 gene fragments for E. diaspidicola (519 bp) and A. albitibiae (415 bp) are as follows: GQ22208 Ð10 and GQ22211Ð13, respectively. DNA Sequence Analysis and Design of Species-Specific COI Molecular Markers. The DNA Sequencing Software Program Sequencher (Gene Codes Corp., Ann Arbor, MI) was used to process the raw COI sequences and the program DNAStar (DNAStar, Inc., Madison, WI) by using the ClustalW algorithm was used to calculate percentage divergence (Higgins et al. 1994), as described in de Leo´ n et al. (2006b, 2008). For the sequence analysis, ClustalX (Thompson et al. 1997) and PAUP version 4.0b10 (Swofford 2002) for

the Macintosh (PPC) were used for reconstruction of trees with the bootstrapping (as percentage of 1,000 replications) function to conÞrm the reliability of the trees (Felsenstein 1985). For the distance analysis, the neighbor-joining algorithmic method was performed using the uncorrected “p” genetic distance parameter (Saitou and Nei 1987). For the parsimony analysis, heuristic searches for the most parsimonious trees (bootstrap 50% majority-rule consensus tree) were conducted using closest stepwise addition and branchswapping algorithm by tree bisection-reconstruction. All characters had equal unweight. From the aligned COI sequences, molecular markers were designed that were speciÞc toward the various species of interest, each with speciÞc assay conditions to avoid crossreactivity. The primer sets Edia-F/R, Eber-F/R, and Aalb-F/R were designed toward E. diaspidicola, E. berlesei, and A. albitibiae, respectively (Table 1). Mitochondrial COI sequences were translated into amino acid sequences by using the invertebrate mitochondrial code with the computer program EMBOSS Transeq (http://www.ebi.ac.uk/emboss/ transeq/index.html). ISSR-PCR DNA Fingerprinting. ISSR-PCR reactions were performed independently with both a compound ISSR primer [T(GT)7(AT)2] (Witsenboer et al. 1997)and a 5⬘-anchored primer [HVH(TG)7T] (Zietkiewicz et al. 1994), where H ⫽ A/T/C and V ⫽ G/C/A, as described in previous work (de Leo´ n et al. 2004a,b, 2006, 2008).

Results Analysis of the COI Gene From E. diaspidicola and E. berlesei. Sequencing of the partial COI gene generated a 518-bp fragment in both Encarsia species and in A. albitibiae. A 524-bp fragment was produced from C. pritchardiae, however, attempts to amplify the COI gene from the white peach scale with the same primers were unsuccessful. Out of three individuals sequenced, E. diaspidicola showed no haplotype diversity as only one haplotype (H1) was uncovered, whereas three haplotypes (H1ÐH3) were identiÞed in E. berlesei, demonstrating genetic variation. The two Encarsia species, however, were readily discriminated based on COI sequence data, because 46-bp differences were seen between the two species. Of the 46-bp differences, eight led to amino acid substitutions (L12M, S32P, T45N, V77I, M94L, P105S, T140S, and A146S/P). The levels of genetic divergence (percent-

June 2010

DE


Fig. 1. Phylogram inferred from COI sequence data. Unrooted parsimonious (50% majority-rule consenses) tree based on 85 informative characters. Tree length ⫽ 98 steps; consistency index (CI) ⫽ 1.000, and retention index (RI) ⫽ 1.000. Bootstrap values are located at the nodes. A. albitibiae was included for comparison.

