ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Nov. 2005, p. 4798–4800 0066-4804/05/$08.00⫹0 doi:10.1128/AAC.49.11.4798–4800.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Vol. 49, No. 11
Multiplex PCR for Simultaneous Detection of Macrolide and Tetracycline Resistance Determinants in Streptococci Surbhi Malhotra-Kumar,* Christine Lammens, Jasper Piessens, and Herman Goossens Belgian Reference Center for Group A Streptococcus, University of Antwerp, Antwerp, Belgium Received 31 May 2005/Returned for modification 29 July 2005/Accepted 26 August 2005
Resistance to macrolides and tetracyclines is increasing among streptococci and co-occurs as their resistance determinants are carried on the same mobile element. We developed a multiplex PCR to facilitate simultaneous and specific detection of resistance determinants for both macrolides [erm(A), erm(B), and mef(A/E)] and tetracyclines [tet(M), tet(O), tet(K), and tet(L)] in streptococci. a multiplex PCR procedure that enables simultaneous detection of three macrolide [erm(A), erm(B), and mef(A/E)] and four tetracycline [tet(M), tet(O), tet(K), and tet(L)] resistance determinants in streptococci. (A preliminary account of this work was presented at the 44th International Conference on Antimicrobial Agents and Chemotherapy, Washington, D.C., 30 October to 2 November 2004.) We utilized the following resistant reference strains as positive controls: erm(A), S. pyogenes UR1092 (10); erm(B), S. pyogenes BM137 (9); mef(A) S. pyogenes STP046 (10); tet(M), S. pyogenes BM137 (9); tet(O), Enterococcus faecalis BM4110 (9); tet(K), S. aureus R-16794 (6) (BCCM/LMG Bacteria Collection, Ghent University, Belgium; http://bccm .belspo.be/db/bacteria_search.htm); and tet(L), E. faecalis P33 (BCCM/LMG Bacteria Collection). Genomic DNA was extracted either with GenElute Bacterial Genomic Miniprep (Sigma-Aldrich) or by alkaline lysis (14). For the latter, two to four bacterial colonies were emulsified in 20 l lysis buffer (0.25% sodium dodecyl sulfate, 0.05 N NaOH) at 94°C for 5 min. The lysates were diluted with 180 l water and centrifuged at 16,000 ⫻ g for 5 min, and the supernatants were directly used as template DNA. The genotypes of the reference strains were confirmed with individual (singlex) PCRs using known primers for erm(A) (10), erm(B) (15), mef(A)/mef(E) (15), tet(M) (17), tet(O) (11), tet(K) (11), and tet(L) (11). All strains gave expected PCR products. Genomic DNA from the six reference strains was further pooled in equimolar amounts and served as a multiplex control for seven resistance determinants and one housekeeping control (see below). According to published guidelines (5), PCR conditions were optimized and the following considerations were taken while designing primers. One, cross-annealing and specificity of the primers were examined using BLAST (www.ncbi.nlm.nih.gov). Two, primer pairs generating amplicons with at least a 50-bp difference were chosen to facilitate their electrophoretic separation. Three, the melting temperature was kept close to 60°C for all primer pairs. Thus, new primers for erm(B), mef, tet(K), and tet(L) genes were designed using Primer3 software (http: //www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) and synthesized (Eurogentec, Seraing, Belgium) (Table 1). Four, consensus primers for mef were chosen that amplified both mef(A) and mef(E). Finally, consensus primers amplifying
Macrolides and tetracyclines are among the most common antibiotics employed for the treatment of streptococcal infections. However, a concomitant increase in resistance to both these antibiotics has been observed among pathogenic and commensal streptococci, mostly because their major resistance determinants are carried on the same mobile element (2, 4, 9, 12, 13). Resistance to macrolides in streptococci occurs by two main mechanisms. First, erm(B)/erm(A) gene products methylate specific residues in 23S rRNA and disable macrolide binding to its target (7). Rarely, mutations in 23S rRNA or in the ribosomal proteins L4 and L22 also modify the macrolide binding site, causing macrolide resistance (3, 16). The second major mechanism is active macrolide efflux, mediated by an ABC transporter. The transmembrane domains of this pump are encoded by mef genes [mef(A) in Streptococcus pyogenes and mef(E) in S. pneumoniae] and the ATP-binding domains by the msr(D) gene (F. Ianelli, M. Santagati, J.