New Drug Targets in Infectious Diseases?

206 Infectious Disorders - Drug Targets 2008, Vol. 8, No. 4

Editorial

Editorial New Strategies and Tools to Identify Drug Targets on Infectious Disorders In spite the great advances on biomedical sciences, and in particular on the analysis of the immune response regarding cells, mechanisms, signaling pathways and genes involved, together with a plethora of genetically modified animal models, infectious diseases still keep increasing in the world population, both on terms of morbidity and mortality. Naïve CD4+ T lymphocytes, upon encountering antigen, differentiate towards Th1 or Th2 cells, and the signals leading to the induction of one or the other T cell subset are well known. Similarly, the mechanisms used by CD8+ cytotoxic T cells to kill their specific targets have been unraveled and conditions leading to the induction of different phenotypes (Tc1, Tc2) established. However, this increased knowledge on immune response mechanisms (both cellular and molecular) has not yet been reflected on the identification of new drug targets to fight infection. The aim of this special issue is to discuss the reasons that might explain, at least in part and form the point of view of the authors, the lack of new drug targets on infectious diseases. The first manuscript by R. Vernal & J.A. Garcia-Sanz discusses two new T lymphocyte subpopulations, namely Th17 cells and regulatory T cells, with a profound impact on the outcome of the T cell responses, analyzing in particular their role in different infections. A manuscript by F. Erard & B. Ryffel follows in which the potential of Toll like receptors as potential drug targets on infectious diseases is discussed. Toll like receptors play a crucial role in the recognition and response to pathogens by the innate immune system. The use of a particular set of TLR could favor a Th1-biased response versus a Th2-biased response, or vice-versa. The following group of manuscripts review several mechanisms that have either been underscored or neglected in the past, all of them with a high impact on T cell activation and acquisition of effector functions. The first is by J. Nakagawa on mRNA stability, where the author describes the relevance of the process, and the current knowledge on the mechanisms involved. The second by O. Villate et al., describes the new increased complexity of the mammalian genomes due to the extensive usage of alternative splicing to generate different isoforms and their role in several diseases. The third one by E. Diaz-Guerra et al., discuss the issue of translational control as a mechanism regulating gene expression and describe evidences not only of the effects of different infections on the translation of the host cell, but also on the own infectious agent. Finally, as a possible application of some of these tools to drug discovery, M. Lopez-Fraga et al., describe the mechanisms of RNA interference and the possible use of siRNA as a new strategy to identify new drug targets.

Jose A. Garcia-Sanz Guest Editor Centro de Investigaciones Biologicas-CSIC Ramiro de Maeztu, 9 28040-Madrid, Spain Phone: +34918373112 Fax: +34915360432 E-mail: [email protected]

Infectious Disorders - Drug Targets 2008, 8, 207-220

207

Th17 and Treg Cells, Two New Lymphocyte Subpopulations with a Key Role in the Immune Response Against Infection Rolando Vernal1,2, and Jose A. Garcia-Sanz1,* 1

Department of Cellular and Molecular Physiopathology, Centro de Investigaciones Biológicas, CIB-CSIC, Madrid, Spain, 2Department of Conservative Dentistry, Dentistry School, Universidad de Chile, Santiago, Chile Abstract: In addition to the T helper 1 (Th1) and Th2 lymphocyte subsets, two new subpopulations Th17 and regulatory T (Treg) cells have recently been described. Th17 cells, which produce high levels of interleukin (IL)-17, are dependent on the transcription factor orphan nuclear receptor RORC2/RORt and have been implicated in exacerbating the immune response to infections. Conversely, Treg cells, either thymus-derived or generated upon TCR activation of naïve T cells, express the transcription factor forkhead box P3 (Foxp3) and have regulatory functions mediated through either direct cell-cell contact or immuno-suppressive cytokines, being able to suppress the activation of T, B and NK cells. Based on the current knowledge of Th17 and Treg cell functions, new therapeutic strategies start to emerge, involving anti-cytokine treatments targeting Th17 functions or cell-based treatments in which Treg cells are generated from T cells either through Foxp3 gene transfer onto T cells with known specificities or transferring specific TCR genes onto Treg cells.

Keywords: T lymphocytes, T cells, T cell subsets, helper T cells, Th17, RORC2, RORt, regulatory T cells, Treg cells, Foxp3, infectious diseases, infections. INTRODUCTION In spite of great advances in the biomedical sciences, infectious diseases keep increasing in the world population, both on terms of morbidity and mortality. Due to its nondebatable economic advantages, prevention strategies are the gold-standard on infection control. Together with the improvement in sanitary conditions, new therapeutic strategies and vaccines are the focus of current investigations. The new knowledge in the microbial-host interactions, infection pathogenesis and immune response are the clues and further basic research is essential to successfully achieve these goals. In this review, we provide a general overview of the response from different T lymphocyte subsets and their relation to infectious and non-infectious diseases, which might represent the key for future advances to successfully fight infection. IMMUNE RESPONSE: Th1 Th2 AND MORE The immune system evolved to protect higher organisms from infection by microorganisms and parasites. Its function is carried out by specialized cells and molecules, which are able to distinguish between self- and foreign-antigens, being tolerant to self-antigens to avoid autoimmunity and responding to foreign antigens to control and eliminate them. The activation of the innate arm of the immune response represents the first barrier against foreign antigens, which through antigen-unspecific mechanisms recruits immune cells to the infection site, starts inflammation, allows activation of the complement cascade and the removal of foreign substances present in organs, tissues or blood. It involves specialized white blood cells such as mast cells, phagocytes, neutrophils, basophils, eosinophils and natural killer cells. If the innate immune response is unable to *Address correspondence to this author at the Centro de Investigaciones Biológicas, CIB-CSIC, Ramiro de Maeztu 9, 28040 Madrid, Spain; Tel: +34 91 8373112; Fax: +34 91 5360432; E-mail: [email protected] 1871-5265/08 $55.00+.00

effectively cope with the infection, the adaptive arm of the immune response is activated, which then deals with the infection on an antigen-specific manner, through the response against specific antigens present in the infectious agent. The lymphocytes of the adaptive immune response provide a highly versatile mean of defense and generate immunological memory, implying protection from subsequent re-infection by the same pathogen. The cells and the inflammatory cytokines and chemokines released during the innate immunity are essential for the initiation and determination of the type of the response developed during the adaptive response. CD4+ T cells represent one of the main components of the adaptive immune response. These cells control the functional activities of both innate and adaptive immunity and determine the outcome of the immune response against infections. After antigenic stimulation, naïve CD4 + T cells proliferate and may differentiate into distinct effector subsets, which have been classically divided, on the basis of their cytokine production profiles, into T helper (Th) 1 and Th2 cells [1]. Th1 cells are characterized by the secretion of interferon (IFN) -, interleukin (IL) -2, IL-12, tumor necrosis factor (TNF) - and TNF-, and are involved in the eradication of intracellular pathogens. Conversely, Th2 cells are characterized by secretion of IL-4, IL-5, IL-6, IL-9 and IL-13, which are potent activators of B cells, are involved in the elimination of extracellular microorganisms and parasitic infections, and are also responsible for allergic disorders [2, 3]. In addition, a third type of Th cells, referred to as Th0 cells, with the capacity to secrete both Th1 and Th2 cytokines has been described [4]. More recently, two new subsets of CD4+ T cells have been characterized, on the one hand, the Th17 subset, which follows different polarizing conditions and displays different functional activities than Th1 and Th2 cells [5, 6] and, on the other hand, the regulatory T (Treg) cell subset, which displays suppressor functions [7, 8] Fig. (1). © 2008 Bentham Science Publishers Ltd.


Vernal and Garcia-Sanz

Fig. (1). Paradigms in Th and Treg cell differentiation. Dendritic cells recognize microbes by the molecular patterns that they expose (PAMPS), through an extensive array of surface receptors, including TLRs and C-type lectins. The microbe is then captured and the antigens are processed into small peptides, which subsequently associate with molecules from major histocompatibility complex (MHC) and then presented to T cells bearing on their surface specific receptors (TCR) specific for these antigen-MHC complexes. During TCR stimulation, naïve T precursors differentiate into distinct subsets, as a result of co-stimulatory signals and their cytokine environment. Th1 cells arise in the presence of IL-12 and drive cell-mediated immunity. Alternatively, in the presence of IL-4, naïve T cells differentiate into Th2 cells and mediate a humoral immune response. Th17 cells are a novel CD4+ T cell subset that arise in the presence of IL6 and TGF-, have a key role in inflammation and autoimmunity. Adaptive Treg cells arise in the presence of TGF- and secrete immunosuppressive cytokines. The interaction between the different cell subsets is essential for immune response regulation. APCs = antigen presenting cells; PAMPS = pathogen-associated molecular patters; TCR = T cell receptor; Th = T helper lymphocytes; TLRs = Toll-like receptors.

Th17 CELLS: A NEW T HELPER LYMPHOCYTE SUBSET The first indication of a new Th subset came from data demonstrating that microbial stimuli induce, in both murine and human T cells, IL-17 and TNF- production, in the absence of Th1 and Th2 cytokines [9], but the description of the Th17 phenotype came from analysis of mouse autoimmunity models historically associated with Th1 immune responses, namely experimental autoimmune encephalomyelitis (EAE) and collagen-induced arthritis (CIA) [10, 11]. The discovery that the p40 subunit of IL-12 (p40/p35 heterodimer) is common to IL-23 (on p40/p19 heterodimer), allowed to demonstrate that both EAE and CIA were completely abrogated in IL-23 deficient mice but not in IL12 deficient mice [12, 13]. These data demonstrated that

IL23 was required for Th17-mediated immunopathology. IL23 receptor is a heterodimer (IL-12R1/IL-23R), not functional in resting T cells since IL-23R is up-regulated only upon T cell activation, thereby rendering activated cells responsive to IL-23 [14]. Thus, IL-23 cannot drive naïve T cell differentiation into Th17 cells, since only the latter express IL-23R [14, 15]. Subsequently it was demonstrated that the combination of IL-6 with transforming growth factor (TGF) - triggered the secretion from naïve T cells of large amounts of IL-17 [16] and led to Th17 differentiation [17, 18] and up-regulated IL-23R expression [19], allowing IL-23 to stabilize and strengthen the Th17 phenotype and providing a survival signal for differentiated Th17 cells [18, 20]. Furthermore, IL-1 increases Th17 cell numbers generated in vitro [18] and in IL-1R-/- mice the Th17 response is weaker [21], suggesting a role of IL-1 in Th17 generation.

Translational controlled mRNAs: new drug targets on infectious diseases?

Infectious Disorders - Drug Targets 2008, Vol. 8, No. 4

209

RORC2/RORt: MASTER SWITCH OF Th17 CELLS The different Th cell phenotypes develop from the same pool of naïve T cells [11]. Th1 differentiation is initiated by TCR signaling in the presence of IL-12, which lead to signal transducer and activator of transcription 1 (STAT1) activation [6, 22], which up-regulates the transcription factor T-bet (also known as Tbx-21), the master regulator for Th1 differentiation [23]. T-bet enables IL-12 signaling through STAT4, which in turn, further potentiates IFN- production and induces IL-18R expression [22, 23]. Thus, the later stage of Th1 differentiation induced by IL-12 enables mature Th1 cells to produce IFN- in an antigen-independent manner and allows suppression of Th2 and Th17 differentiation [5, 24]. Conversely, Th2 differentiation is initiated by TCR signaling in concert with IL-4 receptor signaling via STAT6, which cooperatively up-regulates the expression of the transcription factor GATA3, the master regulator of Th2 differentiation [25]. GATA3 auto-activates its own expression and blocks Th1 and Th17 differentiation through the suppression of STAT4, IL-12R2 chain and IL-23R [5, 19]. The absence of Th17 cells in mice deficient for the transcription factor orphan nuclear receptor (RORt, or RORC2 in humans) and its reversion upon transduction of RORt-encoding retroviruses on naïve T cells [26] suggested a relevant role of this transcription factor on the generation of Th17 cells. Both RORt and ROR are encoded by the Rorc locus by the use of two different promoters, which are responsible for their differential expression [27]. Th17 differentiation is initiated by TCR signaling in the presence of IL-6 and TGF-. These signals activate STAT3 and Smads which trigger, in turn, expression of the transcription factor RORt. Latter stages of Th17 differentiation are induced by IL-23, which through the over-expression of TGF- inhibits Th1 and Th2 development [17, 18, 28] Fig. (2). EFFECTOR FUNCTIONS OF Th17 CELLS Activated human Th17 cells are phenotypically identified as CCR2+CCR5- [29], whereas human memory CD4+ T cells producing IL-17 and expressing RORC2 mRNA are CCR6 + CCR4+ [30]. Th17 cells secrete several pro-inflammatory cytokines such as TNF-, TGF-, IL-6, IL-21, IL-22, IL-23, IL-26 and particularly IL-17, but neither IFN- nor IL-4 [3133]. At the beginning of the 1990’s, the first IL-17 was described, cloned and originally named cytotoxic Tlymphocyte antigen (CTLA) -8; it was subsequently renamed IL-17 and more recently IL-17A [34]. IL-17A is the prototypic IL-17 family member, a disulfide-linked homodimeric glycoprotein of 155 aminoacids, with a molecular weight of about 35 kDa [34, 35]. The IL-17 family consists of 6 family members (IL17-A to IL-17F), identified by homology-based cloning, evolutionarily conserved between rodents and humans, and all form homodimers [36]. These molecules signal through five distinct surface receptors (IL-17RA-E) [36] (Table 1). The role of Th17 T cells in host defense against pathogens is just emerging, particularly on their destructive potential in autoimmune and chronic diseases. It has been proposed that Th17 cells are important in host defense

Fig. (2). Th1, Th2 and Th17 cell differentiation. Following TCR activation, naïve CD4 T cells may differentiate into either Th1 cells in presence of IL-12 or Th2 cells in presence of IL-4. IL-12 upregulates IFN- synthesis via STAT4 signaling. This stimulates STAT1 activation and T-bet transcription factor expression, leading to a Th1 phenotype. Conversely, IL-4 activates STAT6 signaling, which induces GATA3 transcription factor expression and determines Th2 cell differentiation. The Th17 phenotype develops in response to IL-6, TGF- and IL-23 via STAT3 and Smads signaling and the up-regulation of the transcription factor RORt (RORC2 in humans) expression. In addition, Th1 and Th2 cytokines potently inhibit Th17 differentiation. Conversely, TGF- inhibits the Th1 and Th2 differentiation both by inhibiting the IFN and IL-4 synthesis by effector Th1 and Th2 cells and by blocking the IFN- and IL-4 activity on naïve T cells. IFN = interferon; IL = interleukin; Th = T helper lymphocytes; TGF = transforming growth factor; TNF = tumor necrosis factor.

against extracellular bacteria such as Klebsiella pneumoniae or Bacteroides fragilis as well as against fungal infections including Candida albicans [37-39]. Th17 lymphocytes constitute an early defense against severe trauma that could result in tissue necrosis or sepsis and represent a bridge between innate and adaptive immunity, synthesizing IL-17 and stimulating the generation and mobilization of neutrophils [40, 41]. Moreover, Th17 cells seem to antagonize Treg cell development, thereby amplifying the inflammatory responses and thus, playing a crucial role in the progression of inflammatory and autoimmune disorders [16, 42, 43].


Table 1.


Human IL-17 Cytokine and Receptor Families [36]

Ligand

Chromosome

Size a

Length b

Receptor

Chromosome

IL-17A

6p12

35

155

IL-17RA

22q11.1

Also IL-17RC IL-17B

5q32-34

41

180

IL-17RB/IL-17RH1

3p21.1

IL-17C

16q24

40

197

IL-17RC/IL-17RL

3p25.3

IL-17D

13q12.11

52

202

IL-17RD/hSED

3p21.2

IL-17E/IL-25

14q11.2

34

161

IL-17RE

3p25.3

Also IL-17RB IL-17F

6p12

44

153

IL-17RA Also IL-17RC

a

KDa amino-acid number

b

IL-17A, IL-17C and IL-17F have direct effects on human blood neutrophil chemotaxis whereas IL-17E is involved in eosinophil migration [44, 45]. IL-17A enhances the expression of CXCL1, CXCL2 and CXCL8 (IL-8), strengthening the chemotactic activity of neutrophils in gastrointestinal and bronchoalveolar infections [44, 46], and induces increased expression of monocyte chemotactic protein-1 (MCP-1) in rat intestinal epithelial cells, promoting the accumulation of functional monocytes [47] In addition, IL-17A also activates neutrophils, increasing neutrophil elastase and myeloperoxidase activity and determining the pathological proteolysis in inflamed tissues [48]. IL-17A and IL-17D induce the production of granulocyte colony-stimulating factor (G-CSF) and granulocyte monocyte colonystimulating factor (GM-CSF) in endothelial cells and bronchio-epithelial cells in humans, increasing the number of neutrophil progenitors and enhancing neutrophil survival [49, 50]. Th17 ROLE IN NON-INFECTIOUS AND INFECTIOUS DISEASES The relevance of Th17 lymphocytes in autoimmunity has been unraveled in numerous studies. Treatment with anti-IL17A antibodies on a rodent CIA model resulted in reduced joint inflammation, cartilage and bone destruction [51]. Consistently, IL-17A deficient mice displayed suppressed CIA development [52] and reduced EAE [53]. In humans, elevated IL-17 levels have been detected in the synovial fluid and serum samples from rheumatoid arthritis (RA), psoriasis, inflammatory bowel disease (IBD) and multiple sclerosis (MS) patients [54-57]. In RA patients, IL-17A induced release of metalloproteinase (MMP) -1 and MMP-13 in the joint synovia, whereas in MS patients, up-regulated IL-17A expression was detected in central nervous lesions [58-60]. In a mouse model of allergic asthma, IL-17A regulates neutrophil recruitment in response to allergens in the bronchoalveolar space, determining the balance between neutrophil and eosinophil accumulation [61]. Consistently, asthma affected patients displayed an increase in local concentration of soluble IL-17A [62]. Moreover, healthy volunteers exposed to a swine confinement, which induces

severe airway inflammation, showed a pronounced increase in soluble IL-17A in their bronchoalveolar tissues [63]. Although the role of the Th17 cells in cancer has been scarcely studied, some data pointed towards the participation of IL-17 cytokine family in cancer development. IL-17A promoted angiogenesis and tumor growth in a mice model of fibrosarcoma and triggered increased macrophage recruitment in human cervical cancer in nude mice [64, 65]. Conversely, in human prostate cancers, down-regulated levels of IL-17RC were detected, whereas an over-expression of IL17RB was associated to the lack of recurrence of breast cancers [66, 67]. Skeletal homeostasis depends on a dynamic balance between the activities of the bone-forming osteoblasts (OBLs) and bone-resorbing osteoclasts (OCLs) [68]. This balance is tightly controlled by various regulatory systems, such as the endocrine system, and is influenced by the immune system, an osteoimmunological regulation depending on lymphocyte- and macrophage-derived cytokines [6870]. An unbalance in favor of OCLs leads to pathological bone resorption as it has been observed in RA, periodontitis, osteoporosis, Paget’s disease and bone tumors [68, 71]. During the 1970’s the first observation pointing towards immune cells influencing OCLs activity was made. Indeed, a factor (OCL-activating factor or OAF) that stimulated bone resorption was detected in the supernatant from cultured human peripheral monocytes stimulated with phytohemagglutinin [72]. Purification of this activity led to the identification of IL-1 [73]. Nowadays, numerous cytokines have been demonstrated to stimulate bone resorption, including TNF-, IL-1, IL-1, IL-6, IL-11, IL-15 and IL17, whereas others such as IL-4, IL-10, IL-13, IL-18, GMCSF and IFN- inhibited bone resorption [68, 69]. In this context, functional characterization of three novel members of the TNF-ligand and receptor superfamily, the receptor activator of nuclear factor-B (RANK), its ligand (RANKligand or RANKL) and the soluble decoy receptor of RANKL named osteoprotegerin (OPG), have contributed significantly to the establishment of osteoimmunology, where these molecular mediators participate as key modu-