911

age divergence, %D) in the COI gene between the two Encarsia species was 9.7%. For comparison, the %D between E. diaspidicola and A. albitibiae was 13.3Ð 13.5% and between E. berlesei and A. albitibiae it was 14.9 Ð15.2%. At the amino acid level, the %D between the two Encarsia species was 4.8 Ð5.4%. A single most parsimonious phylogram showed that each Encarsia spp. formed it own taxonomic unit or clade, conÞrming species boundaries (Fig. 1). A neighbor-joining distance phylogram showed the same tree topology as the parsimonious tree (data not shown). Molecular Analysis of E. diaspidicola and E. berlesei by ISSR-PCR DNA Fingerprinting. To determine whether ISSR-PCR could be used as a diagnostic tool to discriminate the two Encarsia spp., we subjected adult specimens to ISSR-PCR DNA Þngerprinting. Figure 2A shows the DNA Þngerprinting results performed with the compound ISSR primer. Fixed ISSRPCR banding pattern differences were observed between the two Encarsia spp., with no band sharing seen between the two. Eleven E. berlesei-speciÞc and Þve E. diaspidicola-speciÞc bands were observed. The E. berlesei-speciÞc bands ranged in size from above 1,000 bp to below 400 bp, and the E. diaspidicolaspeciÞc bands ranged in size from below 850 bp to ⬇400 bp. A similar situation was seen with the 5⬘anchored ISSR primer (Fig. 2B). Again, Þxed speciesspeciÞc ISSR-PCR banding pattern differences were observed between the two Encarsia spp. with no apparent band sharing. Within certain specimens of E. diaspidicola, there seemed to be some slight variation in size, for example, at the 850-bp mark, below 850 bp, below 650 bp, and at the 400-bp mark. This type of slight variation in size is not uncommon to see at hypermutable microsatellite sites (Zietkiewicz et al. 1994, Witsenboer et al. 1997, de Leo´ n et al. 2004b). Five E. berlesei-speciÞc and eight E. diaspidicola-spe-

Fig. 2. ISSR-PCR DNA Þngerprinting. Five individual adults of each E. diaspidicola and E. berlesei were subjected to DNA Þngerprinting with a compound ISSR primer (A) and a 5⬘-anchored ISSR primer (B). M, 1.0-kb Plus DNA ladder.

912


Vol. 103, no. 3

Fig. 3. SpeciÞcity assays using the developed species-speciÞc COI molecular markers. (A) Edia-F/R (E. diaspidicola) (expected size, 326 bp), (B) Eber-F/R (E. berlesei) (326 bp), (C) Aalb-F/R (A. albitibiae) (251 bp), and (D) 28S primer set. Total genomic DNA per species (three individuals each) was used in ampliÞcation assays. Negative control contains water instead of template DNA. M, 1.0-kb Plus DNA ladder.

ciÞc bands were generated with the 5⬘-anchored ISSR primer. With this ISSR primer the bands generated in E. berlesei ranged in size from 650 bp to below the 300-bp mark and in E. diaspidicola the bands ranged in size from the 850-bp mark to above the 200-bp mark. Development and Specificity of the Species-Specific COI Molecular Markers. Three primer sets were designed that discriminated the species of interest from each other and other nontarget species found in Hawaii. To determine the speciÞcity of the three markers, we tested speciÞc ampliÞcation assay conditions (Table 1) and tested them for cross-reactivity. Figure 3 shows that all of the developed markers ampliÞed DNA fragments of the correct size and all were highly speciÞc as cross-reactivity with the speciÞc assay conditions was not seen with any of the nontarget species. The internal control, 28S ampliÞcation, was seen across all samples, indicating that PCR inhibitors or failures did not play a role in these reactions (Fig. 3D). Stated differently, what this internal control conÞrms is that the negative banding seen in nontarget species is due to the fact that the designed molecular markers are highly speciÞc as opposed to the effects of PCR inhibitors, PCR failures, or DNA extraction failures of the tiny specimens, as described in other work (Vega et al. 1993, Pooler et al. 1997, de Leo´ n et al. 2006a).

Detection of Parasitism in the White Peach Scale Exposed to E. diaspidicola. To test the utility of the developed E. diaspidicola-speciÞc COI markers, quarantine experiments were designed exposing white peach scales to E. diaspidicola. Nonexposed scales showed negative ampliÞcation when assayed with the E. diaspidicola markers, whereas the positive control (E. diaspidicola genomic DNA) showed positive ampliÞcation. Positive ampliÞcation also was seen with the internal control, the 28S gene (data not shown). Figure 4 shows the results of white peach scales exposed to E. diaspidicola. In this representative experiment, 11 of 20 or 55% of the scales tested positive for E. diaspidicola. Two more replications of the same experiment showed parasitism of white peach scale at 70 and 60% (data not shown), conÞrming that the white peach scale serves as a host for E. diaspidicola. Time of Detection of E. diaspidicola Parasitism of White Peach Scale. To determine the amount of time required for detection of E. diaspidicola parasitism of white peach scale we exposed them to the endoparasitoids and varied the exposure time (24, 48, and 72 h). Figure 5 shows results of time point experiments. Four replications were performed for 60 specimens in total. E. diaspidicola (egg stage) was detected within its host by 24 h (Fig. 5A and C). At 48 h in replication 1, two individuals (1 and 4) generated negative banding, however, this was due