-D. Docquier, M. Cassone, M. R. Oggioni, G. Rossolini, S. Stefani, and G. Pozzi, Abstr. 44th Intersci. Conf. Antimicrob. Agents Chemother., abstr. C1-1188, 2004). Tetracycline resistance in streptococci is mediated by ribosomal protection proteins encoded mainly by the tet(M) or tet(O) genes. These proteins are homologous to elongation factors EF-G and EF-Tu and possess GTPase activity that is important in the displacement of tetracycline from the ribosome (1). In contrast to macrolide resistance, efflux pumps for tetracycline encoded by the tet(K) or tet(L) genes in streptococci are relatively uncommon (13). PCR has been widely used to detect the presence of resistance genes in human or animal streptococci. However, because streptococci carrying more than one macrolide/tetracycline resistance determinant are increasingly being noted, many separate PCRs have to be performed to detect their presence (4, 9, 12, 13). Although the correlation between the presence of erm(B) and tet(M) is well established (2, 9) and there is also evidence suggesting a genetic linkage of tet(O) with erm(A) or mef(A) (4), assays for simultaneous detection of macrolide and tetracycline resistance determinants in streptococci have not been previously developed. Here we describe
* Corresponding author. Mailing address: Department of Medical Microbiology, Campus Drie Eiken, University of Antwerp, S3, Universiteitsplein 1, B-2610 Wilrijk, Belgium. Phone: 32-3-820-25-51. Fax: 32-3-820-26-63. E-mail:
[email protected]. 4798
VOL. 49, 2005
NOTES
4799
TABLE 1. Primers used in the multiplex PCR assay Gene(s)
erm(A) erm(B) mef(A/E) tet(M) tet(O) tet(K) tet(L) 16S rRNA
Primer sequence (5⬘ to 3⬘)
CCCGAAAAATACGCAAAATTTCAT CCCTGTTTACCCATTTATAAACG TGGTATTCCAAATGCGTAATG CTGTGGTATGGCGGGTAAGT CAATATGGGCAGGGCAAG AAGCTGTTCCAATGCTACGG GTGGACAAAGGTACAACGAG CGGTAAAGTTCGTCACACAC AACTTAGGCATTCTGGCTCAC TCCCACTGTTCCATATCGTCA GATCAATTGTAGCTTTAGGTGAAGG TTTTGTTGATTTACCAGGTACCATT TGGTGGAATGATAGCCCATT CAGGAATGACAGCACGCTAA GAGTACGACCGCAAGGTTGA CTGGTAAGGTTCTTCGCGTTG
Amplicon size (bp)
GenBank accession no. or reference
590
10
745
X52632
317
U70055, U83667
406
17
515
11
155
S67449
229
U17153
100
—a
a For 16S rRNA, consensus primers were developed based on genes from the following streptococcal species (accession no.): S. pyogenes (AY273147), S. pneumoniae (NC_003098), S. mitis (AF003929), S. salivarius (AY188352), S. parasanguinis (AF003933), S. thermophilus (NC_006449), S. constellatus (AY277938), and S. anginosus (AY309096).
the 16S rRNA gene were designed that served as internal controls for all streptococci analyzed here (Table 1). PCR was performed in a final volume of 50 l of 0.8⫻ PCR buffer (50 mM KCl, 10 mM Tris-HCl [pH 9.0], 0.1% Triton X-100, 0.01% [wt/vol] stabilizer, 1.5 mM MgCl2) containing 300 M deoxynucleoside triphosphates, 3.5 mM MgCl2, 2 U Taq polymerase (Invitrogen, Carlsbad, Calif.), and 10 to 15 ng of template DNA. Optimized primer concentrations were as follows: erm(A), 0.5 M; erm(B), 0.5 M; mef(A/E), 0.2 M; tet(M), 0.4 M; tet(O), 0.3 M; tet(L), 0.4 M; tet(K), 0.1 M; and 16S rRNA, 0.16 M. PCR was performed on a DNA thermal cycler (9600 GeneAmp PCR System; Perkin-Elmer, Zaventem, Belgium) with the following cycling conditions: an initial cycle of 3 min at 93°C, 30 cycles of 1 min of denaturation
at 93°C, 1 min of annealing at 62°C, and 4 min of extension at 65°C, followed by one cycle of 3 min of elongation at 65°C. PCR products were analyzed by electrophoresis in a 1.5% agarose gel at 150 V for 1.05 h in 0.5⫻ TBE (45 mM Tris-HCl, 45 mM boric acid, 1 mM EDTA) containing 0.05 mg/liter ethidium bromide. Visualization and image acquisition was performed with Gel-Doc-1000 (Bio-Rad Laboratories, Nazareth, Belgium). Using these conditions, the pooled positive control yielded eight expected bands (Fig. 1, lane C). This technique was further validated on 125 previously characterized macrolide- and tetracycline-resistant (n ⫽ 95) and -sus ceptible (n ⫽ 30) streptococci, comprising S. pneumoniae (n ⫽ 42) (J. Van Eldere et al., unpublished data), S. pyogenes (n ⫽ 49) (8), and viridans streptococci (S. mitis [n ⫽ 14],
FIG. 1. Agarose gel electrophoresis of multiplex PCR products as well their phenotypic description and resistance gene content. The control lane (C) amplifies all genes from DNA samples pooled from the six reference strains. Lane M, molecular size standard (100-bp DNA ladder; Invitrogen).