211

lators of physiological and pathological bone resorption [7476]. RANKL exerts its biological effects directly through binding to RANK, inducing OCL differentiation, maturation and activation [77]. OPG inhibits the osteoclastogenesis and induces osteopetrosis when over-expressed in transgenic mice [78]. RANKL has been associated with diverse osteodestructive pathologies, including RA, bone tumors, osteoporosis, Paget’s bone disease, osteolytic lesions of the facial skeleton, odontogenic lesions and periodontitis [79-86]. The identification of RANKL as the T cell cytokine TRANCE (TNF-related activation-induced cytokine) allowed to envisage the possibility that CD4+ T cells may have the capacity to induce OCL differentiation and activation by directly acting on OCL precursors and on mature OCLs through synthesis of RANKL during osteodestructive diseases [85, 87-89]. Furthermore, many wellknown osteotropic factors, including TNF-, IL-1 and IL-6, exert their osteoclastogenic activity by inducing RANKL expression on OBLs and CD4+ T cells [90]. Th1 and Th2 cells inhibit osteoclastogenesis by acting on the precursor cells, mainly through IFN- and IL-18, which are released by Th1 cells, or IL-4 and IL-10, which are released by Th2 cells [91, 92]. In contrast, Th17 cells stimulated by IL-23 promote osteoclastogenesis mostly through production of IL-17 and RANKL [93]. Furthermore, IL-17 facilitates local inflammation by recruiting and activating immune cells, which leads to an abundance of inflammatory cytokines such as IL1 and TNF- that enhance the RANKL expression on OBLs and Th17 cells [94, 95] Fig. (3). Th17 cells represent a large proportion of the inflammatory cells invading the synovial tissues during RA [96]. High levels of IL-17A have been detected in the synovial fluid and IL-17-producing cells have been detected within the T cell-rich areas in patients with RA [57, 97]. Furthermore, IL-17A is able to promote cartilage destruction and bone erosion in experimental RA [57]. Increased levels of IL-17 were detected in gingival crevicular fluid and in biopsy samples from periodontal lesions, both at the mRNA and protein levels, in patients with chronic periodontitis, and these increased levels have been associated to CD4+ T cells [98, 99]. Furthermore, RANKL and RANK were synthesized within periodontal lesions where IL-17 was produced by activated gingival T cells [43, 98]. These data are reinforced by the over-expression of RORC2 mRNA in active lesions from chronic periodontitis patients (R.V. unpublished data). Taken together, these data establish that Th17 cells represent the osteoclastogenic Th subset on CD4+ T lymphocytes, inducing osteoclastogenesis and bone resorption through synthesizing IL-17 and RANKL. FROM SUPPRESSOR CELLS TO REGULATORY T CELLS The immune system has the potential to destroy invading microorganisms and control outgrowth of tumor cells, but must prevent the attack against self, a concept known as selftolerance. Tolerance to self-antigens is attained initially by the elimination of self-reactive T and B lymphocytes during negative selection in the thymus and bone marrow, respectively. In addition, and as an additional safety mechanism, the immune system has peripheral mechanisms to deal with immune cells that escape to the central tolerance.

Fig. (3). Role of Th17 cells on bone destruction induced during infectious diseases through enhanced osteoclastogenesis. During early infection stages, an inflammatory response is established, characterized by synthesis of inflammatory cytokines, such as IL-1 and TNF-. In the context of an unresolved infection, an adaptive immune response is established and, under determined conditions, Th17 cells may be activated, contributing to bone destruction by secreting IL-6, IL-17 and RANKL. IL-6 and IL-17 increase the inflammatory response and induce RANKL expression by osteoblastic stromal cells. Thus, Th17 cells may induce cell-to-cell interactions between osteoblasts and osteoclast precursors, inducing indirectly osteoclast differentiation. On the other hand, Th17 cells also may contribute directly to bone loss by synthesizing RANKL, thereby driving osteoclast differentiation and maturation by a cellcontact independent way. APCs = antigen presenting cells; Th = T helper lymphocytes; MOs = monocytes, osteoclast precursors; OBLs = osteoblasts; OCLs = osteoclasts.

At the beginning of 1980’s, the existence of a suppressor T cell population was proposed, suggesting that these suppressor T cells restrict the induction or expression of effector T cells and thereby prevent and control exaggerated immune response and autoimmune disease development [100]. The modern view of suppressor cells began with the observation that the transfer of T cells depleted of the IL2R+ (CD25+) cell subpopulation induced multiorgan autoimmunity in recipient mice [101]. Nowadays, suppressor T cells have been renamed and are currently known as Treg cells. These cells have been isolated from mice and humans and their regulatory functions have been demonstrated not only in vitro but also in vivo. It has also been established that several types of cells carry out regulatory activities. These include IL-10-secreting CD4+ T regulatory-1 (Tr1) cells, TGF--secreting CD4+ Th3 cells, NKT cells, CD8+CD28-Foxp3+ cells, / TCR+ cells, and CD4+CD25highFoxp3+ T cells, the last one widely accepted as “professional Treg cells” or naturally occurring Treg cells [102, 103]. Some of these cells are induced in response


to infectious challenge and develop from conventional naïve T cells exposed to specific stimulatory conditions, whereas others arise during the normal process of maturation in the thymus [7] Fig. (1). PHENOTYPE AND CLASSIFICATION OF TREG CELLS In spite of the experimental evidence for the existence of Treg cells, key aspects from this phenotype and mechanism of action still remain undefined. In fact, although many studies indicate that CD25 is a crucial cell-surface marker for the Treg cells, several other markers such as CD38, CD62L (L-selectin) or CD103 also identify this subset. Furthermore, the relative contribution of soluble cytokines compared with cell-cell contact to carry out their inhibitory activity also remains controversial [7, 103, 104]. It has been proposed that there are two main subsets of Treg cells, which differ in terms of origin, generation and mechanisms of action. They have been named natural and adaptive Treg cells [7] Fig. (4).


Natural Treg Cells Natural Treg cells are CD4+ T cells that develop and mature in the thymus and carry out their regulatory function during normal surveillance of self-antigens [7]. On normal individuals, they represent 5-10% of the peripheral CD4+ T cell population and are characterized by the constitutive expression of high levels of CD25 and low levels of CD45RB (CD4+CD25highCD45RBlow) [105]. Unlike conventional T cells, which transiently up-regulate CD25 expression after activation, these cells maintain the CD25 expression independent of their activation status [106]. Other surface molecules have been associated with natural Treg cells, including CD152 (CTLA-4), CD103 (E-integrin), and two members of the TNFR-superfamily receptor, namely CD134 (OX40; TNFRSF4) and GITR (glucocorticoidinduced TNF receptor family-related protein; TNFRSF18) [7, 107]. None of these markers is, however, exclusive for Treg cells and there are evidences of CD4+ and CD8+ T cells with regulatory functions devoid of CD25 and other Treg makers [104, 108]. The signals that are responsible for the generation of Treg cells in the thymus are incompletely defined. It has been proposed a key role of signaling through CD28 for both thymic development and peripheral homeostasis of natural Treg cells [109]. A combination of strong antigenic signals to TCR and maximal co-stimulation of CD80 (B7.1) and/or CD86 (B7.2) through CD28 are required for thymic Treg development [110-112]. A strong B7/CD28 co-stimulation is also required to their peripheral self-renewal and survival [111, 112]. In contrast to regular effector T cells, natural Treg cells show only marginal synthesis of mitogenic cytokines and cell proliferation in vitro, however, they proliferate extensively in vivo [7]. The absence of CD80/CD86 or CD28 results in decreased number of natural Treg cells in peripheral lymphoid tissues and their absence induce autoimmunity [111, 113].

Fig. (4). Differentiation and function of Treg cells. In the periphery, chronic TCR stimulation is able to induce Foxp3 expression in naïve T cells. TGF- is essential for acquisition of Foxp3 expression in peripheral induced Treg cells in vivo. Reciprocal developmental pathways have been described for Th17 and Treg cell generation, in which IL-6 is essential. In addition, it has been postulated that IL-10 signaling contributes to differentiation of Tr1 phenotype. The factors involved on Th3 differentiation, however, have not yet been described. On the other hand, the thymus represents the main site for natural Treg cell differentiation. Foxp3 expression in the thymus is dependent upon CD28 signaling and perhaps an additional unknown factor(s). In vivo, natural and adaptive Treg cells mediate their regulatory activities by producing immuno-suppressive cytokines such as IL-10 and TGF-. In addition, natural Treg cells function by direct cell-to-cell interactions, at least in vitro, through surface molecules such as CTLA-4, mediator of natural Treg cell activities in APCs and effector T cells. APCs = antigen presenting cells; aTreg = adaptive Treg cells; IL = interleukin; nTreg = natural Treg cells; Th = T helper lymphocytes; TGF = transforming growth factor; CTLA-4 = cytotoxic Tlymphocyte antigen-4.

Natural Treg cells appear to be mainly restricted by self antigens; however pathogen-specific Treg cell activity has also been proposed in infectious diseases [114]. The mechanisms involved in the suppressive activity of natural Treg cells are not fully understood. It has been postulated that direct cell-to-cell contact through surface molecules, for instance CTLA-4, is necessary for regulatory function in vitro [105, 115]. Adaptive or Induced Treg Cells Adaptive Treg cells represent CD4+ T cells that acquire their regulatory activity during activation [7]. Unlike natural Treg cells, which came out from the thymus as CD4+CD25 + cells, adaptive Treg cells originate from peripheral naïve T cells [7]. They are derived from CD4+CD25- T cells and show variable expression of CD25 in mature state, depending on the disease and the site of regulatory activity [116]. Induced Treg cells require TCR stimulation for induction of regulatory functions and have demonstrated limited proliferation in vitro [104]. Critical determining factors for the induced Treg development are the type and the differentiation status of the antigen presenting cells (APCs) and the cytokine milieu during activation. Antigen presentation by immature dendritic cells (DCs) in presence of IL-10 and/or


TGF- during naïve T cell activation promotes differentiation into adaptive Treg cells in vitro [117]. In this context, it is worth to note that unlike natural Treg cells adaptive Treg cells do not require co-stimulation through CD28 for their development and function [118]. Inducible Treg cell populations include Tr1, Th3 and converted forkhead box P3 (Foxp3) cells [119]. The antigen specificity of the adaptive Treg cells remains unclear; however, it has been determined their regulatory activity is mediated by IL-10 and/or TGF- expression [104]. FOXP3: T REGULATORY CELLS MASTER SWITCH The transcription factor Foxp3, also known as scurfin, represents a lineage-specific marker for natural Treg cells and is a critical regulator of Treg cell development [120, 121]. Foxp3 is an acetylated and phosphorylated protein that forms oligomers associated as a large molecular complex [122, 123]. Its relevance on Treg cells development and function was demonstrated by natural mutations of foxp3 gene both in mice and humans. Scurfy (sf) is a spontaneous X-linked recessive mutation of the foxp3 gene in mice, characterized by lymphoproliferation, multiorgan infiltration, complete loss of natural Treg cells, autoimmunity and premature death of hemizygous (sf/Y) males [124]; the same phenotype was obtained in foxp3-/- genetically modified animals [125]. Similarly, mutations of foxp3 gene in humans are responsible for the IPEX (immuno-dysfunction polyendocrinopathy enteropathy X-linked) syndrome, characterized by natural Treg cell function impairment and clinical manifestations of autoimmune disorders such as enteropathy and type 1 diabetes [126]. Furthermore, retroviral gene transfer of foxp3 into CD4+CD25- or CD8+ T cells, but not into B cells, leads to the generation of cells with a regulatory phenotype [127]. Foxp3 is expressed both at mRNA and protein levels in peripheral CD4+CD25+ T cells [125]. In the thymus, Foxp3 mRNA has been detected in CD4+CD8-CD25+ cells but not in immature thymocytes [128]. Low levels of Foxp3 expression have been detected in B and CD8+ T cells and low but significant levels have been detected in CD4+CD25 CD45RBlow T cells, a cell subset with regulatory activity [128]. In addition, Th1 and Th2 cells generated from CD4 + CD25- cells fail to express Foxp3 [121]. In humans, Foxp3 is also expressed in CD4+CD8-CD25+ cells [129]. Unlike in mice, in humans a small subpopulation of CD4+CD25- T cells up-regulate Foxp3 in vitro upon anti-CD3 and antiCD28 stimulation, exhibiting suppressive activity and suggesting acquisition of regulatory functions [130]. In humans, Foxp3 expression is not exclusive to natural Treg cells. Recent work has demonstrated transient Foxp3 expression in activated CD4+CD25- effector T cells. However, a transient wave of Foxp3 expression is not sufficient to confer regulatory activity [131], rather, a high and sustained Foxp3 expression induced by TCR-stimulation is required to generate functional adaptive Treg cells [132]. The Foxp3 up-regulation in human adaptive T cells is controlled by STAT5-dependent mechanisms [132] and maintenance of Foxp3 expression in natural Treg cells is also STAT5-dependent, suggesting a common molecular mecha-


213

nism controlling Foxp3 expression in both natural and adaptive Treg cells [132]. IL-2 and TGF- are essential for the expression of Foxp3, generation of Treg cells and maintenance of immunologic tolerance. Genetically deficient mice for either IL-2 (IL-2-/-) or CD25 (IL-2R-/-), harboring a Foxp3gfp knock-in allele, allowed to demonstrate that IL-2 signaling was required to induce Foxp3 expression in thymocytes. Thus, in addition to its known functions on the regulation of cell growth, IL-2 seems to be critical for maintaining in vivo Treg cell function [133]. TGF--/- or CTLA-4-/- mice show an uncontrolled T cell activation and develop generalized autoimmunity leading to a fatal lymphoproliferative disease, disclosing an important relation among TGF-, CTLA-4 and the Treg phenotype [134]. Indeed, in TGF- or CTLA-4 deficient mice, the number of natural Treg cells within the thymus is normal [135], but these factors seem to be required for a maintained Foxp3+ expression [136]. Furthermore, TGF- is also necessary to induce expression of Foxp3 on activated CD4+CD25- T cells [137] Fig. (4). EFFECTOR MECHANISMS OF REGULATORY T CELLS It has been postulated that natural Treg cells function, at least in vitro, through direct cell-cell interactions with APCs and responding effector T cells [105, 115]. Recently, it has been postulated, however, that IL-10 and TGF- also appear to be important mediators of their regulatory activities in vivo [134, 138], a molecular mechanism that had already been suggested for the function of adaptive Treg cells [104]. Fig. (4). Indeed, whereas neutralizing antibodies to TGF- did not affect CD4 +CD25+ Treg function in vitro, abolished the therapeutic effects in inflammatory bowel disease and type 1 diabetes in mice in vivo [139, 140]. It has been reported that Treg cells in addition to secrete active TGF-, also express membrane-bound TGF-, having an important role in the functional properties of natural and induced Treg cells [134, 141]. On Treg cell-depleted CD4+ T cells, it has been demonstrated that cell-cell contact-mediated suppression was independent from membrane-bound TGF- [142]. When CD25+ Treg cells where co-activated together with Treg cell-depleted CD4+ T cells, anergized CD4+ T cells were obtained and these, in turn, inhibited the activation of freshly isolated CD4+ T cells, demonstrating that the suppressive activity transferred from CD25+ Treg cells via cell contact was mediated by soluble TGF- in a cell-contact independent way [142]. Both in vitro and in vivo studies suggest that Treg cells can suppress the proliferation and/or cytokine production of effector T cells [143]. Suppression of CD4+ effector T cell proliferation by Treg cells has been observed in vitro on an APC-free model, and a block of CD8+ T cell differentiation into cytolytic effector cells has been determined in vivo [143, 144]. Furthermore, it has been proposed that Treg cells can kill effector T cells directly in culture through the release of granzyme B and perforin [145, 146]. Treg cells may also modulate the immune response through DCs. Analyzing the effect of human natural Treg cells on maturation and function of monocyte-derived DCs, it has been demonstrated that Treg cells prevent immature DCs from becoming immunogenic, synthesizing increased levels of IL-10 and


expressing reduced levels of CD80, CD83 and CD86 despite the CD40 pre-stimulation, an effect marginally reverted by neutralizing anti-TGF- antibodies [147]. Furthermore, CTLA-4-expressing natural Treg cells induce the expression by APCs of the enzyme indoleamine 2,3-dioxygenase (IDO), which degrades tryptophan, and lack of this essential amino acid has been shown to inhibit T cell activation and promote T cell apoptosis [148]. Treg cells are also the principal producers of IL-10 and its expression is regulated by IL-6, IL-27 and TGF- [149]. The mechanism by which IL-10 regulates T cell responses is fully understood by now. IL-10-systhesizing Treg cells inhibit the function of DCs through the repression of inflammatory cytokine production and the inhibition of MHC class II and costimulatory-molecule expression [150]. IL-10-deficient mice develop enhanced T cell activation and severe immunopathology upon infection [151]. Additionally, CD4+CD25highCD45RBlow T cells from IL-10 deficient mice fail to protect from colitis and mice with the Treg cellspecific deletion of the il10 gene develop colitis [149, 152]. TGF- and IL-10 are regulatory cytokines with pivotal functions in the control of inflammation. TGF- directly target T cells and DCs to ensure immune tolerance to selfantigens, whereas IL-10 regulates the interface of innate and adaptive immunity to limit the magnitude of immune responses to microbial antigens [149]. Because natural Treg cells constitutively express CD25, it has been suggested that IL-2 plays a role in regulatory Treg cell activity, although it remains controversial. Treg cells obtained from IL-2-/- and IL-2R-/- mice were fully able to suppress T cell proliferation in vitro [133]. More recently, adenosine, cyclic adenosine monophosphate (cAMP), histone/protein deacetylase (HPDA) -7, HPDA-9, heme oxygenase-1, galectins, IL-9 and IL-35 have also been shown to contribute to Treg cell suppressive activities, but their precise role has not yet been fully established [153-155]. CROSSTALK BETWEEN REGULATORY T CELL POPULATIONS Interplay between natural and adaptive Treg cells has been described when their suppressor functions are exerted on APCs and effector T cells during disease pathogenesis. Thus, different Treg populations may have the capacity to influence the development and function of other Treg cells [156, 157]. During the first steps of an infection, inflammation is controlled by the expansion and local recruitment of natural Treg cells, which recognize self-antigens and limit the innate immune response through the expression of IL-10 and CTLA-4. CTLA-4 induces the synthesis of IDO by DCs inhibiting effector T cell activation, inducing their death and leading, as a consequence to the activation and expansion of Tr1 and Th3 cells. Adaptive Treg cells are then generated, they synthesize IL-10 and TGF- inhibitors of Th1 and Th2 cell activity, which are in turn responsible for disease outcome. Thus, the sequential role of various of Treg cell populations lets control the infection and limits collateral tissue damage on different stages of the disease, involving various regulation levels [156, 157]. BYSTANDER SUPPRESSION TOLERANCE