June 2010

DE


913

Fig. 4. Representative experiment screening 20 white peach scale individuals exposed to E. diaspidicola in quarantine. The scales were assayed with the E. diaspidicola-speciÞc COI molecular markers. The negative control does not include template DNA and the positive control is genomic DNA from an E. diapidicola individual. M, 1.0-kb Plus DNA ladder.

to DNA extraction failures of the tiny specimens as the internal control (28S ampliÞcation) also failed to amplify (Fig. 5B). The two 28S bands pertaining to both the scale (top band, above the 650-bp marker) and the endoparasitoid (bottom band, above the 500-bp marker) are seen in the same lane. These two

28S bands were seen in separate lanes in Fig. 3D. In certain assays, for example, in replication 4 at 24 h, ampliÞcation was not seen with the E. diaspidicolaspeciÞc markers in individuals 2 and 4 (Fig. 5C). However, ampliÞcation with the internal control produced the band for the scale but not the band for

Fig. 5. Time point experiments of detection of E. diaspidicola parasitism of white peach scale. White peach scales were exposed to E. diaspidicola and at the indicated time point (24, 48, and 72 h), and the scales were frozen until they were they were ready for processing. Exposed white peach scales were assayed with the E. diaspidicola-speciÞc COI markers: replication 1 (A) and 28S internal control for 24, 48, and 72 h (B) and replication 4 (C) and 28S control for 24 h (D). Neg. crtl, negative control (no template DNA). M, 1.0-kb Plus DNA ladder.

914


the endoparasitoid (Fig. 5D). In this particular case, the negative ampliÞcation with the E. diaspidicolaspeciÞc markers was due to the lack of parasitism and not to DNA extraction failures. Discussion To our knowledge, the current work represents the Þrst molecular genetic study of these two morphologically similar endoparasitoids (E. diaspidicola and E. berlesei) used worldwide in various biological control programs (Collins and Whitcomb 1975, Clausen et al. 1978, Liebregts et al. 1989, Sands et al. 1990). Two molecular methods, phylogenetic analysis of the COI gene and ISSR-PCR DNA Þngerprinting were used; both were in accord and successfully discriminated the two Encarsia spp. Analysis of the COI gene uncovered 46-bp differences between the two species and the two formed their own clade on a phylogenetic tree with strong bootstrap support (Fig. 1). The levels of COI genetic divergence between them was 9.7%, very similar to the COI divergence (10%) seen between populations of E. sophia from Pakistan (M95107) and Spain (M93003) (Monti et al. 2005) known to be cryptic species, as measured by reproductive incompatibility (Giorgini and Baldanza 2004). The two E. sophia strains were not discriminated based on a phylogenetic analysis inferred from the D2 loop of the 28S gene (Babcock et al. 2001), supporting the use of the COI gene as an alternative in the current study. Using a generalized molecular clock estimate for insect mitochondrial DNA of 2.3% per million years (Brower 1994) to roughly indicate the length of time since the two Encarsia spp. diverged using the maximum pairwise divergence (9.7%) suggests that the two species diverged 4.22 million yr ago. The ISSR-PCR DNA Þngerprinting method also readily distinguished the adult stages of E. diaspidicola and E. berlesei with two separate ISSR primers. Not sharing of bands is usually an indication of lack of gene ßow and reproductive isolation (Hoy et al. 2000; de Leo´ n et al. 2004a, 2006b, 2008; Triapitsyn et al. 2008). We have used this sensitive method extensively and have shown it to be very useful in uncovering species level divergences in a majority of cases, speciÞcally with egg parasitoids of sharpshooters belonging to the genus Gonatocerus Nees (de Leo´ n et al. 2004a, 2006b, 2008; de Leo´ n and Morgan 2007; Triapitsyn et al. 2008). The nucleotide differences observed in the COI gene allowed us to design “one- step” species-speciÞc molecular markers that were speciÞc toward the species for which they were designed. It should be noted that there are ⬇17 species of Encarsia in Hawaii, with six found on the Big Island; however, none of these species are known to attack or be associated with the white peach scale (P.A.F., unpublished data). One of the COI markers (E. diaspidicola-speciÞc) tested was also successful at detecting parasitism of white peach scale by E. diaspidicola. These results indicate that the current molecular markers have the capacity to detect