4800
NOTES
ANTIMICROB. AGENTS CHEMOTHER.
TABLE 2. Streptococcal isolates (n ⫽ 125) grouped according to their macrolide and tetracycline resistance gene content, as detected by the multiplex assay, and corresponding MIC rangesa Presence of gene:
MIC range (g/ml)
No. of streptococci
erm(B)
mef(A/E)
erm(A)
tet(M)
tet(O)
tet(K)
tet(L)
16S
Erythromycin
Clindamycin
Tetracycline
6 7 47 1 9 2 2 17 1 1 2 30
⫹ ⫹ ⫹ ⫹ ⫹ 0 0 0 0 0 0 0
⫹ ⫹ 0 0 0 ⫹ ⫹ ⫹ 0 0 0 0
0 0 0 0 0 0 0 0 ⫹ ⫹ 0 0
0 ⫹ ⫹ ⫹ 0 0 ⫹ 0 ⫹ 0 0 0
⫹ 0 0 ⫹ 0 ⫹ 0 0 0 ⫹ 0 0
0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0
⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹
256–⬎512 16–⬎512 32–512 256 512–⬎512 4 and 8 4 and 16 0.12–16 1 512 512 ⱕ0.03–0.12
⬎512 ⬎512 16–⬎512 ⬎512 ⬎512 0.03 0.03 0.03–0.25 0.5 0.25 32 and 512 ⱕ0.03–0.5
64 16–128 0.5–128 64 0.25–0.5 32 1 and 64 0.06–0.5 64 64 0.5 0.06–0.5
Sensitivity Specificity
70/70 55/55
34/34 91/91
2/2 123/123
58/58 67/67
10/10 115/115
NA 125/125
NA 125/125
NA NA
a Compared to the singlex PCRs, the multiplex assay detected the presence and absence of the resistance genes with 100% sensitivity and specificity, shown in the lower part of the table. NA, not applicable.
S. parasanguinis [n ⫽ 5], S. thermophilus [n ⫽ 5], S. salivarius [n ⫽ 6], S. constellatus [n ⫽ 2], S. anginosus [n ⫽ 1], and S. cristatus [n ⫽ 1]) (9). Seven singlex PCRs and the multiplex PCR were performed on DNA extracted by two methods for these 125 isolates. The pooled DNA from the six reference strains served as a positive control ladder (Fig. 1). No discordance was noted between the two types of DNA extraction procedures for either singlex or multiplex PCR. Compared to singlex PCR results, the multiplex PCR identified genes with 100% sensitivity and specificity (Table 2). Thus, the described multiplex assay could be a useful tool to analyze seven commonly occurring antibiotic resistance genes in streptococci. In addition, the use of 16S rRNA as a housekeeping positive control would facilitate DNA and PCR quality control. Lastly, the multiplex PCR described here is not free from the limitations inherent to any PCR assay, i.e., falsenegative data due to mutations in the primer-annealing region of the gene amplified or false-positive results caused by gene inactivation due to insertions and/or deletions in regions outside the PCR product. Thus, to correctly interpret PCR results, it is imperative to characterize resistance gene expression in bacterial isolates by means of phenotypic tests like MICs and disk diffusion. Notwithstanding these limitations, the single-step multiplex assay described here will prove economical in terms of labor, time, and cost for studies investigating large numbers of streptococci for macrolide and tetracycline resistance mechanisms. We are grateful to J. Van Eldere and J. Verhaegen for providing S. pneumoniae isolates and to G. Huys for the reference strains S. aureus R-16794 and E. faecalis P33. REFERENCES 1. Chopra, I., and M. Roberts. 2001. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 65:232–260. 2. Clewell, D. B., S. E. Flannagan, and D. D. Jaworski. 1995. Unconstrained bacterial promiscuity: the Tn916-Tn1545 family of conjugative transposons. Trends Microbiol. 3:229–236. 3. Depardieu, F., and P. Courvalin. 2001. Mutation in 23S rRNA responsible for resistance to 16-membered macrolides and streptogramins in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 45:319–323.