AND

INFECTIOUS


Treg cell function is characterized by both bystander suppression and infectious tolerance. The bystander suppression involves that, following activation through their TCR, activated Treg cells can suppress unrelated immune responses in a non-antigen-specific manner either through cell contact or through synthesizing regulatory cytokines. Thus, infection specific-induced Treg cells may regulate and determine the outcome of secondary infections, as well as, autoimmune or allergic responses [158]. The infectious tolerance implies that Treg cells create a regulatory milieu that promotes regulation beyond their suppressor activity. That is, the state of tolerance induced by Treg cells may be maintained even after the original Treg population is inactivated or experimentally removed [159]. REGULATORY T CELLS IN HUMAN INFECTIOUS DISEASES During infections, a tightly controlled immune response must be developed, protecting the host through the development of mechanisms that recognizes and eliminates the invading microorganisms and parasites, but, at the same time, minimizing collateral damage to self tissues that would result from an exacerbated immune response. Both natural and adaptive Treg cells largely exert this control. Whereas the antigen specificity of inducible Treg cells is associated with microbial antigens, the nature of the antigens recognized by natural Treg cells is less evident. During the onset of an acute disease, natural Treg cells recognize self antigens that are released by damaged tissues, however, evidences from chronic infections suggest that natural Treg cells can also recognize microbial antigens [119, 156]. In animal models, it has been evidenced the role of Treg cells in the suppression of innate and adaptive immune responses in experimental autoimmunity (arthritis, colitis, diabetes, autoimmune encephalomyelitis, lupus, gastritis, oophoritis, prostatitis and thyroiditis), transplantation, cancer development and growth, as well as in infectious diseases [104, 114, 156, 160-164]. Human Treg cells constitute a more heterogeneous population than their mice equivalents, greatly hampering the establishment of Treg cells role during human non-infectious and infectious diseases [156]. In humans, Treg cell induction and activity has been associated with cancer, cell and graft transplantation, diabetes, and various microbial diseases, including viral, parasitic, fungal and bacterial infections [119, 165-167]. Viral Infections Most studies that evaluate human Treg cell functions have been carried out analyzing peripheral blood, since it is the most accessible compartment for clinical examination. These measurements may not be, however, representative of all tissues, since in some chronic human infections Treg cells accumulate within the infected tissues and are rarely detectable in the blood. Decreased frequencies of natural Treg cells have been detected in peripheral blood from HIV infected patients, suggesting that Treg cells are progressively lost during chronic HIV infection [168]. Increased levels of the Treg cell-markers Foxp3, CD25 and CTLA-4 have been detected, however, in lymphoid tissues from these patients, strongly suggesting that the decreased frequencies of Treg


cells in peripheral blood can be explained by their accumulation within the infected tissues [169]. In asymptomatic HIV-infected individuals, CD4+CD25+ T cells significantly suppressed in vitro cellular proliferation and cytokine production from CD4+ or CD8+ effector T cells in response to HIV antigens, independently of IL-10 and IFN- expression. These data point towards a role of Treg cells suppressing virus-specific immune responses and therefore contributing to the uncontrolled viral replication during early HIV stages [168]. Increased levels of Foxp3+ Treg cells have been reported both in blood and liver of patients affected of chronic hepatitis B virus (HBV), which correlated with in vitro suppression of antigen-specific effector responses [170]. Similar findings were obtained from chronic hepatitis C virus (HCV) patients. In addition, HCV-specific IFN- secretion from PBMCs was enhanced following depletion of CD4+CD25+ Treg cells, and reversed by adding back the Treg cells [171]. Induced Tr1 cells with similar viral antigen specificity that protective Th1 cells have been isolated from patients chronically infected with HCV [172]. Taken together, these data strongly suggest that antigen-specific Treg cells have a role in controlling chronic inflammatory responses and contribute to liver pathologic events observed in HBV and HCV infections. Infection with human T lymphotropic virus type 1 (HTLV-1) is associated with diminished expression levels of Foxp3 in peripheral T cells as compared to asymptomatic HTLV-1 carriers and healthy donors. This Foxp3 expression inversely correlated with HTLV-1 proviral DNA load, suggesting that impaired Foxp3 expression may contribute to inflammatory disease development during HTLV-1 infection [173]. In cytomegalovirus (CMV) infected patients, Treg cells depleted cultures show increased frequency of CMV-specific IFN-+CD8+ T cells, an increase reversed by the addition back of Treg cells [174]. On the other hand, the role of Treg cells in herpes simplex virus (HSV) has been analyzed in mice, but not in humans [114]. Parasitic Infections Human volunteers exposed to Plasmodium falciparum evidenced rapid increase on CD4+CD25+Foxp3+Treg cells following the first days of blood-stage infection. This enhanced number of Treg cells positively correlated with TGF-ß secretion and with decreased proinflammatory cytokine production and antigen-specific immune response in effector T cells [175]. Analyzing the effect of Leishmania viannia braziliensis, the main etiologic agent of cutaneous leishmaniasis (CL) in Brazil, functional Treg cells, expressing CD25, CTLA-4, GITR, and Foxp3, were found in skin lesions of affected patients. These Treg cells produced large amounts of IL-10 and TGF-ß and suppressed PHA-induced proliferation of T cells obtained from healthy control subjects, suggesting that functional Treg cells accumulating within CL lesions contribute to the local control of effector T cells [176]. The role of Treg cells in other parasitic infection, such as Leishmania mayor, Leishmania amazonensis, Plasmodium


215

yoelii, Plasmodium berghei, Schistosoma mansoni, Schistosoma japonicum, Brugia pahangi, Litomosoides sigmodontis and intestinal helminths have been demonstrated in mice, but, in humans, the exact role of either natural or adaptive Treg cells remains unraveled [114, 177, 178]. Fungal Infections Higher frequency of CD4+CD25+ Treg cells, expressing CTLA-4, GITR, membrane-bound TGF- and Foxp3 were detected in peripheral blood of patients infected with paracoccidioidomycosis (PCM). Furthermore, these cells demonstrated stronger in vitro suppressive activity when compared with controls, evidencing a role of Treg cells controlling immune responses in patients with PCM-induced granulomatous diseases [179]. Bacterial Infections Tuberculosis (TB) infections in humans also lead to increased frequencies of CD4+CD25+ Treg cells both in blood and the active infection sites. In pleural fluid and peripheral blood, this increased frequency of Treg cells was inversely correlated with Mycobacterium tuberculosisinduced IL-10 and TGF-ß synthesis. These data suggest that Treg suppress the M. tuberculosis immune response, favoring persistence of the infectious agent in humans [180]. The stimulation of peripheral CD4+ T cells with DCs pulsed with Helicobacter pylori induced proliferation and IFN- synthesis in both infected and uninfected individuals. Treg cells isolated from chronically infected patients were able to suppress H. pylori-specific CD4 + T cell responses but not responses to unrelated antigens [181], clearly suggesting a role of Treg cells controlling H. pylori infections in humans. Association of Treg cells with multi-infection diseases such as chronic periodontitis has been also established. Immunohistological analyses revealed higher numbers of CD4+CD25+CTLA-4+ Treg cells in samples from periodontitis affected patients, as compared to gingivitis controls. Furthermore, increased Foxp3, TGF-1 and IL-10 mRNA levels were also detected [182]. Foxp3 expression was associated with CD4+CD25+ T cells but not with CD8+ T cells and CD4+CD25+Foxp3+ cells isolated from periodontitis patients suppressed the proliferation of CD4+CD25 cells [183]. INTERACTION BETWEEN REGULATORY T CELLS

Th17

AND

Although induced Treg cells and effector Th17 cells play different roles, at least in vitro, during the pathogenesis of infections, it has been demonstrated reciprocal developmental pathways for their generation. Naïve T cells exposed to TGF- up-regulate Foxp3 and become induced Treg cells; however, when cultured with TGF- and IL-6, naïve T cells generate Th17 cells with pathogenic activities [16, 184]. Thus, when the immune response is not activated, TGF- favours the generation of induced Treg cells, which suppress inflammation; however, when an infection is established, IL6 is synthesized during the innate immune response, inhibiting the generation of Treg cells and inducing the differentiation of proinflammatory of Th17 cells in presence of TGF- [19].



Induced Treg and Th17 cells may arise from the same precursor cell and selective differentiation would depend on the local cytokine milieu, which would determine the predominance of either Treg cells with suppressor activity or Th17 cells with pathologic activities, determining the outcome of the disease [19]. Th17 AND REGULATORY THERAPEUTIC STRATEGIES

T

CELLS:

NEW

The therapeutic potential of Th17 and Treg cells has been approached from two points of view, involving cytokine- and cell-based immunotherapy strategies. Nowadays, most antiinflammatory therapies that involve anti-cytokine strategies have targeted the IL-23/Th17 axis [185]. It has been proposed that therapeutic agents that antagonize signaling through the IL-17R complex might be suited candidates, since the IL-17R family members do not share significant homology with any other known cytokine receptor family [20, 66, 70]. Moreover, it has been proposed that neutralizing IL-23 alone would leave in place the collective regulatory and anti-tumor and anti-infective properties of Th1 pathways [185]. Even then, the research on the therapeutic potential of Th17 cells still represents, by now, the tip of an iceberg. The therapeutic potential of Treg cells has created a lot of expectations and a large number of publications have assayed their potentiality either in vitro or in experimental models [186]. Treg cells suppress in vitro proliferation and cytokine production from co-cultured effector T cells [187]. In mice, both allospecific and polyclonal Treg cells, induced either ex vivo or in vivo, have therapeutic effects. In a TGF-dependent manner, CD4+CD25lowFoxp3+ Treg cells suppressed autoimmune diabetes and polyclonal CD4+CD25 + Treg cells altered the course of lupus [140]. Additionally, induced Treg cells have been successfully used to prevent organ graft rejection [134]. A model of combined therapy aimed to induce tolerance and restoration of -cell function has shown promising results during treatment of type-1 diabetes in mice [187], but additional research is necessary for a better understanding of Treg cell physiology and to solve several yet unanswered aspects associated to their therapeutic potential in humans. The number of cell populations harboring regulatory properties has grown dramatically and by now CD25 is no longer sufficient to characterize CD4+ Treg cells. Separation on the basis of CD25high expression provides a highly purified Treg cell population, but allows the isolation of only a limited fraction (~25%) of the Foxp3+ T cells [187]. Conversely, separation of either CD4 +CD25+CD127-/low or CD4+CD25hightCD45RA+ cells allows the isolation of Foxp3+ T cells with a higher efficiency (>95%) [187-189]. Isolated CD4+CD25+CD127-/low Treg cells, when stimulated with microbeads coated with anti-CD3- and anti-CD28 mAbs, could be expanded 1,500-fold in the presence of IL-2, where the majority of the expanded population (75%) retains Foxp3+ expression and the suppressive capacity in vitro [187]. In addition, it has been proposed that if the growth of enriched Treg cells takes place in the presence of the immunosuppressant drug rapamycin, the expanded cultures could be devoid of unwanted contaminating effector T cells [143].

Tr1 and Th3 are induced Treg cells, which are as effective as naturally occurring Treg cells in vivo preventing autoimmunity and graft rejection [119, 156]. Despite their weak and transient expression of Foxp3, they display an efficient regulatory phenotype since are induced under tolerogenic conditions. Thus, their potential in cellular therapy is highly limited [119, 156]. Antigen specificity of the suppressor response is necessary to ensure regulatory activities in the site of interest, even though the ultimate efficacy of the Treg depends on bystander suppression and infectious tolerance in the affected tissues. These characteristics may be attained by either conversion of conventional T cells into Treg cells, gene transfer, or isolating and expanding in vitro TCRspecific activated Treg cells to achieve therapeutically relevant levels. Thus, whether Treg cells can be isolated and expanded with sufficient purity and keeping their suppressor potential, whether Treg therapy is sufficient to control unwanted immunity and whether the new therapeutic strategies are safe and effective are questions for future consideration. ACKNOWLEDGMENTS The work in the authors’ laboratory has been supported by a grant from the Spanish Ministry of Science and Education SAF2007-63631. RV is the recipient from a Chilean Government fellowship CONICYT-26080046. ABBREVIATIONS APCs

=

Antigen presenting cells

BD

=

Bowel disease

cAMP

=

Cyclic adenosine monophosphate

CIA

=

Collagen-induced arthritis

CL

=

Cutaneous leishmaniasis

CMV

=

Cytomegalovirus

CTLA

=

Cytotoxic T-lymphocyte antigen

DCs

=

Dendritic cells

EAE

=

Experimental autoimmune encephalomyelitis

Foxp3

=

Transcription factor forkhead box P3

G-CSF

=

Granulocyte colony-stimulating factor

GITR

=

Glucocorticoid-induced family-related protein

TNF

receptor

GM-CSF =

Granulocyte monocyte colony-stimulating factor

HBV

=

Hepatitis B virus

HCV

=

Hepatitis C virus

HPDA

=

Histone/protein deacetylase

HSV

=

Herpes simplex virus

HTLV-1 =

Human T lymphotropic virus type 1

IDO

=

Indoleamine 2,3-dioxygenase

IFN

=

Interferon



IL

=

Interleukin

[18]

IPEX

=

Immuno-dysfunction polyendocrinopathy enteropathy X-linked

[19]

MCP

=

Monocyte chemotactic protein

MMP

=

Metalloproteinases

[21]

MS

=

Multiple sclerosis

[22]

OAF

=

OCLs-activating factor

OBLs

=

Osteoblasts

OCLs

=

Osteoclasts

OPG

=

Osteoprotegerin

[24] [25] [26]

PCM

=

Paracoccidioidomycosis

[27]

RA

=

Rheumatoid arthritis

[28]

RANK

=

Receptor activator of nuclear factor-B

[20]

[23]

[29]

RANKL =

RANK-ligand

ROR

Transcription factor orphan nuclear receptor

[31]

=

[30]

sf

=

Scurfy

[32]

STAT

=

Signal transducer and activator of transcription

[33]

TB

=

Tuberculosis

TGF

=

Transforming growth factor

[34]

Th

=

T helper lymphocytes

[35]

REFERENCES [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12]

[13]

[14]

[15] [16] [17]

Mosmann, T.R.; Cherwinski, H.; Bond, M.W.; Giedlin, M.A.; Coffman, R.L. J. Immunol., 1986, 136, 2348. Abbas, A.K.; Murphy, K.M.; Sher, A. Nature, 1996, 383, 787. Mosmann, T.R.; Coffman, R.L. Annu. Rev. Immunol., 1989, 7, 145. Mosmann, T.R.; Sad, S. Immunol. Today, 1996, 17, 138. Harrington, L.E.; Mangan, P.R.; Weaver, C.T. Curr. Opin. Immunol., 2006, 18, 349. Seder, R.A.; Paul, W.E. Annu. Rev. Immunol., 1994, 12, 635. Bluestone, J.A.; Abbas, A.K. Nat. Rev. Immunol., 2003, 3, 253. Reiner, S.L. Cell, 2007, 129, 33. Infante-Duarte, C.; Horton, H.F.; Byrne, M.C.; Kamradt, T. J. Immunol., 2000, 165, 6107. Gran, B.; Zhang, G.X.; Yu, S.; Li, J.; Chen, X.H.; Ventura, E.S.; Kamoun, M.; Rostami, A. J. Immunol., 2002, 169, 7104. Murphy, K.M.; Reiner, S.L. Nat. Rev. Immunol., 2002, 2, 933. Cua, D.J.; Sherlock, J.; Chen, Y.; Murphy, C.A.; Joyce, B.; Seymour, B.; Lucian, L.; To, W.; Kwan, S.; Churakova, T.; Zurawski, S.; Wiekowski, M.; Lira, S.A.; Gorman, D.; Kastelein, R.A.; Sedgwick, J.D. Nature, 2003, 421, 744. Murphy, C.A.; Langrish, C.L.; Chen, Y.; Blumenschein, W.; McClanahan, T.; Kastelein, R.A.; Sedgwick, J.D.; Cua, D.J. J. Exp. Med., 2003, 198, 1951. Parham, C.; Chirica, M.; Timans, J.; Vaisberg, E.; Travis, M.; Cheung, J.; Pflanz, S.; Zhang, R.; Singh, K.P.; Vega, F.; To, W.; Wagner, J.; O'Farrell, A.M.; McClanahan, T.; Zurawski, S.; Hannum, C.; Gorman, D.; Rennick, D.M.; Kastelein, R.A.; de Waal Malefyt, R.; Moore, K.W. J. Immunol., 2002, 168, 5699. Langrish, C.L.; McKenzie, B.S.; Wilson, N.J.; de Waal Malefyt, R.; Kastelein, R.A.; Cua, D.J. Immunol. Rev., 2004, 202, 96. Bettelli, E.; Carrier, Y.; Gao, W.; Korn, T.; Strom, T.B.; Oukka, M.; Weiner, H.L.; Kuchroo, V.K. Nature, 2006, 441, 235. Mangan, P.R.; Harrington, L.E.; O'Quinn, D.B.; Helms, W.S.; Bullard, D.C.; Elson, C.O.; Hatton, R.D.; Wahl, S.M.; Schoeb, T.R.; Weaver, C.T. Nature, 2006, 441, 231.