Vol. 103, no. 3

immature stages (eggs and larvae) of E. diaspidicola within its host and the results conÞrmed that the endoparasitoids were detected by 24 h. In the current study, as in previous work with molecular predation studies (de Leo´ n et al. 2006a, Fournier et al. 2008), we demonstrated the importance of including an internal control (28S ampliÞcation) for these types of molecular marker assays. The internal controls become even more important when working with tiny insects, as in the current study. The importance of the internal control to obtain accurate and correct information was demonstrated, for example, in the time point experiments (white peach scale exposed to E. diaspidicola) (Fig. 5). Two different situations were observed: 1) negative ampliÞcation with the E. diaspidicola-speciÞc COI markers was seen in two individuals at the 48-h time point (replication 1) (Fig. 5A); however, the negative ampliÞcation of the 28S gene (Fig. 5B) indicated that this was due to DNA extraction failures; and 2) negative ampliÞcation with the E. diaspidicola-speciÞc markers was seen in two specimens at the 24-h time point (replication 4) (Fig. 5C). The positive ampliÞcation of the 28S gene (white peach scale band at above the 650-bp marker) (Fig. 5D) demonstrated that the E. diaspidicola negative banding was due to the fact that the white peach scale was not parasitized, thus demonstrating the utility of the control. Other authors have used internal controls targeting other genes, for example, the mitochondrial 12S rDNA (Hoogendoorn and Heimpel 2001) and the actin gene (Zaidi et al. 1999). Dissecting a small host such as the white peach scale and attempting to Þnd even much smaller eggs or larvae of the endoparasitoids by microscopic examinations can be challenging and laborious. However, the molecular markers can aid in overcoming these challenges. As demonstrated in the current study, the markers (E. diaspidicola-speciÞc COI) detected parasitism of white peach scale by 24 h. This capability can save time by ⬇34 d. For example, it takes E. berlesei ⬇28 d to complete development (Be´ nassy 1958), and a similar amount of time (35 d) has been estimated for E. diaspidicola (G.N., unpublished data). The markers can also make measuring “percent parasitism” more accurate and therefore better estimate the impact of natural enemies on host populations (Van Driesche 1983). Plans are in progress for other uses for the current molecular COI markers that include studying the competitive interactions between parasitoids, for example, between the native A. albitibiae and the imported E. diaspidicola in Hawaii. Future studies also include performing phylogeographic analyses of both Encarsia spp. inferred from the COI gene. Acknowledgments We acknowledge Marissa Gonza´lez (USDAÐARS, Weslaco, TX) for excellent technical assistance with the molecular work. We thank Christine A. Nalepa (Biological Control Laboratory, North Carolina Department of Agriculture) for kindly providing the endoparasitoid E. berlesei. We thank James R. Hagler (USDAÐARS, Maricopa) and Daniel

June 2010

DE


Murray (USDAÐARS, Weslaco) for reading and improving a previous version of the manuscript. We thank the anonymous reviewers and the editor for improving the manuscript.