4. Giovanetti, E., A. Brenciani, R. Lupidi, M. C. Roberts, and P. E. Varaldo. 2003. Presence of the tet(O) gene in erythromycin- and tetracycline-resistant strains of Streptococcus pyogenes and linkage with either the mef(A) or the erm(A) gene. Antimicrob. Agents Chemother. 47:2844–2849. 5. Henegariu, O., N. A. Heerema, S. R. Dlouhy, G. H. Vance, and P. H. Vogt. 1997. Multiplex PCR: critical parameters and step-by-step protocol. BioTechniques 23:504–511. 6. Huys, G., K. D’Haene, J. Van Eldere, A. von Holy, and J. Swings. 2005. Molecular diversity and characterization of tetracycline-resistant Staphylococcus aureus isolates from a poultry processing plant. Appl. Environ. Microbiol. 71:574–579. 7. Leclercq, R. 2002. Mechanisms of resistance to macrolides and lincosamides: nature of the resistance elements and their clinical implications. Clin. Infect. Dis. 34:482–492. 8. Malhotra-Kumar, S., C. Lammens, S. Chapelle, M. Wijdooghe, J. Piessens, K. Van Herck, and H. Goossens. 2005. Macrolide- and telithromycin-resistant Streptococcus pyogenes, Belgium, 1999–2003. Emerg. Infect. Dis. 11:939–942. 9. Malhotra-Kumar, S., C. Lammens, A. Martel, C. Mallentjer, S. Chapelle, J. Verhoeven, M. Wijdooghe, F. Haesebrouck, and H. Goossens. 2004. Oropharyngeal carriage of macrolide-resistant viridans group streptococci: a prevalence study among healthy adults in Belgium. J. Antimicrob. Chemother. 53:271–276. 10. Malhotra-Kumar, S., S. Wang, C. Lammens, S. Chapelle, and H. Goossens. 2003. Bacitracin-resistant clone of Streptococcus pyogenes isolated from pharyngitis patients in Belgium. J. Clin. Microbiol. 41:5282–5284. 11. Ng, L. K., I. Martin, M. Alfa, and M. Mulvey. 2001. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 15:209–215. 12. Nielsen, H. U., A. M. Hammerum, K. Ekelund, D. Bang, L. V. Pallesen, and N. Frimodt-Moller. 2004. Tetracycline and macrolide co-resistance in Streptococcus pyogenes: co-selection as a reason for increase in macrolide-resistant S. pyogenes? Microb. Drug Resist. 10:231–238. 13. Rodriguez-Avial, I., C. Rodriguez-Avial, E. Culebras, and J. J. Picazo. 2003. Distribution of tetracycline resistance genes tet(M), tet(O), tet(L) and tet(K) in blood isolates of viridans group streptococci harbouring erm(B) and mef(A) genes. Susceptibility to quinupristin/dalfopristin and linezolid. Int. J. Antimicrob. Agents 21:536–541. 14. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 15. Sutcliffe, J., T. Grebe, A. Tait-Kamradt, and L. Wondrack. 1996. Detection of erythromycin-resistant determinants by PCR. Antimicrob. Agents Chemother. 40:2562–2566. 16. Tait-Kamradt, A., T. Davies, P. C. Appelbaum, F. Depardieu, P. Courvalin, J. Petitpas, L. Wondrack, A. Walker, M. R. Jacobs, and J. Sutcliffe. 2000. Two new mechanisms of macrolide resistance in clinical strains of Streptococcus pneumoniae from eastern Europe and North America. Antimicrob. Agents Chemother. 44:3395–3401. 17. Warsa, U. C., M. Nonoyama, T. Ida, R. Okamoto, T. Okubo, C. Shimauchi, A. Kuga, and M. Inoue. 1996. Detection of tet(K) and tet(M) in Staphylococcus aureus of Asian countries by the polymerase chain reaction. J. Antibiot. (Tokyo) 49:1127–1132.