[36] [37] [38]

[39] [40] [41] [42] [43] [44]

[45]

[46] [47] [48] [49]

[50] [51] [52]

217

Veldhoen, M.; Hocking, R.J.; Atkins, C.J.; Locksley, R.M.; Stockinger, B. Immunity, 2006, 24, 179. Bettelli, E.; Oukka, M.; Kuchroo, V.K. Nat. Immunol., 2007, 8, 345. Aggarwal, S.; Ghilardi, N.; Xie, M.H.; de Sauvage, F.J.; Gurney, A.L. J. Biol. Chem., 2003, 278, 1910. Sutton, C.; Brereton, C.; Keogh, B.; Mills, K.H.; Lavelle, E.C. J. Exp. Med., 2006, 203, 1685. Mullen, A.C.; High, F.A.; Hutchins, A.S.; Lee, H.W.; Villarino, A.V.; Livingston, D.M.; Kung, A.L.; Cereb, N.; Yao, T.P.; Yang, S.Y.; Reiner, S.L. Science, 2001, 292, 1907. Szabo, S.J.; Kim, S.T.; Costa, G.L.; Zhang, X.; Fathman, C.G.; Glimcher, L.H. Cell, 2000, 100, 655. Stockinger, B.; Veldhoen, M. Curr. Opin. Immunol., 2007, 19, 281. Zheng, W.; Flavell, R.A. Cell, 1997, 89, 587. Ivanov, II; McKenzie, B.S.; Zhou, L.; Tadokoro, C.E.; Lepelley, A.; Lafaille, J.J.; Cua, D.J.; Littman, D.R. Cell, 2006, 126, 1121. Dzhagalov, I.; Zhang, N.; He, Y.W. Cell Mol. Immunol., 2004, 1, 401. Li, M.O.; Wan, Y.Y.; Sanjabi, S.; Robertson, A.K.; Flavell, R.A. Annu. Rev. Immunol., 2006, 24, 99. Sato, W.; Aranami, T.; Yamamura, T. J. Immunol., 2007, 178, 7525. Acosta-Rodriguez, E.V.; Napolitani, G.; Lanzavecchia, A.; Sallusto, F. Nat. Immunol., 2007, 8, 942. Harrington, L.E.; Hatton, R.D.; Mangan, P.R.; Turner, H.; Murphy, T.L.; Murphy, K.M.; Weaver, C.T. Nat. Immunol., 2005, 6, 1123. Liang, S.C.; Tan, X.Y.; Luxenberg, D.P.; Karim, R.; DunussiJoannopoulos, K.; Collins, M.; Fouser, L.A. J. Exp. Med., 2006, 203, 2271. Park, H.; Li, Z.; Yang, X.O.; Chang, S.H.; Nurieva, R.; Wang, Y.H.; Wang, Y.; Hood, L.; Zhu, Z.; Tian, Q.; Dong, C. Nat. Immunol., 2005, 6, 1133. Rouvier, E.; Luciani, M.F.; Mattei, M.G.; Denizot, F.; Golstein, P. J. Immunol., 1993, 150, 5445. Yao, Z.; Fanslow, W.C.; Seldin, M.F.; Rousseau, A.M.; Painter, S.L.; Comeau, M.R.; Cohen, J.I.; Spriggs, M.K. Immunity, 1995, 3, 811. Kolls, J.K.; Linden, A. Immunity, 2004, 21, 467. Chung, D.R.; Kasper, D.L.; Panzo, R.J.; Chitnis, T.; Grusby, M.J.; Sayegh, M.H.; Tzianabos, A.O. J. Immunol., 2003, 170, 1958. Happel, K.I.; Dubin, P.J.; Zheng, M.; Ghilardi, N.; Lockhart, C.; Quinton, L.J.; Odden, A.R.; Shellito, J.E.; Bagby, G.J.; Nelson, S.; Kolls, J.K. J. Exp. Med., 2005, 202, 761. Huang, W.; Na, L.; Fidel, P.L.; Schwarzenberger, P. J. Infect. Dis., 2004, 190, 624. Fossiez, F.; Banchereau, J.; Murray, R.; Van Kooten, C.; Garrone, P.; Lebecque, S. Int. Rev. Immunol., 1998, 16, 541. McKenzie, B.S.; Kastelein, R.A.; Cua, D.J. Trends Immunol., 2006, 27, 17. Cua, D.J.; Kastelein, R.A. Nat. Immunol., 2006, 7, 557. Kramer, J.M.; Gaffen, S.L. J. Periodontol., 2007, 78, 1083. Laan, M.; Cui, Z.H.; Hoshino, H.; Lotvall, J.; Sjostrand, M.; Gruenert, D.C.; Skoogh, B.E.; Linden, A. J. Immunol., 1999, 162, 2347. Ye, P.; Rodriguez, F.H.; Kanaly, S.; Stocking, K.L.; Schurr, J.; Schwarzenberger, P.; Oliver, P.; Huang, W.; Zhang, P.; Zhang, J.; Shellito, J.E.; Bagby, G.J.; Nelson, S.; Charrier, K.; Peschon, J.J.; Kolls, J.K. J. Exp. Med., 2001, 194, 519. Kolls, J.K.; Kanaly, S.T.; Ramsay, A.J. Am. J. Respir. Cell Mol. Biol., 2003, 28, 9. Awane, M.; Andres, P.G.; Li, D.J.; Reinecker, H.C. J. Immunol., 1999, 162, 5337. Hoshino, H.; Laan, M.; Sjostrand, M.; Lotvall, J.; Skoogh, B.E.; Linden, A. J. Allergy Clin. Immunol., 2000, 105, 143. Laan, M.; Prause, O.; Miyamoto, M.; Sjostrand, M.; Hytonen, A.M.; Kaneko, T.; Lotvall, J.; Linden, A. Eur. Respir. J., 2003, 21, 387. Starnes, T.; Broxmeyer, H.E.; Robertson, M.J.; Hromas, R. J. Immunol., 2002, 169, 642. Lubberts, E. Curr. Opin. Investig. Drugs, 2003, 4, 572. Nakae, S.; Saijo, S.; Horai, R.; Sudo, K.; Mori, S.; Iwakura, Y. Proc. Natl. Acad. Sci. USA., 2003, 100, 5986.

218 Infectious Disorders - Drug Targets 2008, Vol. 8, No. 4 [53] [54] [55]

[56] [57] [58] [59] [60]

[61]

[62]

[63] [64]

[65]

[66] [67]

[68] [69] [70] [71] [72] [73] [74] [75] [76] [77]

[78]

[79] [80] [81]

Komiyama, Y.; Nakae, S.; Matsuki, T.; Nambu, A.; Ishigame, H.; Kakuta, S.; Sudo, K.; Iwakura, Y. J. Immunol., 2006, 177, 566. Matusevicius, D.; Kivisakk, P.; He, B.; Kostulas, N.; Ozenci, V.; Fredrikson, S.; Link, H. Mult. Scler., 1999, 5, 101. Kotake, S.; Udagawa, N.; Takahashi, N.; Matsuzaki, K.; Itoh, K.; Ishiyama, S.; Saito, S.; Inoue, K.; Kamatani, N.; Gillespie, M.T.; Martin, T.J.; Suda, T. J. Clin. Invest., 1999, 103, 1345. Fujino, S.; Andoh, A.; Bamba, S.; Ogawa, A.; Hata, K.; Araki, Y.; Bamba, T.; Fujiyama, Y. Gut, 2003, 52, 65. Lubberts, E. Cytokine, 2008, 41, 84. Chabaud, M.; Garnero, P.; Dayer, J.M.; Guerne, P.A.; Fossiez, F.; Miossec, P. Cytokine, 2000, 12, 1092. Rifas, L.; Arackal, S. Arthritis Rheum., 2003, 48, 993. Lock, C.; Hermans, G.; Pedotti, R.; Brendolan, A.; Schadt, E.; Garren, H.; Langer-Gould, A.; Strober, S.; Cannella, B.; Allard, J.; Klonowski, P.; Austin, A.; Lad, N.; Kaminski, N.; Galli, S.J.; Oksenberg, J.R.; Raine, C.S.; Heller, R.; Steinman, L. Nat. Med., 2002, 8, 500. Hellings, P.W.; Kasran, A.; Liu, Z.; Vandekerckhove, P.; Wuyts, A.; Overbergh, L.; Mathieu, C.; Ceuppens, J.L. Am. J. Respir. Cell Mol. Biol., 2003, 28, 42. Molet, S.; Hamid, Q.; Davoine, F.; Nutku, E.; Taha, R.; Page, N.; Olivenstein, R.; Elias, J.; Chakir, J. J Allergy Clin. Immunol., 2001, 108, 430. Laan, M.; Palmberg, L.; Larsson, K.; Linden, A. Eur. Respir. J., 2002, 19, 534. Numasaki, M.; Fukushi, J.; Ono, M.; Narula, S.K.; Zavodny, P.J.; Kudo, T.; Robbins, P.D.; Tahara, H.; Lotze, M.T. Blood, 2003, 101, 2620. Tartour, E.; Fossiez, F.; Joyeux, I.; Galinha, A.; Gey, A.; Claret, E.; Sastre-Garau, X.; Couturier, J.; Mosseri, V.; Vives, V.; Banchereau, J.; Fridman, W.H.; Wijdenes, J.; Lebecque, S.; SautesFridman, C. Cancer Res., 1999, 59, 3698. Moseley, T.A.; Haudenschild, D.R.; Rose, L.; Reddi, A.H. Cytokine Growth Factor Rev., 2003, 14, 155. Ma, X.J.; Wang, Z.; Ryan, P.D.; Isakoff, S.J.; Barmettler, A.; Fuller, A.; Muir, B.; Mohapatra, G.; Salunga, R.; Tuggle, J.T.; Tran, Y.; Tran, D.; Tassin, A.; Amon, P.; Wang, W.; Wang, W.; Enright, E.; Stecker, K.; Estepa-Sabal, E.; Smith, B.; Younger, J.; Balis, U.; Michaelson, J.; Bhan, A.; Habin, K.; Baer, T.M.; Brugge, J.; Haber, D.A.; Erlander, M.G.; Sgroi, D.C. Cancer Cell, 2004, 5, 607. Walsh, M.C.; Kim, N.; Kadono, Y.; Rho, J.; Lee, S.Y.; Lorenzo, J.; Choi, Y. Annu. Rev. Immunol., 2006, 24, 33. Takayanagi, H. J. Periodontal. Res., 2005, 40, 287. Sato, K.; Takayanagi, H. Curr. Opin. Rheumatol., 2006, 18, 419. Rodan, G.A.; Martin, T.J. Science, 2000, 289, 1508. Horton, J.E.; Raisz, L.G.; Simmons, H.A.; Oppenheim, J.J.; Mergenhagen, S.E. Science, 1972, 177, 793. Dewhirst, F.E.; Stashenko, P.P.; Mole, J.E.; Tsurumachi, T. J. Immunol., 1985, 135, 2562. Walsh, M.C.; Choi, Y. Cytokine Growth Factor Rev., 2003, 14, 251. Theill, L.E.; Boyle, W.J.; Penninger, J.M. Annu. Rev. Immunol., 2002, 20, 795. Takahashi, N.; Udagawa, N.; Suda, T. Biochem. Biophys. Res. Commun., 1999, 256, 449. Lacey, D.L.; Timms, E.; Tan, H.L.; Kelley, M.J.; Dunstan, C.R.; Burgess, T.; Elliott, R.; Colombero, A.; Elliott, G.; Scully, S.; Hsu, H.; Sullivan, J.; Hawkins, N.; Davy, E.; Capparelli, C.; Eli, A.; Qian, Y.X.; Kaufman, S.; Sarosi, I.; Shalhoub, V.; Senaldi, G.; Guo, J.; Delaney, J.; Boyle, W.J. Cell, 1998, 93, 165. Simonet, W.S.; Lacey, D.L.; Dunstan, C.R.; Kelley, M.; Chang, M.S.; Luthy, R.; Nguyen, H.Q.; Wooden, S.; Bennett, L.; Boone, T.; Shimamoto, G.; DeRose, M.; Elliott, R.; Colombero, A.; Tan, H.L.; Trail, G.; Sullivan, J.; Davy, E.; Bucay, N.; Renshaw-Gegg, L.; Hughes, T.M.; Hill, D.; Pattison, W.; Campbell, P.; Sander, S.; Van, G.; Tarpley, J.; Derby, P.; Lee, R.; Boyle, W.J. Cell, 1997, 89, 309. Hofbauer, L.C.; Heufelder, A.E. J. Mol. Med., 2001, 79, 243. Huang, L.; Xu, J.; Wood, D.J.; Zheng, M.H. Am. J. Pathol., 2000, 156, 761. Tay, J.Y.; Bay, B.H.; Yeo, J.F.; Harris, M.; Meghji, S.; Dheen, S.T. J. Dent. Res., 2004, 83, 349.

Vernal and Garcia-Sanz [82]

[83] [84] [85]

[86] [87] [88]

[89]

[90] [91] [92]

[93]

[94] [95] [96] [97]

[98] [99] [100] [101] [102] [103] [104] [105] [106] [107] [108] [109]

[110] [111] [112] [113]

[114] [115] [116]

Crotti, T.; Smith, M.D.; Hirsch, R.; Soukoulis, S.; Weedon, H.; Capone, M.; Ahern, M.J.; Haynes, D. J. Periodontal. Res., 2003, 38, 380. Liu, D.; Xu, J.K.; Figliomeni, L.; Huang, L.; Pavlos, N.J.; Rogers, M.; Tan, A.; Price, P.; Zheng, M.H. Int. J. Mol. Med., 2003, 11, 17. Vernal, R.; Chaparro, A.; Graumann, R.; Puente, J.; Valenzuela, M.A.; Gamonal, J. J. Periodontol., 2004, 75, 1586. Kong, Y.Y.; Feige, U.; Sarosi, I.; Bolon, B.; Tafuri, A.; Morony, S.; Capparelli, C.; Li, J.; Elliott, R.; McCabe, S.; Wong, T.; Campagnuolo, G.; Moran, E.; Bogoch, E.R.; Van, G.; Nguyen, L.T.; Ohashi, P.S.; Lacey, D.L.; Fish, E.; Boyle, W.J.; Penninger, J.M. Nature, 1999, 402, 304. Vernal, R.; Dezerega, A.; Dutzan, N.; Chaparro, A.; Leon, R.; Chandia, S.; Silva, A.; Gamonal, J. Oral Dis., 2006, 12, 283. Taubman, M.A.; Kawai, T. Crit. Rev. Oral. Biol. Med., 2001, 12, 125. Vernal, R.; Dutzan, N.; Hernandez, M.; Chandia, S.; Puente, J.; Leon, R.; Garcia, L.; Del Valle, I.; Silva, A.; Gamonal, J. J. Periodontol., 2006, 77, 1772. Yasuda, H.; Shima, N.; Nakagawa, N.; Yamaguchi, K.; Kinosaki, M.; Mochizuki, S.; Tomoyasu, A.; Yano, K.; Goto, M.; Murakami, A.; Tsuda, E.; Morinaga, T.; Higashio, K.; Udagawa, N.; Takahashi, N.; Suda, T. Proc. Natl. Acad. Sci. USA, 1998, 95, 3597. Boyle, W.J.; Simonet, W.S.; Lacey, D.L. Nature, 2003, 423, 337. Hong, M.H.; Williams, H.; Jin, C.H.; Pike, J.W. J. Bone Miner. Res., 2000, 15, 911. Udagawa, N.; Horwood, N.J.; Elliott, J.; Mackay, A.; Owens, J.; Okamura, H.; Kurimoto, M.; Chambers, T.J.; Martin, T.J.; Gillespie, M.T. J. Exp. Med., 1997, 185, 1005. Sato, K.; Suematsu, A.; Okamoto, K.; Yamaguchi, A.; Morishita, Y.; Kadono, Y.; Tanaka, S.; Kodama, T.; Akira, S.; Iwakura, Y.; Cua, D.J.; Takayanagi, H. J. Exp. Med., 2006, 203, 2673. Dong, C. Nat. Rev. Immunol., 2006, 6, 329. Weaver, C.T.; Harrington, L.E.; Mangan, P.R.; Gavrieli, M.; Murphy, K.M. Immunity, 2006, 24, 677. Chabaud, M.; Durand, J.M.; Buchs, N.; Fossiez, F.; Page, G.; Frappart, L.; Miossec, P. Arthritis Rheum., 1999, 42, 963. Ziolkowska, M.; Koc, A.; Luszczykiewicz, G.; KsiezopolskaPietrzak, K.; Klimczak, E.; Chwalinska-Sadowska, H.; Maslinski, W. J. Immunol., 2000, 164, 2832. Takahashi, K.; Azuma, T.; Motohira, H.; Kinane, D.F.; Kitetsu, S. J. Clin .Periodontol., 2005, 32, 369. Vernal, R.; Dutzan, N.; Chaparro, A.; Puente, J.; Antonieta Valenzuela, M.; Gamonal, J. J. Clin. Periodontol., 2005, 32, 383. Green, D.R.; Flood, P.M.; Gershon, R.K. Annu. Rev. Immunol., 1983, 1, 439. Sakaguchi, S.; Toda, M.; Asano, M.; Itoh, M.; Morse, S.S.; Sakaguchi, N. J. Autoimmun., 1996, 9, 211. Pillai, V.; Karandikar, N.J. Immunol. Lett., 2007, 114, 9. Sakaguchi, S. Eur. J. Immunol., 2008, 38, 901. Mittrucker, H.W.; Kaufmann, S.H. Eur. J. Immunol., 2004, 34, 306. McGuirk, P.; Mills, K.H. Trends Immunol., 2002, 23, 450. Malek, T.R.; Yu, A.; Vincek, V.; Scibelli, P.; Kong, L. Immunity, 2002, 17, 167. Shimizu, J.; Yamazaki, S.; Takahashi, T.; Ishida, Y.; Sakaguchi, S. Nat Immunol., 2002, 3, 135. Gavin, M.; Rudensky, A. Curr. Opin. Immunol., 2003, 15, 690. Tang, Q.; Henriksen, K.J.; Boden, E.K.; Tooley, A.J.; Ye, J.; Subudhi, S.K.; Zheng, X.X.; Strom, T.B.; Bluestone, J.A. J. Immunol., 2003, 171, 3348. Bensinger, S.J.; Bandeira, A.; Jordan, M.S.; Caton, A.J.; Laufer, T.M. J. Exp. Med., 2001, 194, 427. Salomon, B.; Lenschow, D.J.; Rhee, L.; Ashourian, N.; Singh, B.; Sharpe, A.; Bluestone, J.A. Immunity, 2000, 12, 431. Liston, A.; Rudensky, A.Y. Curr. Opin. Immunol., 2007, 19, 176. Lenschow, D.J.; Herold, K.C.; Rhee, L.; Patel, B.; Koons, A.; Qin, H.Y.; Fuchs, E.; Singh, B.; Thompson, C.B.; Bluestone, J.A. Immunity, 1996, 5, 285. Belkaid, Y.; Rouse, B.T. Nat. Immunol., 2005, 6, 353. Shevach, E.M. Nat. Rev. Immunol., 2002, 2, 389. Gonzalez, A.; Andre-Schmutz, I.; Carnaud, C.; Mathis, D.; Benoist, C. Nat. Immunol., 2001, 2, 1117.