References Cited Babcock, C. S., J. M. Heraty, P. J. De Barro, F. Driver, and S. Schmidt. 2001. Preliminary phylogeny of Encarsia Fo¨ rster (Hymenoptera: Aphelinidae) based on morphology and 28S rDNA. Mol. Phylogenet. Evol. 18: 306 Ð323. Be´ nassy, C. 1958. E´ tude bio-e´ cologique de Pseudaulacaspis pentagona Targ. Et de son parasite spe´ ciÞque Prospaltella berlesei Howard, en France. Ann. E´ piphyt. 9: 425Ð 496. Bennett, F. D., and S. W. Brown. 1958. Life history and sex determination in the diaspine scale, Pseudaulacaspis pentagona (Targ.) (Coccoidae). Can. Entomol. 90: 317Ð324. Brower, A.V.Z. 1994. Rapid morphological radiation and convergence among races of the butterßy Heliconius erato inferred from patterns of mitochondrial DNA evolution. Proc. Natl. Acad. Sci. U.S.A. 91: 6491Ð 6495. Clausen, C. P., B. R. Barlett, P. DeBach, R. G. Goeden, E. F. Leger, J. A. McMurtry, E. R. Oatman, E. C. Bay, and D. Rosen. 1978. Introduced parasites and predators of arthropod pests and weeds: a world review. Agric. Handb. U.S. Dep. Agric. 480. Collins, F. A., and W. H. Whitcomb. 1975. Natural enemies of the white peach scale, Pseudaulacaspis pentagona (Homoptera: Coccidae), in Florida. Fla. Entomol. 58: 15Ð21. de Leo´ n, J. H., and D.J.W. Morgan. 2007. Evaluation of molecular markers for discriminating Gonatocerus morrilli (Hymenoptera: Mymaridae): a biological control agent for Homalodisca vitripennis. Ann. Entomol. Soc. Am. 100: 749 Ð757. de Leo´ n, J. H., W. A. Jones, and D.J.W. Morgan. 2004a. Molecular distinction between populations of Gonatocerus morrilli, egg parasitoids of the glassy-winged sharpshooter Homalodisca coagulata, from Texas and California: do cryptic species exist? J. Insect Sci. 4:39 (insectscience.org/4.39). de Leo´ n, J. H., W. A. Jones, and D.J.W. Morgan. 2004b. Population genetic structure of Homalodisca coagulata (Homoptera: Cicadellidae), the vector of the bacterium Xylella fastidiosa causing PierceÕs disease in grapevines. Ann. Entomol. Soc. Am. 97: 809 Ð 818. de Leo´ n, J. H., V. Fournier, J. R. Hagler, and K. M. Daane. 2006a. Development of molecular diagnostic markers for sharpshooters Homalodisca coagulata and H. liturata for use in predator gut content examinations. Entomol. Exp. Appl. 119: 109 Ð119. de Leo´ n, J. H., W. A. Jones, M. Se´tamou, and D.J.W. Morgan. 2006b. Genetic and hybridization evidence conÞrms that a geographic population of Gonatocerus morrilli (Hymenoptera: Mymaridae) from California is a new species: egg parasitoids of the glassy-winged sharpshooter Homalodisca coagulata (Homoptera: Cicadellidae). Biol. Control 38: 282Ð293. de Leo´ n, J. H., G. A. Logarzo, and S. V. Triapitsyn. 2008. Molecular characterization of Gonatocerus tuberculifemur (Ogloblin) (Hymenoptera: Mymaridae), a prospective Homalodisca vitripennis (Germar) (Hemiptera: Cicadellidae) biological control candidate agent from South America: divergent clades. Bull. Entomol. Res. 98: 97Ð108. Felsenstein, J. 1985. ConÞdence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783Ð791.