Translational controlled mRNAs: new drug targets on infectious diseases? [117] [118] [119] [120] [121] [122]

[123] [124] [125] [126]

[127]

[128] [129]

[130]

[131]

[132]

[133] [134] [135] [136] [137] [138] [139] [140] [141] [142] [143] [144]

[145] [146] [147] [148]

[149] [150] [151]

Jonuleit, H.; Schmitt, E.; Steinbrink, K.; Enk, A.H. Trends Immunol., 2001, 22, 394. Taylor, P.A.; Friedman, T.M.; Korngold, R.; Noelle, R.J.; Blazar, B.R. Blood, 2002, 99, 4601. Belkaid, Y. Nat. Rev. Immunol., 2007, 7, 875. Roncarolo, M.G.; Gregori, S. Eur. J. Immunol., 2008, 38, 925. Hori, S.; Sakaguchi, S. Microbes Infect., 2004, 6, 745. Li, B.; Samanta, A.; Song, X.; Iacono, K.T.; Brennan, P.; Chatila, T.A.; Roncador, G.; Banham, A.H.; Riley, J.L.; Wang, Q.; Shen, Y.; Saouaf, S.J.; Greene, M.I. Int. Immunol., 2007, 19, 825. Li, B.; Greene, M.I. Immunology, 2008, 123, 17. Godfrey, V.L.; Wilkinson, J.E.; Russell, L.B. Am. J. Pathol., 1991, 138, 1379. Fontenot, J.D.; Gavin, M.A.; Rudensky, A.Y. Nat. Immunol., 2003, 4, 330. Bacchetta, R.; Passerini, L.; Gambineri, E.; Dai, M.; Allan, S.E.; Perroni, L.; Dagna-Bricarelli, F.; Sartirana, C.; Matthes-Martin, S.; Lawitschka, A.; Azzari, C.; Ziegler, S.F.; Levings, M.K.; Roncarolo, M.G. J. Clin. Invest., 2006, 116, 1713. Yagi, H.; Nomura, T.; Nakamura, K.; Yamazaki, S.; Kitawaki, T.; Hori, S.; Maeda, M.; Onodera, M.; Uchiyama, T.; Fujii, S.; Sakaguchi, S. Int. Immunol., 2004, 16, 1643. Hori, S.; Nomura, T.; Sakaguchi, S. Science, 2003, 299, 1057. Cosmi, L.; Liotta, F.; Lazzeri, E.; Francalanci, M.; Angeli, R.; Mazzinghi, B.; Santarlasci, V.; Manetti, R.; Vanini, V.; Romagnani, P.; Maggi, E.; Romagnani, S.; Annunziato, F. Blood, 2003, 102, 4107. Walker, M.R.; Kasprowicz, D.J.; Gersuk, V.H.; Benard, A.; Van Landeghen, M.; Buckner, J.H.; Ziegler, S.F. J. Clin. Invest., 2003, 112, 1437. Allan, S.E.; Crome, S.Q.; Crellin, N.K.; Passerini, L.; Steiner, T.S.; Bacchetta, R.; Roncarolo, M.G.; Levings, M.K. Int. Immunol., 2007, 19, 345. Passerini, L.; Allan, S.E.; Battaglia, M.; Di Nunzio, S.; Alstad, A.N.; Levings, M.K.; Roncarolo, M.G.; Bacchetta, R. Int.Immunol., 2008, 20, 421. Fontenot, J.D.; Rasmussen, J.P.; Gavin, M.A.; Rudensky, A.Y. Nat. Immunol., 2005, 6, 1142. Horwitz, D.A.; Zheng, S.G.; Wang, J.; Gray, J.D. Eur. J. Immunol., 2008, 38, 912. Marie, J.C.; Letterio, J.J.; Gavin, M.; Rudensky, A.Y. J. Exp. Med., 2005, 201, 1061. Zheng, S.G.; Wang, J.H.; Stohl, W.; Kim, K.S.; Gray, J.D.; Horwitz, D.A. J. Immunol., 2006, 176, 3321. Rubtsov, Y.P.; Rudensky, A.Y. Nat. Rev. Immunol., 2007, 7, 443. Shevach, E.M.; Tran, D.Q.; Davidson, T.S.; Andersson, J. Eur. J. Immunol., 2008, 38, 915. Coombes, J.L.; Siddiqui, K.R.; Arancibia-Carcamo, C.V.; Hall, J.; Sun, C.M.; Belkaid, Y.; Powrie, F. J. Exp. Med., 2007, 204, 1757. You, S.; Leforban, B.; Garcia, C.; Bach, J.F.; Bluestone, J.A.; Chatenoud, L. Proc. Natl. Acad. Sci. USA, 2007, 104, 6335. Oida, T.; Xu, L.; Weiner, H.L.; Kitani, A.; Strober, W. J. Immunol., 2006, 177, 2331. Jonuleit, H.; Schmitt, E.; Kakirman, H.; Stassen, M.; Knop, J.; Enk, A.H. J. Exp. Med., 2002, 196, 255. Tang, Q.; Bluestone, J.A. Nat. Immunol., 2008, 9, 239. Mempel, T.R.; Pittet, M.J.; Khazaie, K.; Weninger, W.; Weissleder, R.; von Boehmer, H.; von Andrian, U.H. Immunity, 2006, 25, 129. Gondek, D.C.; Lu, L.F.; Quezada, S.A.; Sakaguchi, S.; Noelle, R.J. J. Immunol., 2005, 174, 1783. Grossman, W.J.; Verbsky, J.W.; Barchet, W.; Colonna, M.; Atkinson, J.P.; Ley, T.J. Immunity, 2004, 21, 589. Misra, N.; Bayry, J.; Lacroix-Desmazes, S.; Kazatchkine, M.D.; Kaveri, S.V. J. Immunol., 2004, 172, 4676. Fallarino, F.; Grohmann, U.; Hwang, K.W.; Orabona, C.; Vacca, C.; Bianchi, R.; Belladonna, M.L.; Fioretti, M.C.; Alegre, M.L.; Puccetti, P. Nat. Immunol., 2003, 4, 1206. Li, M.O.; Flavell, R.A. Immunity, 2008, 28, 468. Moore, K.W.; de Waal Malefyt, R.; Coffman, R.L.; O'Garra, A. Annu. Rev. Immunol., 2001, 19, 683. Roers, A.; Siewe, L.; Strittmatter, E.; Deckert, M.; Schluter, D.; Stenzel, W.; Gruber, A.D.; Krieg, T.; Rajewsky, K.; Muller, W. J. Exp. Med., 2004, 200, 1289.

Infectious Disorders - Drug Targets 2008, Vol. 8, No. 4 [152]

[153]

[154]

[155]

[156] [157]

[158] [159]

[160] [161] [162] [163] [164] [165] [166] [167] [168]

[169]

[170]

[171] [172]

[173] [174] [175]

[176]

[177] [178] [179]

[180]

[181] [182]

219

Rubtsov, Y.P.; Rasmussen, J.P.; Chi, E.Y.; Fontenot, J.; Castelli, L.; Ye, X.; Treuting, P.; Siewe, L.; Roers, A.; Henderson, W.R., Jr.; Muller, W.; Rudensky, A.Y. Immunity, 2008, 28, 546. Bopp, T.; Becker, C.; Klein, M.; Klein-Hessling, S.; Palmetshofer, A.; Serfling, E.; Heib, V.; Becker, M.; Kubach, J.; Schmitt, S.; Stoll, S.; Schild, H.; Staege, M.S.; Stassen, M.; Jonuleit, H.; Schmitt, E. J. Exp. Med., 2007, 204, 1303. Deaglio, S.; Dwyer, K.M.; Gao, W.; Friedman, D.; Usheva, A.; Erat, A.; Chen, J.F.; Enjyoji, K.; Linden, J.; Oukka, M.; Kuchroo, V.K.; Strom, T.B.; Robson, S.C. J. Exp. Med., 2007, 204, 1257. Collison, L.W.; Workman, C.J.; Kuo, T.T.; Boyd, K.; Wang, Y.; Vignali, K.M.; Cross, R.; Sehy, D.; Blumberg, R.S.; Vignali, D.A. Nature, 2007, 450, 566. Belkaid, Y. Eur. J. Immunol., 2008, 38, 918. Montagnoli, C.; Fallarino, F.; Gaziano, R.; Bozza, S.; Bellocchio, S.; Zelante, T.; Kurup, W.P.; Pitzurra, L.; Puccetti, P.; Romani, L. J Immunol, 2006, 176, 1712. von Boehmer, H. Nat. Immunol., 2005, 6, 338. Tarbell, K.V.; Petit, L.; Zuo, X.; Toy, P.; Luo, X.; Mqadmi, A.; Yang, H.; Suthanthiran, M.; Mojsov, S.; Steinman, R.M. J. Exp. Med., 2007, 204, 191. Suri-Payer, E.; Fritzsching, B. Springer Semin. Immunopathol., 2006, 28, 3. Edinger, M.; Hoffmann, P.; Ermann, J.; Drago, K.; Fathman, C.G.; Strober, S.; Negrin, R.S. Nat. Med., 2003, 9, 1144. Yu, P.; Lee, Y.; Liu, W.; Krausz, T.; Chong, A.; Schreiber, H.; Fu, Y.X. J. Exp. Med., 2005, 201, 779. Nixon, D.F.; Aandahl, E.M.; Michaelsson, J. Microbes Infect., 2005, 7, 1063. Vahlenkamp, T.W.; Tompkins, M.B.; Tompkins, W.A. Vet Immunol. Immunopathol., 2005, 108, 219. Beyer, M.; Schultze, J.L. Blood, 2006, 108, 804. Brusko, T.; Atkinson, M. Cell Biochem. Biophys., 2007, 48, 165. Zorn, E. Semin. Cancer Biol., 2006, 16, 150. Kinter, A.L.; Hennessey, M.; Bell, A.; Kern, S.; Lin, Y.; Daucher, M.; Planta, M.; McGlaughlin, M.; Jackson, R.; Ziegler, S.F.; Fauci, A.S. J. Exp. Med., 2004, 200, 331. Andersson, J.; Boasso, A.; Nilsson, J.; Zhang, R.; Shire, N.J.; Lindback, S.; Shearer, G.M.; Chougnet, C.A. J. Immunol., 2005, 174, 3143. Xu, D.; Fu, J.; Jin, L.; Zhang, H.; Zhou, C.; Zou, Z.; Zhao, J.M.; Zhang, B.; Shi, M.; Ding, X.; Tang, Z.; Fu, Y.X.; Wang, F.S. J..Immunol., 2006, 177, 739. Cabrera, R.; Tu, Z.; Xu, Y.; Firpi, R.J.; Rosen, H.R.; Liu, C.; Nelson, D.R. Hepatology, 2004, 40, 1062. MacDonald, A.J.; Duffy, M.; Brady, M.T.; McKiernan, S.; Hall, W.; Hegarty, J.; Curry, M.; Mills, K.H. J. Infect. Dis., 2002, 185, 720. Oh, U.; Grant, C.; Griffith, C.; Fugo, K.; Takenouchi, N.; Jacobson, S. J. Infect. Dis., 2006, 193, 1557. Aandahl, E.M.; Michaelsson, J.; Moretto, W.J.; Hecht, F.M.; Nixon, D.F. J. Virol., 2004, 78, 2454. Walther, M.; Tongren, J.E.; Andrews, L.; Korbel, D.; King, E.; Fletcher, H.; Andersen, R.F.; Bejon, P.; Thompson, F.; Dunachie, S.J.; Edele, F.; de Souza, J.B.; Sinden, R.E.; Gilbert, S.C.; Riley, E.M.; Hill, A.V. Immunity, 2005, 23, 287. Campanelli, A.P.; Roselino, A.M.; Cavassani, K.A.; Pereira, M.S.; Mortara, R.A.; Brodskyn, C.I.; Goncalves, H.S.; Belkaid, Y.; Barral-Netto, M.; Barral, A.; Silva, J.S. J. Infect. Dis., 2006, 193, 1313. Belkaid, Y.; Blank, R.B.; Suffia, I. Immunol. Rev., 2006, 212, 287. Kitagaki, K.; Businga, T.R.; Racila, D.; Elliott, D.E.; Weinstock, J.V.; Kline, J.N. J. Immunol., 2006, 177, 1628. Cavassani, K.A.; Campanelli, A.P.; Moreira, A.P.; Vancim, J.O.; Vitali, L.H.; Mamede, R.C.; Martinez, R.; Silva, J.S. J. Immunol., 2006, 177, 5811. Chen, X.; Zhou, B.; Li, M.; Deng, Q.; Wu, X.; Le, X.; Wu, C.; Larmonier, N.; Zhang, W.; Zhang, H.; Wang, H.; Katsanis, E. Clin. Immunol., 2007, 123, 50. Lundgren, A.; Suri-Payer, E.; Enarsson, K.; Svennerholm, A.M.; Lundin, B.S. Infect. Immun., 2003, 71, 1755. Nakajima, T.; Ueki-Maruyama, K.; Oda, T.; Ohsawa, Y.; Ito, H.; Seymour, G.J.; Yamazaki, K. J. Dent. Res., 2005, 84, 639.

220 Infectious Disorders - Drug Targets 2008, Vol. 8, No. 4 [183] [184] [185] [186]

Okui, T.; Ito, H.; Honda, T.; Amanuma, R.; Yoshie, H.; Yamazaki, K. Oral Microbiol. Immunol., 2008, 23, 49. Yamazaki, S.; Bonito, A.J.; Spisek, R.; Dhodapkar, M.; Inaba, K.; Steinman, R.M. Blood, 2007, 110, 4293. Kikly, K.; Liu, L.; Na, S.; Sedgwick, J.D. Curr. Opin. Immunol., 2006, 18, 670. Minton, K. Nat. Rev. Immunol. Highlights, 2005, 5, 100.

Received: May 21, 2008

Accepted: June 30, 2008

Vernal and Garcia-Sanz [187] [188]

[189]

Brusko, T.; Bluestone, J. Eur. J. Immunol., 2008, 38, 931. Liu, W.; Putnam, A.L.; Xu-Yu, Z.; Szot, G.L.; Lee, M.R.; Zhu, S.; Gottlieb, P.A.; Kapranov, P.; Gingeras, T.R.; Fazekas de St Groth, B.; Clayberger, C.; Soper, D.M.; Ziegler, S.F.; Bluestone, J.A. J. Exp. Med., 2006, 203, 1701. Hoffmann, P.; Eder, R.; Boeld, T.J.; Doser, K.; Piseshka, B.; Andreesen, R.; Edinger, M. Blood, 2006, 108, 4260.


221

Toll Like Receptor - Potential Drug Targets in Infectious Disease Francois Erard* and Bernhard Ryffel Molecular Immunology and Embryology, University and CNRS, Orleans, France Abstract: Toll like receptors (TLR) play a critical role in the recognition and response of pathogens by the innate immune system. Pathogen engagement of the TLR-MyD88 pathway favours the development of a protective Th1-biased T cell response. Interruption of TLR recognition or signalling has profound effects on innate immunity. Agonists or antagonists of specific TLRs modulate the host response to microbial infections and have effects beyond infectious control and may be used as immunostimulators in vaccine, cancer, inflammatory disorders and allergy.

Keywords: TLR, IL1R, infection, vaccine, inflammation, immunomodulation. 1. INTRODUCTION The Toll like receptor (TLR) family is structurally conserved and homologous to the Drosophila Toll system and critical in the response to microbes [1-4]. Microbial products bind and activate mammalian TLRs, leading to the transcription of genes that regulate the adaptive immune response such as chemokines, cytokines and costimulatory molecules as reviewed recently [5-9]. The TLR family comprises at least ten members, which have a broad tissue expression [10]. The greatest variety of TLR mRNAs is found in professional phagocytes which correlates with their role as microbial sensors for the innate immune response. TLRs are type I membrane proteins containing an extracellular domain with leucine-rich repeats and a cytoplasmic Toll/IL1 receptor (TIR) homology domain. TLRs form both homo- and heterodimers, and ligand binding results in the recruitment of the adaptor proteins MyD88, TIRAP, TRAM and TRIF, and activation of IRAK kinases resulting in the translocation of NFB initiating the transcription of genes of proinflammatory and costimulatory molecules. Agonists or antagonists of the TLR system may direct a cell-mediated or humoral response and thereby modulate disease. As an example, the 19kDa lipoprotein derived from Mycobacterium tuberculosis (M; tuberculosis) activates TLR2, induces a vigorous cell mediated immune response (Th1) and enhances the killing of TB bacilli in macrophages by the induction of tumour necrosis factor (TNF), nitric oxide synthesis, and apoptosis [11,12]. Here the emerging role of TLR in infectious diseases is reviewed with a focus on endogenous and exogenous TLR ligands. TLRs and the TLR signalling pathway may represent novel targets for therapy in infections and allergic and inflammatory diseases. 2. TLRs AND PATHOGEN-ASSOCIATED MOLECULAR PATTERN RECOGNITION 2.1. Structure and Function of TLRs Structurally, the type I membrane protein family TLRs are composed of an extracellular domain with several *Address correspondence to this author at the Molecular Immunology and Embryology, University and CNRS, Orleans, France; E-mail: [email protected]; [email protected] 1871-5265/08 $55.00+.00

leucine-rich repeats, transmembrane domain and a cytoplasmic homology domain similar to that of the interleukin 1 (IL-1) receptor family, which form either homo- or heterodimers. Individual TLRs recognize specific pathogen associated molecular patterns (PAMPs) of micro-bial origin with their extracellular portion, but the exact molecular structure allowing the binding of pathogen derived molecules such as lipid A, lipoproteins, glycolipids, zymosan has only been partially identified. A simplified overview of PAMPs binding selectively to individual TLRs is given (Fig. 1). Binding of pathogen derived molecules to these nonclonal receptors associated with homo- or hetero-dimerisation modulates cell activation and gene transcription in a TLR specific fashion. TLR signal transduction is mediated by binding of the adaptor protein MyD88 to the TIR domain of TLRs, followed by the recruitment of IL-1 receptor associated kinases (IRAK), TNF receptor associated factor (TRAF) 6, mitogen-activated protein (MAP) kinase and NFB activation [13]. In the case of TLR2 and TLR4, another adaptor related to MyD88 called Mal/TIRAP participates in signalling [14-16]. A third adaptor, called Toll-interleukin-1 receptor (TIR) domain-containing adaptor inducing interferon (IFN)-beta (TRIF), also known as TIR-containing adaptor molecule-1 (TICAM-1), has been identified [17,18]. TRIF is particularly important for IFN regulatory factor-3 (IRF-3) activation mediated by viral-induced TLR3 engagement [17-19]. These data suggest that pathogen binding to specific TLRs or to combinations of TLRs may recruit different adaptor proteins allowing a specific signalling cascade and gene activation programmes. The serine/threonine kinase family consists of two active kinases, IRAK and IRAK-4, and two inactive kinases, IRAK-2 and IRAK-M. IRAK-M expression is restricted to monocytes/macrophages, is induced upon TLR stimulation and prevents the dissociation of IRAK and IRAK-4 from MyD88 and the formation of IRAK-TRAF6 complexes. Therefore, IRAK activation is critical for TLR signalling, and IRAK-M regulates TLR signalling and innate immune homeostasis [20]. The regulatory role of IRAK-M on TLR signalling and the requirement of IRAK in response to TLR stimulation respectively have been confirmed in gene deficient mice [2022].

© 2008 Bentham Science Publishers Ltd.


Erard and Ryffel

Fig. (1). Microbial ligands and association with known TLRs and adaptor molecules. Schematic representation of the structure of TLRs and the major TLR ligands. Most TLRs form homodimers, while TLR2 associates with either TLR1 or TLR6. TLR signalling is mediated through adaptators such as MyD88 TIRAP, TRIF or TRAM.

Other pathogen recognition receptors (PRR) and cooperation between different PRR may contribute to the recognition of PAMPs and therefore of pathogens by the innate immune system. In particular, other PRR include the family of the nucleotide-binding oligomerization domain proteins (NOD), cytosolic proteins with homologies to TLRs and functions in innate immune responses [23], and lectin receptors such as DC-SIGN, which recognises HIV and M. tuberculosis [24-26], mannose receptor [27,28], scavenger receptor [29-31], Dectin-1 [32,33] and others. Furthermore, there is evidence that several PPR cooperate for efficient pathogen recognition, such as CD14 and TLR4 [34], CD14 and TLR2 [35] or Dectin-1 and TLR2 [32,33]. Therefore, in addition to TLRs, several non-clonal receptors participate in innate recognition of microbes, and recent studies demonstrate strong interactions between signalling through these receptors and TLRs, possibly in supra-molecular receptor complexes, as recently proposed by Underhill [8]. 2.2. Recognition of Microbes by Different TLRs Microbes and pathogens express and secrete products which are recognized by TLRs, which are shortly reviewed [36]. 2.2.1. TLR in Response to Bacteria TLR2 and TLR4 are critical for the control of Grampositive and -negative bacterial infections. They are essential in the recognition of various bacterial cell wall components or secreted products. TLR4 is the signalling receptor of LPS

derived from Gram-negative bacteria, as shown in spontaneous TLR4 mutant mice [37]. By contrast, TLR2deficient macrophages are hyporesponsive to several Grampositive bacterial cell wall components such as peptidoglycans. Therefore, TLR2 and TLR4 recognize different bacterial molecules and are involved in the host response to different pathogens [38]. The control of Listeria monocytogenes infection appears to be TLR dependent as MyD88 deficient mice rapidly succumb to infection [39,40] and TLR2 signalling plays a role in host resistance [41]. Interestingly, TLR2 and CD14 cooperate in the host response [42]. Salmonella typhimurium induced recruitment of neutrophil is CD14 and TLR4 dependent [43], and overexpression of TLR4 increases host resistance [44]. Flagellated bacteria are recognized by TLR5, and flagellin was shown to bind and activate TLR5 [45]. Further, flagellin induced airway inflammation is mediated by TLR5 [46] (Janot et al in preparation). Activation of TLR5 by flagellin and synthetic peptides have protective effect in irradiation induced intestinal and haemopoietic adverse effects in mice and non-human primates suggesting that activation of the innate immunity by the TLR5 agonists protects the host and reduces the enteral barrier by the microflora [47]. Mixed bacterial infections are a complex issue, especially infection with mircroorganisms from the intestine. An inflammatory response by microflora is avoided by the interaction of the microflora with TLRs on surface epithelia under steady- state conditions [48,49].

Toll Like Receptor - Potential Drug Targets in Infectious Disease

However, upon disruption of this intestinal homeostasis caused by dextran sodium sulfate (DSS) induced intestinal injury, TLR activation is critical, and TLR2, TLR4 and MyD88 deficient mice succumb to in systemic. Surprisingly, polymicrobial infection caused by experimental caecal ligation puncture in mice is TLR9 dependent as TLR9 deficient mice and mice treated with an inhibitory CpG that blocks TLR9 are protected [50]. These data suggest that bacterial DNA released by the enteral pathogens causes a hyperinflammation which is driven by a single TLR9. Obviously these unexpected data need to be confirmed. 2.2.2. TLR in Response to Mycobacteria We have recently reviewed the role of TLR in the control of mycobacterial infection [51]. TLR2 and to a lesser extent TLR4 are required for the long-term control of Mycobacterium tuberculosis infection in aerosol exposed mice [52,53], while the early response to infection are less TLR2 dependent [54]. In addition, MyD88 deficient mice succumb rapidly to mycobacterial infection [55]. Soluble tuberculosis factor (STF), a component of a short term culture filtrate of M. tuberculosis purified by proteinase K digestion and triton extraction, activates TLR2 [56]. At the molecular level the 19kDa lipoprotein activates murine and human macrophages to secrete TNF and nitric oxide via interaction with TLR2, but not TLR4 and inducing T-cell responses [11]. Lipoarabinomannan from rapidly growing mycobacteria (PILAM or AraLAM), lipomannan (LM) and their phosphatidylinositol anchor PIM are glycolipids stimulating cytokine secretion by macrophages in a TLR2 dependent fashion [35,56,57] and the acetylation state may be critical for the response [58]. In conclusion, TLR2 and TLR4, and possibly other TLRs, are essential to control M. tuberculosis infection. The discovery of regulatory components released by mycobacteria which may modulate TLR responses are emerging. 2.2.3. TLRs in Response to Virus Pattern recognition via Toll-like receptors is also an important for the recognition of viruses and includes at least TLR3 and TLR2. TLR3 is activated by RNA virus and polyIC [59]. TLR3 but also TLR7 and TLR8, that are expressed in endosomes, have been shown to be important to control several virus infections as recently reviewed (Takeuchi Akira 2008, 2007 Beutler 2007). However, TLR3 signaling may be detrimental as the inflammatory pathology is reduced in TLR3 deficient mice [60]. Respiratory syncytial virus (RSV) potently and specifically activates NF-B in vivo, which is TLR4 dependent. NF-B may be considered a central activator of not only inflammatory but also innate immune responses to RSV [61]. 2.2.4. TLR in Response to Fungi Beta-glucans are major structural components of fungi. Beta-glucan from Pneumocystis carinii (P. carinii) induces leukocyte activation and the synthesis of pro-inflammatory cytokines and chemokines through NF-B activation [62]. P. carinii beta-glucan and LPS utilize different receptor systems to induce macrophage activation, as LPS beta-glucan induced TNF activation is TLR2 and MyD88 dependent [62]. Furthermore beta-glucan from yeast including zymosan


223

induce TNF in macrophages by a combined ligation of TLR2 and Dectin-1 at the cell surface and requires the cytoplasmic tail and immunoreceptor tyrosine activation motif of Dectin1 as well as TLR2 and MyD88 [32,33]. Overall data demonstrate that the inflammatory response to pathogens requires recognition by a specific receptor, in the case of yeast Dectin-1, in addition to the TLRs. The critical role of dectin-1 for the fungal defence has been confirmed in dectin1 deficient mice [63]. The in vivo host defence to Candida albicans was reduced in TLR4-defective C3H/HeJ mice with impaired chemokine expression and neutrophil recruitment [64] and the complex issue of TLR and C-type lectin receptors has been reviewed recently [65,66]. 2.2.5. TLR in Response to Parasites Host resistance to the intracellular protozoan Toxoplasma gondii (T. gondii) is highly dependent on early IL-12 production by APC. Host resistance and T. gondii-induced IL-12 productions are dramatically reduced in mice lacking MyD88 although neither TLR2 nor TLR4 seemed to be involved [67]. Cyclophilin-18 produced T. gondii signals though CCR5, a chemokine receptor important in parasiteinduced IL-12 production by DCs [68]. Recently, a critical role of TLR9 has been identified in orally infected mice; which develop a dramatic and lethal infection. TLR9 deficient mice were protected from induced ileitis and mortality [69]). Trypanosoma cruzi and their glycosylphosphatidyl inositol (GPI)-anchored variant-specific surface glycoprotein induce TLR2 dependent recruitment of leukocytes [70,71]. Plasmodium berghei (P. berghei)-induced liver injury is associated with increased IL-12 serum levels and IL-12deficient mice are resistant to P berghei NK65 liver injury. The TLR-MyD88 pathway appears to be required for induction of IL-12 production during P. berghei NK65 infection and hepatic injury, although parasite clearance was MyD88independent [72]. By contrast, absence of the TLR-MyD88 did not protect from lethal cerebral malaria cause by blood stage infection with the P. berghei ANKA parasite [73], while mice deficient for the lymphotoxin (LT, and LT) as well as TNFR2 and LT receptors are protected from cerebral malaria (Fauconnier, et al. in press). 3. TLR AGONISTS AND ANTAGONISTS Recent investigations demonstrated the presence of several host derived molecules capable of binding TLR in addition to the pathogen derived molecules PAMPs. A limited list of known TLR ligands is given in the table, and the main findings are discussed below. 3.1. Endogenous Ligands of TLR Heat Shock Proteins Heat-shock proteins (HSP) are ubiquitous chaperone proteins which may activate innate immune cells. Both HSP70 and HSP60 activate the TLR signal pathway [74-77]. HSP60 and HSP70 induce macrophages and endothelial cell activation, e.g. induction of IL-12 and endothelial cellleukocyte adhesion molecule-1 (ELAM-1) promoters in


Table 1. Overview of the Known Toll-Like Receptor Ligands and their Specificity for Toll-Like Receptors

Erard and Ryffel

trigger robust, type 1 polarized adaptive immune responses in vivo, suggesting that beta-defensin 2 may play an important role in immunosurveillance against pathogens [82].

TLR1

Tri-acyl lipopeptides (mycobacteria, bacteria)

Matrix Proteins

TLR2

Lipoproteins and lipopeptides

Low molecular weight fragmentation products of polysaccharide of hyaluronic acid (HA) produced during inflammation are potent activators of immune cells such as DCs and macrophages. HA induces DC maturation via TLR4, resulting in activation of p38/p42/44 MAP-kinases and nuclear translocation of NF-B. In vivo HA induces TLR4-dependent emigration and maturation of dermal DC. Therefore, polysaccharide degradation products of the extracellular matrix produced during inflammation or tissue injury might serve as endogenous ligands for the TLR4 on DCs [83,84]. Interestingly hyaluronan binds to CD44, which terminates the inflammatory response [85].

Peptidoglycan (Gram-positive bacteria) Lipoarabinomannan Lipoteichoic acid (Gram-positive bacteria) Zymosan Lipopolysaccharides, atypical (Leptospira and others) Porins (Neisseria) Glyco-inositol-phospholipids (Trypanosoma cruzi) Hsp70 TLR3

Double-stranded RNA, poly inositol-cytosine

TLR4

Lipopolysaccharide (Gram-negative bacteria) Taxol

The expanding list of endogenous ligands able to activate the Toll/IL-1 receptor signal pathway is in line with the "danger hypothesis" proposing that the innate immune system senses danger signals even if they originate from self [86].

Viral proteins (RSV, MMTV)

3.2. Pathogen Derived Molecular Ligands of TLRs

Hsp60 and 70

LPS, Endotoxin, Lipid A

Hyaluronic acid and Type III repeat extradomain A of Fibronectin Heparansulfate (fragments) Fibrinogen TLR5

Flagellin (bacteria)

TLR6

Di-acyl lipopeptides (mycoplasma)

TLR7

Imidazoquinoline derivatives

TLR8

Imidazoquinoline derivatives

TLR9

CpG DNA (bacteria)

TLR10

?

Hsp: Heat shock protein; poly IC: Poly-inositol-cytosine; RSV: Respiratory syncytial virus

macrophages. The HSP70 and HSP60 signal through TLR2 and TLR4 [78], and the proinflammatory effect of HSP60 is absent in TLR4 deficient macrophages [79]. Furthermore, HSP70 has a B lymphocyte mitogenic effect [80]. Finally, genetic complementation with TLR2 and TLR4 confer responsiveness to HSP70 in 293T fibroblasts. These data suggest that HSPs might act as endogenous TLR agonists, and therefore stress might activate the innate immune system through TLR ligation. Beta-Defensin 2 Beta-defensins are antimicrobial peptides of the innate immune system produced in response to microbial infection in the lung and other organs [81]. Beta-defensin 2 acts directly on immature dendritic cells as an endogenous ligand for TLR-4, inducing up-regulation of costimulatory molecules and dendritic cell maturation. These events, in turn,

Genetic studies revealed a critical role for TLR4 in the biological response to LPS from Gram-negative bacteria. LPS is transported in the serum by lipoprotein binding protein (LBP) and presented by CD14 to the TLR4 MD2 complex [37,87]. Two major signalling pathways for LPS have been suggested in recent studies, which are referred to as MyD88dependent and -independent pathways. MyD88- or TRAF-6 deficient cells failed to produce inflammatory cytokines in response to LPS, although IRF-3 and IFN-stimulated regulatory elements such as IP-10 were not affected [88]. Thus, TLR4 signalling is composed of at least two distinct pathways, a MyD88-dependent pathway that is critical to the induction of inflammatory cytokines and a MyD88/TRAF6independent pathway that regulates induction of IP-10. Beside the genetic evidence for TLR4 in the biological response to LPS, other pathogen derived ligands activate ectopically expressed TLR4 and TLR2 in a LBP and/or CD14 dependent manner, such as LTA, LAM and lipid A [89,90]. Lipid A is the active moiety of LPS and several analogues have been generated including OM174 from E. Coli and HP206 from Helicobacter pylori [91-94]. Their effects are essentially mediated through TLR4 (unpublished). Lipopeptide The effect of the TLR2 dependent agonist, the 19kDa mycobacterial lipoprotein, on macrophage activation has been described [11,95]. The TLR2 mediated immunostimulatory properties of bacterial lipoproteins are attributed to the presence of a lipoylated N-terminus. Most BLP are triacylated at the N-terminus cysteine residue, but mycoplasma derived macrophage-activating lipopeptide-2 kD (MALP-2) is only diacylated. Co-expression of TLR2


and TLR6 is absolutely required for the response to diacylated MALP-2, and TLR6 appears to discriminate between the N-terminal lipoylated structures of MALP-2 and lipopeptides derived from other bacteria [96,97]. By contrast, TLR2 associates with TLR1 and recognizes the native mycobacterial 19kDa lipoprotein and synthetic triacylated lipopeptide such as Pam3 CSK4. Macrophages from TLR1-deficient mice showed impaired proinflammatory cytokine production in response to the 19kDa lipoprotein and Pam3 CSK4. In contrast, TLR1-deficient cells responded normally to the diacylated lipopeptide MALP-2. Furthermore, lipoprotein analogs whose acylation was modified were preferentially recognized by TLR1. Therefore, TLR1 interacts with TLR2 to recognize the lipid configuration of the native mycobacterial lipoprotein as well as several triacylated lipopeptides [98] and TLR2 heterodimerization with TLR6 or TLR1 seem to confer TLR2 specificity for di- versus tri-acylated lipopeptides, respectively. Peptidoglycan Peptidoglycans from bacteria activate TLR2 [38]. The nucleotide-binding oligomerization domain protein 1 (NOD1), part of multiple member family with NOD and leucine-rich repeats, is intracellular protein with homologies to TLRs and functions in innate immune responses. NOD1 as TLR2 were shown to recognize peptidoglycan, but NOD1 recognise diaminopimelic acid (DAP) of peptidoglycan from Gram-negative bacteria. DAP induced secretion of cytokines in macrophages is NOD1 dependent, as macrophages from NOD1 deficient mica do not respond to DAP. The data suggest a selective recognition of bacteria through detection of DAP-containing peptidoglycan by NOD1 [23]. While TLR receptors are broadly expressed, the main target of TLR agonists are the antigen presenting cells, including dendritic cells, macrophages, B-cells, neutrophils, endothelial and epithelial cells. Recent evidence suggests that mast cells play a critical role in host defence against bacterial infection. Murine mast cells produce cytokines in response to bacterial peptidoglycan and LPS via TLR2- and TLR4-dependent mechanisms. Human mast cells express mRNA for TLR1, TLR2, and TLR6 but not TLR4. Bacterial peptidoglycan and yeast zymosan are potent mast cell inducers of GM-CSF and IL-1beta and also triggered substantial short-term cysteinyl leukotriene generation. In contrast, a synthetic triacylated lipopeptide induced shortterm mast cell degranulation but failed to induce cysteinyl leukotriene production. These data demonstrate the highly selective production of different classes of mast cell mediators in response to distinct TLR agonists of potential importance in the host response to bacterial or fungal pathogens [99]. Lipoteichoic Acid Lipoteichoic acid (LTA) derived from Streptococcus pneumoniae and Staphylococcus aureus induces cytokine synthesis in human mononuclear phagocytes [100]. Activation of APC by LTA was shown to be LBP- and CD14- and TLR2 dependent [90,101].


225

Flagellin Flagellin, a principal protein component of bacterial flagella, is a virulence factor that is recognized by the innate immune system. It was shown recently that TLR5 recognizes bacterial flagellin from both Gram-positive and Gramnegative bacteria, resulting in mobilisation of NF-B and TNF production. Flagellin expression in non-flagellated E.coli conferred on the bacterium the ability to activate TLR5, whereas deletion of the flagellin genes from Salmonella typhimurium abrogated TLR5-stimulating activity. Therefore, TLR5 may have evolved to detect specifically flagellated bacterial pathogens [45,102]. Unmethylated CpG Containing Oligodeoxynucleotides Unmethylated CpG motifs are prevalent in bacterial, but not in vertebrate genomic DNAs. Oligodeoxynucleotides containing CpG motifs (CpG ODN) activate host defence mechanisms leading to innate and acquired immune responses. CpG induces a strong T-helper-1-like inflammatory response. Accumulating evidence has revealed the therapeutic potential of CpG DNA as adjuvants for vaccination strategies for cancer, allergy and infectious diseases. TLR9-deficient mice did not show any response to CpG DNA, in terms or mortality, production of systemic proinflammatory cytokines, and cell proliferation, matu-ration or inflammatory cytokine production. The in vivo CpGDNA-mediated T-helper type-1 response was also abolished in TLR9-deficient mice [103]. Heat shock protein 90 (hsp90) was shown to bind CpG DNA. Therefore, hsp90 might act as a ligand transfer molecule and/or play a central role in the signalling cascade induced by CpG DNA [104]. Taxol Taxol, which is used in the treatment of several cancers, is a LPS-mimetic recognising selectively CD14/TLR4 together with MD2 [105,106]. Induction of the entire panel of proinflammatory genes in macrophages in response to low concentrations of LPS or Taxol requires the participation of both CD14 and TLR4, whereas high concentrations of LPS or Taxol elicit the expression of a subset of LPS-inducible genes in the absence of CD14. For the expression of a full repertoire of LPS/Taxol-inducible genes, CD14, TLR4, and CD11b/CD18 must be co-ordinately engaged to deliver optimal signaling to the macrophage [106,107]. Imidazoquinoline The imidazoquinoline compounds imiquimod and R-848 are low-molecular-weight immune response modifiers that can induce the synthesis of interferon-alpha and other cytokines in a variety of cell types. These compounds have potent anti-viral and anti-tumour properties. However, the mechanisms by which they exert their anti-viral activities remain unclear. Imidazoquinolines activate immune cells via a TLR7-MyD88-dependent signalling pathway. In response to these compounds, neither MyD88- nor TLR7-deficient mice show any inflammatory cytokine production by macrophages, proliferation of splenocytes or maturation of dendritic cells [108].


4. TLR Modulation in Disease TLR signalling is involved in several disease conditions such as infection, where a rapid initiation of the innate immune response is critical for host defence. A role of TLR engagement has been demonstrates in systemic infection with bacteria, virus and fungi, septic shock, inflammatory disease including ulcerative colitis, Crohn’s disease, rheumatoid arthritis etc. In addition, TLR modulators might be effective immunoadjuvants in vaccine therapy, allergic disease such asthma, rhinitis and chronic lung disease such as chronic pulmonary obstructive disease (CPOD) and emphysema, and other diseases. Bacterial Infection, Septic Shock Absence of TLR recognition or signalling has been shown to be detrimental in several bacterial infections. More specifically infection with Gram-negative bacteria depends on TLR4, while infection with Gram-positive bacteria is largely TLR2 dependent, but may include TLR1 or TLR6 co-recognition [38]. Endotoxin from Gram-negative bacteria when released in large quantities results in a dramatic release of TNF and IFN causing shock [44,109,110]. Endotoxin mediated shock is mediated through CD14 and TLR4 signalling [111,112]. In experimental polymicrobial septic peritonitis induced by caecal ligation puncture both TLR2 and TLR4 were dispensable for host defence although MyD88-deficient mice were protected, displaying normal recruitment of neutrophils to the septic focus and normal bacterial clearance [113]. These results imply a central role of MyD88 for the systemic immune pathology of polymicrobial sepsis, which may be due to other TLRs beside TLR2 and TLR4 or to the IL-1 response. Several inhibitors of endotoxin shock have been developed such as antibodies to TNF and CD14 and TNF soluble receptors which were proved not to be efficacious in patients [87,114], therefore inhibition of TLR signalling might be an attractive alternative. Antisense polynucleotides to TIRAP have been claimed for treating diseases associated with TIRAP expression (206). Regulation at the level of TLR expression might be another possibility to prevent LPS toxicity as shown for macrophage inhibitory factor, MIF, which might downregulate TLR4 expression and thereby prevents LPS toxicity [115,116] (207). TLR antibodies, in particular, antibodies to TLR2, have been claimed for treating bacterial infection (208), but might enhance antigen presentation and enhance vaccine response [117]. Lipid Alike antagonists such as E5531 which inhibit TLR4-dependent cellular responses [118], represent novel approaches, but to which extent this other lipid analogue may inhibit septic shock is unclear. Human TLR analogue peptides and the corresponding coding nucleic acid sequence, antibodies, chimeric molecules and agonists/antagonists were claimed for septic shock (205). Other TLR4 analogues, based on cyclic nonapeptides of the endogenous ligand hsp60 have been claimed for the treatment of infectious, inflammatory or autoimmune diseases and graft rejection, although no biological data is presented (206).