915

Flanders, S. E. 1960. The status of San Jose scale parasitization (including biological notes). J. Econ. Entomol. 53: 757Ð759. Follett, P. A. 2000. Arthropod pest of papaya in Hawaii. Chron. Horticult. 40: 7Ð10. Fournier, V., J. R. Hagler, K. M. Daane, J. H. de Leo´ n, R. L. Groves, H. S. Costa, and T. J. Henneberry. 2008. Identifying the predator complex of Homalodisca vitripennis (Hemiptera: Cicadellidae): a comparative study of the efÞcacy of an ELISA and PCR gut content assay. Oecologia 157: 629 Ð 640. Giorgini, M., and F. Baldanza. 2004. Species status of two populations of Encarsia Sophia (Girault & Dodd) (Hymenoptera: Aphelinidae) native to different geographic areas. Biol. Control 30: 25Ð35. Greathead, D. J. 1976. A review of biological control in western and southern Europe. Tech. Comm. 7. Commonwealth Agricultural Bureaux, London, United Kingdom. Higgins, D., J. Thompson, T. Gibson, J. D. Thompson, D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-speciÞc gap penalties and weight matrix choice. Nucleic Acids Res. 22: 4673Ð 4680. Hoogendoorn, M., and G. E. Heimpel. 2001. PCR-based gut content analysis of insect predators: using ribosomal ITS-1 fragments from prey to estimate predation frequency. Mol. Ecol. 10: 2059 Ð2067. Hoy, M. A., J. Ayyamperumal, R. Morakete, M.K.C. Lo, and R. Nguyen. 2000. Genomic analyses of two populations of Ageniaspis citricola (Hymenoptera: Encyrtidae) suggest that a cryptic species may exist. Biol. Control 17: 1Ð10. Liebregts, W.J.M.M., D.P.A. Sands, and A. S. Bourne. 1989. Population studies and biological control of Pseudalacaspis pentagona (Targioni-Tozzetti) (Homoptera: Diaspididae) on passion fruit in Western Samoa. Bull. Entomol. Res. 79: 163Ð171. Monti, M. M., A. G. Nappo, and M. Giorgini. 2005. Molecular characterization of closely related species in the parasitic genus Encarsia (Hymenoptera: Aphelinidae) based on the mitochondrial cytochrome oxidase subunit I gene. Bull. Entomol. Res. 95: 401Ð 408. Peters, A., I. Aloalii, R. G. Hollingsworth, and H. Hammans. 1985. Insecticidal control of white peach scale (Pseudaulacaspis pentagona) on passion fruit (Passiflora edulis var. flavicarpa) in western Samoa. Alafua Agric. Bull. 10: 13Ð17. Pooler, M. R., I. S. Myung, J. Bentz, J. Sherald, and J. S. Hartung. 1997. Detection of Xylella fastidiosa in potential insect vectors by immunomagnetic separation and nested polymerase chain reaction. Lett. Appl. Microbiol. 25: 123Ð126. Porter, C. H., and F. H. Collins. 1991. Species-diagnostic difference in a ribosomal DNA internal transcribed spacer from the sibling species Anopheles freeborni and Anopheles hermsi (Diptera: Culicidae). Am. J. Trop. Med. Hyg. 45: 271Ð279. Saitou, N., and M. Nei. 1987. The neighbour-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406 Ð 425. Sands, D.P.A., R. Broe, and W.J.M.M. Liebregts. 1990. Identity of Encarsia spp. (Hymenoptera: Apheninidae) introduced into western Samoa for biological control of Pseudalacaspis pentagona (Targioni-Tozzetti) (Homoptera: Diaspididae). Proc. Entomol. Soc. Wash. 92: 135Ð138. Simon, C., F. Frati, A. Bechenbach, B. Crespi, H. Liu, and P. Flook. 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compila-

916


tion of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87: 651Ð701. Swofford, D. L. 2002. PAUP*: phylogenetic analysis using Parsimony (*and other methods). Version 4. Sinauer, Sunderland, MA. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The ClustalX windows interface: ßexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25: 4876 Ð 4882. Triapitsyn, S. V., G. A. Logarzo, J. H. de Leo´ n, and E. G. Virla. 2008. A new Gonatocerus (Hymenoptera: Mymaridae) from Argentina, with taxonomic notes and molecular data on the G. tuberculifemur species complex. Zootaxa 1949: 1Ð29. Van Driesche, R. G. 1983. Meaning of “percent parasitism” in studies of insect parasitoids. Environ. Entomol. 12: 1611Ð1622. Vega, F. E., R. E. Davis, P. Barbosa, E. L. Dally, A. H. Purcell, and I. M. Lee. 1993. Detection of plant pathogen in a

Vol. 103, no. 3

nonvector insect species by the polymerase chain reaction. Phytopathology 83: 621Ð 624. Werren, J. H., D. Windsor, and L. Guo. 1995. Distribution of Wolbachia among Neotropical arthropods. Proc. R. Soc. Lond. Ser. B 262: 197Ð204. Witsenboer, H., J. Vogel, and R. W. Michelmore. 1997. IdentiÞcation, genetic localisation and allelic diversity of ampliÞed microsatellite polymorphic loci in lettuce and wild relatives (Lactuca ssp.). Genome 40: 923Ð936. Zaidi, R. H., Z. Jaal, N. J. Hawkes, J. Hemingway, and W.O.C. Symondson. 1999. Can multiple-copy sequences of prey DNA be detected amongst the gut contents of invertebrate predators? Mol. Ecol. 8: 2081Ð2020. Zietkiewicz, E., A. Rafalski, and D. Labuda. 1994. Genomic Þngerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction ampliÞcation. Genomics 20: 176 Ð183. Received 21 September 2009; accepted 26 January 2010.