Erard and Ryffel

Finally, CpG-induced activation of innate immunity through TLR9 protects against lethal challenge with a wide variety of pathogens [119]. Viral Infection The host response to viruses requires recognition by at least TLR2 and TLR3, a recently identified receptor for viral RNA [59,61,120-124]. Viruses have developed multiple strategies to escape the immune system including inhibition of chemokines and chemokine receptors [125,126]. The viral inhibitory proteins are an exciting field of research, and the relation to TLR and other PRR is not elucidated. Vaccinia virus (VV), the poxvirus used to vaccinate against smallpox, encodes proteins that antagonize important components of host antiviral defence. VV protein A52R associates with both IRAK-2 and TRAF6 and blocks the activation of NF-B induced by multiple TLRs, including TLR3 and thereby suppresses the host immunity [122]. In conclusion, viral infections elicit a rapid innate immune response via activation of TLR and likely other PRR, but viruses have developed strategies to evade immunosurveillance at several levels including TLR signalling. Immunoadjuvants in Vaccine Therapy Bacterial extracts derived from several bacteria including BCG consisting of highly unmethylated DNA was used for decades as immunostimulating agent [127]. Synthetic ODN comprising unmethylated CpG motifs bind and activate TLR9. Plasmacytoid dendritic cells (PDCs) and B cells express TLR9 and produce Th1-like proinflammatory cytokines, interferons, and chemokines upon CpG activation [128]. Certain CpG motifs (CpG-A) are especially potent at activating NK cells and inducing IFN-alpha production by PDCs, while other motifs (CpG-B) are potent B cell activators. CpG-induced activation of innate immunity has therapeutic activity in murine models of cancer and allergy, and enhances the development of acquired immune responses for prophylactic and therapeutic vaccination [119]. Double-stranded (ds) RNA motifs bind and activate TLR3, conferring strong immunomodulatory effects, and represent another class of potential adjuvants [129]. Asthma and Allergic Disease The incidence of allergy and asthma has almost doubled in the past two decades. Numerous epidemiological studies have linked the recent surge in atopic disease with decreased exposure to infections in early childhood as a result of a more westernized lifestyle. However, a clear mechanistic explanation for how this might occur is still lacking. An answer might lie in the presently unfolding story of various regulatory T-cell populations that can limit adaptive immune responses, including Th2 cell-mediated allergic airway disease [130]. Furthermore, exposure to LPS or other microbial products may influence the development and severity of asthma. Although it is known that signalling through TLRs is required for adaptive Th1 responses, recent


evidence suggest that low level inhaled LPS signalling through TLR4 is necessary to induce Th2 responses to inhaled antigens in a mouse model of allergic sensitization [131]. The mechanism by which low levels LPS signalling results in Th2 sensitization involves the activation of DC. By contrast, inhalation of high levels of LPS with antigen results in Th1 responses. Therefore, the level of LPS exposure may determine the type of inflammatory response generated and provide a potential mechanistic explanation of epidemiological data on endotoxin exposure and asthma prevalence [131]. For allergic diseases including asthma TLR agonists inducing a Th1 response may reduce allergy as shown with BCG [127,132]. Unmethylated DNA, ODN CpG, has been shown to have immunomodulatory effects, stimulating a strong Th1 response and thereby suppressing allergic responses [119]. CpG, but not LPS, induces T-bet expression in B cells in a TLR9 and MyD88 dependent fashion [133]. Furthermore, CpG inhibited IgG1 and IgE class switching induced by IL-4 and CD40 signalling in purified B cells. Thus, CpG triggers anti-allergic immune responses by directly regulating T-bet expression via a signalling pathway in B cells that is dependent upon TLR9, but appears independent of IFN-STAT1 and synergistic with IL-12 [133]. CONCLUSION Blockade or activation of individual TLRs or modulation of TLR signalling may have profound effects on innate immunity, host resistance and the pathogenesis of several diseases. Agonists or antagonists of specific TLRs have effects beyond infectious control and may represent a novel therapeutics for immunostimulation in vaccine, cancer, inflammatory disorders and allergy. Targeting of TLR2 with lipopeptides and other agonists may increase natural resistance to Gram-positive bacterial infections and to mycobacteria. TLR3 agonists such as dsRNA and synthetic analogues stimulate IFN production by plasmacytoid DCs and may represent extremely valuable therapeutics for vaccine development, viral infection and cancer. TLR4 agonists such as natural and synthetic lipid A analogues devoid of the toxic moiety of LPS are already successfully used as adjuvants in vaccines. TLR4 antagonists may play a role in septic shock. Targeting of the TLR5, the flagellin receptor, may prevent the invasion and hence virulence of flagellated bacteria. TLR5 activation may protect from irradiation injury and allow a better tolerability of therapeutic irradiation.


specificity such as lipid A analogues and imidazoquinolines derivatives. In summary, there is experimental evidence that activation of the innate immune system by TLR ligation may have profound effects on the immune response of the host and hence on disease. Therefore, TLRs and TLR signalling pathways represent powerful targets for novel therapeutics, and may contribute to treat infectious disease, cancer, allergy, autoimmune disease and in vaccine development. Depending on the clinical situation either enhancement or inhibition of a specific TLR system may be beneficial. REFERENCES [1] [2] [3]

[4]

[5] [6] [7] [8] [9]

[10]

[11]

[12]

[13] [14]

[15]

TLR7 and TLR8 agonists such as the small molecular weight compounds imidazoquinoline are interesting leads for immunomodulators with a different bioavailability. Unmethylated CpG ODNs represent a novel class of TLR9 agonists with potent anti-allergic and immunoadjuvant properties, which have a great promise in allergy, cancer and vaccine therapy. A note of caution in applying the knowledge from mice to man however needs to be made, as there is evidence that the recognition of several TLR ligands have some species

227

[16]

[17]

[18]

Medzhitov, R.; Janeway, C.A.Jr. Innate immunity: impact on the adaptive immune response. Curr. Opin Immunol., 1997, 9,4-9. Medzhitov, R.; Preston-Hurlburt, P.; Janeway, C.A. Jr. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature, 1997, 388,394-397. Lemaitre, B.; Reichhart, J.M.; Hoffmann, J.A. Drosophila host defense: differential induction of antimicrobial peptide genes after infection by various classes of microorganisms. Proc. Natl. Acad. Sci. USA, 1997, 94,14614-14619. Lemaitre, B.; Nicolas, E.; Michaut, L.; Reichhart, J.M.; Hoffmann, J.A. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell, 1996, 86, 973-983. Akira, S. Mammalian Toll-like receptors. Curr. Opin. Immunol., 2003, 15, 5-11. Medzhitov, R.; Biron, C.A. Innate immunity. Curr. Opin. Immunol., 2003, 15, 2-4. Medzhitov, R. Toll-like receptors and innate immunity. Nat. Rev. Immunol., 2001, 1,135-145. Underhill, D.M. Mini-review Toll-like receptors: networking for success. Eur. J. Immunol., 2003, 33,1767-1775. Stenger, S.; Modlin, R.L. Control of Mycobacterium tuberculosis through mammalian Toll-like receptors. Curr. Opin. Immunol., 2002, 14, 452-457. Muzio, M.; Bosisio, D.; Polentarutti, N.; D'Amico, G. Stoppacciaro A, Mancinelli R, van't Veer C, Penton-Rol G, Ruco LP, Allavena P, Mantovani A: Differential expression and regulation of toll-like receptors (TLR) in human leukocytes: selective expression of TLR3 in dendritic cells. J. Immunol., 2000, 164, 5998-6004. Thoma-Uszynski, S.; Stenger, S.; Takeuchi, O.; Ochoa, M.T.; Engele, M,; Sieling, P.A.; Barnes, P.F.; Rollinghoff, M.; Bolcskei, P.L.; Wagner, M.; Akira, S.; Norgard, M.V.; Belisle, J.T.; Godowski, P.J.; Bloom, B.R.; Modlin, R.L. Induction of direct antimicrobial activity through mammalian toll-like receptors. Science, 2001, 291, 1544-1547. Aliprantis, A.O.; Yang, R.B.; Mark, M.R.; Suggett, S.; Devaux, B.; Radolf, J.D.; Klimpel, G.R.; Godowski, P.; Zychlinsky, A. Cell activation and apoptosis by bacterial lipoproteins through toll-like receptor-2. Science, 1999, 285, 736-739. Akira, S.; Yamamoto, M.; Takeda, K. Role of adapters in Toll-like receptor signalling. Biochem. Soc. Trans, 2003, 31, 637-642. Horng, T.; Barton, G.M.; Flavell, R.A.; Medzhitov, R. The adaptor molecule TIRAP provides signalling specificity for Toll-like receptors. Nature, 2002, 420, 329-333. Yamamoto, M.; Sato, S.; Hemmi, H.; Sanjo, H.; Uematsu, S.; Kaisho, T.; Hoshino, K.; Takeuchi, O.; Kobayashi, M.; Fujita, T.; Takeda, K.; Akira, S. Essential role for TIRAP in activation of the signalling cascade shared by TLR2 and TLR4. Nature, 2002, 420, 324-329. O'Neill, L.A.; Fitzgerald, K.A.; Bowie, A.G. The Toll-IL-1 receptor adaptor family grows to five members. Trends Immunol., 2003, 24, 286-289. Oshiumi, H.; Matsumoto, M.; Funami, K.; Akazawa, T.; Seya, T.; TICAM-1, an adaptor molecule that participates in Toll-like receptor 3-mediated interferon-beta induction. Nat. Immunol., 2003, 4, 161-167. Yamamoto, M.; Sato, S.; Mori, K.; Hoshino, K.; Takeuchi, O.; Takeda, K.; Akira, S. Cutting edge: a novel Toll/IL-1 receptor


[19]

[20] [21]

[22] [23]

[24]

[25]

[26]

[27]

[28]

[29] [30]

[31]

[32]

[33]

[34] [35]

[36] [37]

domain-containing adapter that preferentially activates the IFNbeta promoter in the Toll-like receptor signaling. J. Immunol., 2002, 169, 6668-6672. Yamamoto, M.; Sato, S.; Hemmi, H.; Hoshino, K.; Kaisho, T.; Sanjo, H.; Takeuchi, O.; Sugiyama, M.; Okabe, M.; Takeda, K.; Akira, S. Role of Adaptor TRIF in the MyD88-Independent TollLike Receptor Signaling Pathway. Science, 2003. Kobayashi, K.; Hernandez, L.D.; Galan, J.E.; Janeway, C.A. Jr.; Medzhitov, R.; Flavell, R.A. IRAK-M is a negative regulator of Toll-like receptor signaling. Cell, 2002, 110, 191-202. Suzuki, N.; Suzuki, S.; Duncan, G.S.; Millar, D.G.; Wada, T.; Mirtsos, C.; Takada, H.; Wakeham, A.; Itie, A.; Li, S.; Penninger, J.M.; Wesche, H.; Ohashi, P.S.; Mak, T.W.; Yeh, W.C. Severe impairment of interleukin-1 and Toll-like receptor signalling in mice lacking IRAK-4. Nature, 2002, 416, 750-756. Janssens, S.; Beyaert, R. Functional diversity and regulation of different interleukin-1 receptor-associated kinase (IRAK) family members. Mol. Cell, 2003, 11, 293-302. Chamaillard, M.; Hashimoto, M.; Horie, Y.; Masumoto, J.; Qiu, S.; Saab, L.; Ogura, Y.; Kawasaki, A.; Fukase, K.; Kusumoto, S.; Valvano, M.A.; Foster, S.J.; Mak, T.W.; Nunez, G.; Inohara, N. An essential role for NOD1 in host recognition of bacterial peptidoglycan containing diaminopimelic acid. Nat. Immunol., 2003, 4,702-707. Tailleux, L.; Schwartz, O.; Herrmann, J. L.; Pivert, E.; Jackson, M.; Amara, A.; Legres, L.; Dreher, D.; Nicod, L. P.; Gluckman, J.C.; Lagrange, P.H.; Gicquel, B.; Neyrolles, O. DC-SIGN is the major Mycobacterium tuberculosis receptor on human dendritic cells. J. Exp. Med., 2003, 197, 121-127. Maeda, N.; Nigou, J.; Herrmann, J.L.; Jackson, M.; Amara, A.; Lagrange, P.H.; Puzo, G.; Gicquel, B.; Neyrolles, O. The cell surface receptor DC-SIGN discriminates between Mycobacterium species through selective recognition of the mannose caps on lipoarabinomannan. J. Biol. Chem., 2003, 278, 5513-5516. Geijtenbeek, T.B.; Van Vliet, S.J.; Koppel, E.A.; SanchezHernandez, M.; Vandenbroucke-Grauls, C.M.; Appelmelk, B.; Van Kooyk, Y. Mycobacteria target DC-SIGN to suppress dendritic cell function. J. Exp. Med., 2003, 197, 7-17. Lee, S.J.; Zheng, N.Y.; Clavijo, M.; Nussenzweig, M.C. Normal host defense during systemic candidiasis in mannose receptordeficient mice. Infect. Immun., 2003, 71, 437-445. Lee, S.J.; Evers, S.; Roeder, D.; Parlow, A.F.; Risteli, J.; Risteli, L.; Lee, Y.C.; Feizi, T.; Langen, H.; Nussenzweig, M.C. Mannose receptor-mediated regulation of serum glycoprotein homeostasis. Science, 2002, 295, 1898-1901. Platt, N.; Haworth, R.; Darley, L.; Gordon, S. The many roles of the class A macrophage scavenger receptor. Int. Rev. Cytol., 2002, 212,1-40. Peiser, L.; De, Winther, M.P.; Makepeace, K.; Hollinshead, M.; Coull, P.; Plested, J.; Kodama, T.; Moxon, E.R.; Gordon, S. The class A macrophage scavenger receptor is a major pattern recognition receptor for Neisseria meningitidis which is independent of lipopolysaccharide and not required for secretory responses. Infect Immun., 2002, 70, 5346-5354. Platt, N.; Suzuki, H.; Kurihara, Y.; Kodama, T.; Gordon, S. Role for the class A macrophage scavenger receptor in the phagocytosis of apoptotic thymocytes in vitro. Proc. Natl. Acad. Sci. USA, 1996, 93, 12456-12460. Brown, G.D.; Herre, J.; Williams, D.L.; Willment, J.A.; Marshall, A.S.; Gordon, S. Dectin-1 mediates the biological effects of {beta}glucans. J. Exp. Med., 2003, 197, 1119-1124. Gantner, B.N.; Simmons, R.M.; Canavera, S.J.; Akira, S.; Underhill, D.M. Collaborative induction of inflammatory responses by dectin-1 and toll-like receptor 2. J. Exp. Med., 2003, 197, 11071117. Beutler, B. TLR4 as the mammalian endotoxin sensor. Curr. Top. Microbiol. Immunol., 2002, 270,109-120. Means, T.K.; Lien, E.; Yoshimura, A.; Wang, S.; Golenbock, D.T.; Fenton, M.J. The CD14 ligands lipoarabinomannan and lipopolysaccharide differ in their requirement for Toll-like receptors. J. Immunol., 1999, 163, 6748-6755. Akira, S.; Uematsu, S.; Takeuchi, O. Pathogen recognition and innate immunity. Cell, 2006, 124, 783-801. Poltorak. A.; He, X.; Smirnova, I.; Liu, M.Y.; Van Huffel, C.; Du, X.; Birdwell, D.; Alejos, E.; Silva, M.; Galanos, C.; Freudenberg, M.; Ricciardi-Castagnoli, P.; Layton, B.; Beutler, B. Defective LPS

Erard and Ryffel

[38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50] [51]

[52]

[53]

[54]

signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science, 1998, 282, 2085-2088. Takeuchi, O.; Hoshino, K.; Kawai, T.; Sanjo, H.; Takada, H.; Ogawa, T.; Takeda, K.; Akira, S. Differential roles of TLR2 and TLR4 in recognition of gram-negative and gram-positive bacterial cell wall components. Immunity, 1999, 11, 443-451. Seki, E.; Tsutsui, H.; Tsuji, N.M.; Hayashi, N.; Adachi, K.; Nakano, H.; Futatsugi-Yumikura, S.; Takeuchi, O.; Hoshino, K.; Akira, S.; Fujimoto, J.; Nakanishi, K. Critical roles of myeloid differentiation factor 88-dependent proinflammatory cytokine release in early phase clearance of Listeria monocytogenes in mice. J. Immunol., 2002, 169, 3863-3868. Edelson, B.T.; Unanue, E.R. MyD88-dependent but Toll-like receptor 2-independent innate immunity to Listeria: no role for either in Macrophage listericidal activity. J. Immunol., 2002, 169, 3869-3875. Torres, D.; Barrier, M.; Bihl, F.; Quesniaux, V.J.; Maillet, I.; Akira, S.; Ryffel, B.; Erard, F.; Toll-Like Receptor 2 Is Required for Optimal Control of Listeria monocytogenes Infection. Infect. Immun., 2004, 72, 2131-2139. Janot, L.; Secher, T.; Torres, D.; Maillet, I.; Pfeilschifter, J.; Quesniaux, V.F.; Landmann, R.; Ryffel, B.; Erard, F. CD14 Works with toll-like receptor 2 to contribute to recognition and control of listeria monocytogenes infection. J. Infect. Dis., 2008, 198, 115124. Yang, K.K.; Dorner, B.G.; Merkel, U.; Ryffel, B.; Schutt, C.; Golenbock, D.; Freeman, M.W.; Jack, R.S. Neutrophil influx in response to a peritoneal infection with Salmonella is delayed in lipopolysaccharide-binding protein or CD14-deficient mice. J. Immunol., 2002, 169, 4475-4480. Bihl, F.; Salez, L.; Beaubier, M.; Torres, D.; Lariviere, L.; Laroche, L.; Benedetto, A.; Martel, D.; Lapointe, J.M.; Ryffel, B.; Malo, D. Overexpression of toll-like receptor 4 amplifies the host response to lipopolysaccharide and provides a survival advantage in transgenic mice. J. Immunol., 2003, 170, 6141-6150. Hayashi, F.; Smith, K.D.; Ozinsky, A.; Hawn, T.R.; Yi, E.C.; Goodlett, D.R.; Eng, J.K.; Akira, S.; Underhill, D.M.; Aderem, A. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature, 2001, 410, 1099-1103. Feuillet, V.; Medjane, S.; Mondor, I.; Demaria, O.; Pagni, P.P.; Galan, J.E.; Flavell, R.A.; Alexopoulou, L. Involvement of Tolllike receptor 5 in the recognition of flagellated bacteria. Proc. Natl. Acad. Sci. USA, 2006, 103, 12487-12492. Burdelya, L.G.; Krivokrysenko, V.I.; Tallant, T.C.; Strom, E.; Gleiberman, A.S.; Gupta, D.; Kurnasov, O.V.; Fort, F.L.; Osterman, A.L.; Didonato, J.A.; Feinstein, E.; Gudkov, A.V. An agonist of toll-like receptor 5 has radioprotective activity in mouse and primate models. Science, 2008, 320, 226-230. Rakoff-Nahoum, S.; Paglino, J.; Eslami-Varzaneh, F.; Edberg, S.; Medzhitov, R.; Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis. Cell, 2004, 118, 229-241. Rakoff-Nahoum, S.; Medzhitov, R. Role of the innate immune system and host-commensal mutualism. Curr. Top Microbiol. Immunol., 2006, 308, 1-18. Plitas, G.; Burt, B.M.; Nguyen, H.M.; Bamboat, Z.M.; DeMatteo, R.P. Toll-like receptor 9 inhibition reduces mortality in polymicrobial sepsis. J. Exp. Med., 2008, 205, 1277-1283. Quesniaux, V.; Fremond, C.; Jacobs, M.; Parida, S.; Nicolle, D.; Yeremeev, V.; Bihl ,F.; Erard, F.; Botha, T.; Drennan, M.; Soler, M.N.; Le Bert, M.; Schnyder, B.; Ryffel, B. Toll-like receptor pathways in the immune responses to mycobacteria. Microbes Infect., 2004, 6, 946-959. Abel, B.; Thieblemont, N.; Quesniaux, V.J.; Brown, N.; Mpagi, J.; Miyake, K.; Bihl, F.; Ryffel, B. Toll-like receptor 4 expression is required to control chronic Mycobacterium tuberculosis infection in mice. J. Immunol., 2002, 169, 3155-3162. Drennan, M.B.; Nicolle, D.; Quesniaux, V.J.; Jacobs, M.; Allie, N.; Mpagi, J.; Fremond, C.; Wagner, H.; Kirschning, C.; Ryffel, B. Toll-Like Receptor 2-Deficient Mice Succumb to Mycobacterium tuberculosis Infection. Am. J. Pathol., 2004, 164, 49-57. Reiling, N.; Holscher, C.; Fehrenbach, A.; Kroger, S.; Kirschning, C.J.; Goyert, S.; Ehlers, S. Cutting edge: Toll-like receptor (TLR)2and TLR4-mediated pathogen recognition in resistance to airborne infection with Mycobacterium tuberculosis. J. Immunol., 2002, 169, 3480-3484.

Toll Like Receptor - Potential Drug Targets in Infectious Disease [55]

[56]

[57]

[58]

[59] [60]

[61]

[62] [63]

[64]

[65]

[66] [67]

[68]

[69]

[70]

[71]

[72]

Fremond, C.; Yeremeev, V.; Nicolle, D.; Jacobs, M.; VJF, Q.; Ryffel, B. Fatal Mycobacterium tuberculosis infection despite adaptive immune response in the absence of MyD88. J. Clin. Invest., 2004, in press. Jones, B.W.; Means, T.K.; Heldwein, K.A.; Keen, M.A.; Hill, P.J.; Belisle, J.T.; Fenton, M.J. Different Toll-like receptor agonists induce distinct macrophage responses. J. Leukoc. Biol., 2001, 69, 1036-1044. Gilleron, M.; Quesniaux, V.F.; Puzo, G. Acylation state of the phosphatidylinositol hexamannosides from Mycobacterium bovis bacillus Calmette Guerin and Mycobacterium tuberculosis H37Rv and its implication in Toll-like receptor response. J. Biol. Chem., 2003, 278, 29880-29889. Doz, E.; Rose, S.; Nigou, J.; Gilleron, M.; Puzo, G.; Erard, F.; Ryffel, B.; Quesniaux, V.F. Acylation determines the toll-like receptor (TLR)-dependent positive versus TLR2-, mannose receptor-, and SIGNR1-independent negative regulation of proinflammatory cytokines by Mycobacterial lipomannan. J Biol Chem 2007, 282:26014-26025. Alexopoulou L, Holt AC, Medzhitov R, Flavell RA: Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature, 2001, 413, 732-738. Le Goffic, R.; Balloy, V.; Lagranderie, M.; Alexopoulou, L.; Escriou, N.; Flavell, R.; Chignard, M.; Si-Tahar, M. Detrimental contribution of the Toll-like receptor (TLR)3 to influenza A virusinduced acute pneumonia. PLoS Pathog., 2006, 2, e53. Haeberle, H.A.; Takizawa, R.; Casola, A.; Brasier, A.R.; Dieterich, H.J.; Van Rooijen, N.; Gatalica, Z.; Garofalo, R.P. Respiratory syncytial virus-induced activation of nuclear factor-kappaB in the lung involves alveolar macrophages and toll-like receptor 4dependent pathways. J. Infect. Dis., 2002, 186, 1199-1206. Lebron, F.; Vassallo, R.; Puri, V.; Limper, A.H. Pneumocystis carinii cell wall beta-glucans initiate macrophage inflammatory responses through NF-kB activation. J. Biol. Chem., 2003. Taylor, P.R.; Tsoni. S.V.; Willment, J.A.; Dennehy, K.M.; Rosas, M.; Findon, H.; Haynes, K.; Steele, C.; Botto, M.; Gordon, S.; Brown, G.D Dectin-1 is required for beta-glucan recognition and control of fungal infection. Nat. Immunol., 2007, 8, 31-38. Netea, M.G.; Van Der Graaf, C.A.; Vonk , A.G.; Verschueren, I.; Van Der Meer, J.W.; Kullberg, B.J. The role of toll-like receptor (TLR) 2 and TLR4 in the host defense against disseminated candidiasis. J. Infect. Dis., 2002, 185, 1483-1489. Netea, M.G.; Brown, G.D.; Kullberg, B.J.; Gow, N.A. An integrated model of the recognition of Candida albicans by the innate immune system. Nat. Rev. Microbiol., 2008, 6, 67-78. Willment, J.A.; Brown, G.D. C-type lectin receptors in antifungal immunity. Trends Microbiol., 2008, 16, 27-32. Scanga, C.A.; Aliberti, J.; Jankovic, D.; Tilloy, F.; Bennouna, S.; Denkers, E.Y.; Medzhitov, R.; Sher, A.; Cutting, e.d.g.e. MyD88 is required for resistance to Toxoplasma gondii infection and regulates parasite-induced IL-12 production by dendritic cells. J. Immunol., 2002, 168, 5997-6001. Aliberti, J.; Valenzuela, J.G.; Carruthers, V.B.; Hieny, S.; Andersen, J.; Charest, H.; Reis, E.; Sousa, C.; Fairlamb, A.; Ribeiro, J.M.; Sher, A. Molecular mimicry of a CCR5 bindingdomain in the microbial activation of dendritic cells. Nat. Immunol., 2003, 4, 485-490. Minns, L.A.; Menard, L.C.; Foureau, D.M.; Darche, S.; Ronet, C.; Mielcarz, D.W.; Buzoni-Gatel, D.; Kasper, L.H. TLR9 is required for the gut-associated lymphoid tissue response following oral infection of Toxoplasma gondii. J. Immunol., 2006, 176,7589-7597. Coelho, P.S.; Klein, A.; Talvani, A.; Coutinho, S.F.; Takeuchi, O.; Akira, S. Silva, J.S.; Canizzaro, H.; Gazzinelli, R.T.; Teixeira, M.M. Glycosylphosphatidylinositol-anchored mucin-like glycoproteins isolated from Trypanosoma cruzi trypomastigotes induce in vivo leukocyte recruitment dependent on MCP-1 production by IFN-gamma-primed-macrophages. J. Leukoc. Biol., 2002, 71, 837844. Magez, S.; Stijlemans, B.; Baral, T.; De Baetselier, P. VSG-GPI anchors of African trypanosomes: their role in macrophage activation and induction of infection-associated immunopathology. Microbes. Infect., 2002, 4,999-1006. Adachi, K.; Tsutsui, H.; Kashiwamura, S.; Seki, E.; Nakano, H.; Takeuchi, O.; Takeda, K.; Okumura, K.; Van Kaer, L.; Okamura, H.; Akira, S.; Nakanishi, K. Plasmodium berghei infection in mice induces liver injury by an IL-12- and toll-like receptor/myeloid


[73]

[74]

[75]

[76]

[77]

[78]

[79]

[80]

[81]

[82]

[83]

[84] [85]

[86] [87] [88]

[89]

[90]

229

differentiation factor 88-dependent mechanism. J. Immunol., 2001, 167, 5928-5934. Togbe, D.; Schofield, L.; Grau, G.E.; Schnyder, B.; Boissay, V.; Charron, S.; Rose, S.; Beutler, B.; Quesniaux, V.F.; Ryffel, B. Murine cerebral malaria development is independent of toll-like receptor signaling. Am. J. Pathol., 2007, 170, 1640-1648. Bulut, Y.; Faure, E.; Thomas, L.; Karahashi, H.; Michelsen, K.S.; Equils, O.; Morrison, S.G.; Morrison, R.P.; Arditi, M. Chlamydial heat shock protein 60 activates macrophages and endothelial cells through Toll-like receptor 4 and MD2 in a MyD88-dependent pathway. J. Immunol., 2002, 168, 1435-1440. Costa, C.P.; Kirschning, C.J.; Busch, D.; Durr, S.; Jennen, L.; Heinzmann, U.; Prebeck, S.; Wagner, H.; Miethke, T. Role of chlamydial heat shock protein 60 in the stimulation of innate immune cells by Chlamydia pneumoniae. Eur.J. Immunol., 2002, 32,2460-2470. Vabulas, R.M.; Ahmad-Nejad, P.; Ghose, S.; Kirschning, C.J.; Issels, R.D.; Wagner, H. HSP70 as endogenous stimulus of the Toll/interleukin-1 receptor signal pathway. J. Biol. Chem., 2002, 277, 15107-15112. Kirschning, C.J.; Schumann, R.R. TLR2: cellular sensor for microbial and endogenous molecular patterns. Curr. Top Microbiol. Immunol., 2002, 270,121-144. Asea, A.; Rehli, M.; Kabingu, E.; Boch, J.A.; Bare, O.; Auron, P.E.; Stevenson, M.A.; Calderwood, S.K. Novel signal transduction pathway utilized by extracellular HSP70: role of toll-like receptor (TLR) 2 and TLR4. J. Biol. Chem., 2002, 277,15028-15034. Habich, C.; Baumgart, K.; Kolb, H.; Burkart, V. The receptor for heat shock protein 60 on macrophages is saturable, specific, and distinct from receptors for other heat shock proteins. J. Immunol., 2002, 168, 569-576. Aosai, F.; Chen, M.; Kang, H.K.; Mun, H.S.; Norose, K.; Piao, L.X.; Kobayashi, M.; Takeuchi, O.; Akira, S.; Yano, A. Toxoplasma gondii-derived heat shock protein HSP70 functions as a B cell mitogen. Cell Stress Chaperones, 2002, 7,357-364. Tsutsumi-Ishii, Y.; Nagaoka, I. Modulation of Human betaDefensin-2 Transcription in Pulmonary Epithelial Cells by Lipopolysaccharide-Stimulated Mononuclear Phagocytes Via Proinflammatory Cytokine Production. J. Immunol., 2003, 170, 4226-4236. Biragyn, A.; Ruffini, P.A.; Leifer, C.A.; Klyushnenkova, E.; Shakhov, A.; Chertov, O.; Shirakawa, A.K.; Farber, J.M.; Segal, D.M.; Oppenheim, J.J.; Kwak, L.W. Toll-like receptor 4-dependent activation of dendritic cells by beta-defensin 2. Science, 2002, 298, 1025-1029. Termeer, C.; Benedix, F.; Sleeman, J.; Fieber, C.; Voith, U.; Ahrens, T.; Miyake, K.; Freudenberg, M.; Galanos, C.; Simon, J.C. Oligosaccharides of Hyaluronan activate dendritic cells via toll-like receptor 4. J. Exp. Med., 2002, 195, 99-111. Termeer, C.; Sleeman, J.P.; Simon, J.C. Hyaluronan - magic glue for the regulation of the immune response? Trends Immunol., 2003, 24,112-114. Teder, P.; Vandivier, R.W.; Jiang, D.; Liang, J.; Cohn, L.; Pure, E.; Henson, P.M.; Noble, P.W. Resolution of lung inflammation by CD44. Science, 2002, 296,155-158. Matzinger, P. The danger model: a renewed sense of self. Science, 2002, 296, 301-305. Ulevitch, R.J.; Tobias, P.S. Recognition of gram-negative bacteria and endotoxin by the innate immune system. Curr. Opin. Immunol., 1999, 11,19-22. Kawai, T.; Takeuchi, O.; Fujita, T.; Inoue, J.; Muhlradt, P.F.; Sato, S.; Hoshino, K.; Akira, S. Lipopolysaccharide stimulates the MyD88-independent pathway and results in activation of IFNregulatory factor 3 and the expression of a subset of lipopolysaccharide-inducible genes. J. Immunol., 2001, 167, 5887-5894. Muta, T.; Takeshige, K. Essential roles of CD14 and lipopolysaccharide-binding protein for activation of toll-like receptor (TLR)2 as well as TLR4 Reconstitution of TLR2- and TLR4activation by distinguishable ligands in LPS preparations. Eur. J. Biochem., 2001, 268, 4580-4589. Schroder, N.W.; Morath, S.; Alexander, C.; Hamann, L.; Hartung, T.; Zahringer, U.; Gobel, U.B.; Weber, J.R.; Schumann, R.R. Lipoteichoic acid (LTA) of Streptococcus pneumoniae and Staphylococcus aureus activates immune cells via Toll-like receptor (TLR)-2, lipopolysaccharide-binding protein (LBP), and


[91]

[92]

[93]

[94]

[95]

[96]

[97]

[98]

[99]

[100]

[101]

[102]

[103]

[104]

[105]

[106]

[107]

CD14, whereas TLR-4 and MD-2 are not involved. J. Biol. Chem., 2003, 278, 15587-15594. Ogawa, T.; Asai, Y.; Sakai, Y.; Oikawa, M.; Fukase, K.; Suda, Y.; Kusumoto, S.; Tamura, T. Endotoxic and immunobiological activities of a chemically synthesized lipid A of Helicobacter pylori strain 206-1. FEMS Immunol. Med. Microbiol., 2003, 36, 1-7 Lagadec ,P.; Raynal, S.; Lieubeau, B.; Onier, N.; Arnould, L.; Saint-Giorgio, V.; Lawrence, D.A.; Jeannin, J.F. Evidence for control of nitric oxide synthesis by intracellular transforming growth factor-beta1 in tumor cells. Implications for tumor development. Am. J. Pathol., 1999, 154, 1867-1876. Onier, N.; Hilpert, S.; Reveneau, S.; Arnould, L.; Saint-Giorgio, V.; Exbrayat, J.M.; Jeannin, J.F. Expression of inducible nitric oxide synthase in tumors in relation with their regression induced by lipid A in rats. Int. J. Cancer, 1999, 81, 755-760. Onier, N.; Hilpert, S.; Arnould, L.; Saint-Giorgio, V.; Davies, J.G.; Jeannin, J.F. Cure of colon cancer metastasis in rats with the new lipid A OM 174. Apoptosis of tumor cells and immunization of rats. Clin. Exp. Metastasis, 1999, 17, 299-306. Thoma-Uszynski, S.; Kiertscher, S.M.; Ochoa, M.T.; Bouis, D.A.; Norgard, M.V.; Miyake, K.; Godowski, P.J.; Roth, M.D.; Modlin, R.L. Activation of toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10. J. Immunol., 2000, 165, 3804-3810. Takeuchi, O.; Kawai, T.; Muhlradt, P.F.; Morr, M.; Radolf, J.D.; Zychlinsky, A.; Takeda, K.; Akira, S. Discrimination of bacterial lipoproteins by Toll-like receptor 6. Int. Immunol. 2001, 13: 933940. Morr M, Takeuchi O, Akira S, Simon MM, Muhlradt PF: Differential recognition of structural details of bacterial lipopeptides by toll-like receptors. Eur. J. Immunol., 2002, 32, 3337-3347. Takeuchi, O.; Sato, S.; Horiuchi, T.; Hoshino, K.; Takeda, K.; Dong, Z.; Modlin, R.L.; Akira, S. Cutting edge: role of Toll-like receptor 1 in mediating immune response to microbial lipoproteins. J. Immunol., 2002, 169, 10-14. McCurdy, J.D.; Olynych, T.J.; Maher, L.H.; Marshall, J.S. Cutting edge: distinct Toll-like receptor 2 activators selectively induce different classes of mediator production from human mast cells. J. Immunol., 2003, 170, 625-1629. Roethlisberger, P.; Iida-Tanaka, N.; Hollemeyer, K.; Heinzle, E.; Ishizuka, I.; Fischer, W. Unique poly(glycerophosphate) lipoteichoic acid and the glycolipids of a Streptococcus sp. closely related to Streptococcus pneumoniae. Eur. J. Biochem., 2000, 267, 5520-5530. Schwarz, K.; Storni, T.; Manolova, V.; Didierlaurent, A.; Sirard, J.C.; Rothlisberger, P.; Bachmann, M.F. Role of Toll-like receptors in costimulating cytotoxic T cell responses. Eur. J. Immunol., 2003, 33, 465-1470. Means, T.K.; Hayashi, F.; Smith, K.D.; Aderem, A.; Luster, A.D. The Toll-like receptor 5 stimulus bacterial flagellin induces maturation and chemokine production in human dendritic cells. J. Immunol., 2003, 170, 5165-5175. Hemmi, H.; Takeuchi, O.; Kawai, T.; Kaisho, T.; Sato, S.; Sanjo, H.; Matsumoto, M.; Hoshino, K.; Wagner, H.; Takeda, K.; Akira, S. A Toll-like receptor recognizes bacterial DNA. Nature, 2000, 408, 740-745. Bandholtz, L.; Guo, Y.; Palmberg, C.; Mattsson, K.; Ohlsson, B.; High, A.; Shabanowitz, J.; Hunt, D. F.; Jornvall, H.; Wigzell, H.; Agerberth, B.; Gudmundsson, G.H. Hsp90 binds CpG oligonucleotides directly: implications for hsp90 as a missing link in CpG signaling and recognition. Cell Mol. Life Sci., 2003, 60, 422429. Kawasaki, K.; Nogawa, H.; Nishijima, M. Identification of mouse MD-2 residues important for forming the cell surface TLR4-MD-2 complex recognized by anti-TLR4-MD-2 antibodies, and for conferring LPS and taxol responsiveness on mouse TLR4 by alanine-scanning mutagenesis. J. Immunol., 2003, 170, 413-420. Wang, J.; Kobayashi, M.; Han, M.; Choi, S.; Takano, M.; Hashino, S.; Tanaka, J.; Kondoh, T.; Kawamura, K.; Hosokawa, M. MyD88 is involved in the signalling pathway for Taxol-induced apoptosis and TNF-alpha expression in human myelomonocytic cells. Br. J. Haematol., 2002, 118,638-645. Perera, P.Y.; Mayadas, T.N.; Takeuchi, O.; Akira, S.; ZaksZilberman, M.; Goyert, S.M.; Vogel, S.N. CD11b/CD18 acts in concert with CD14 and Toll-like receptor (TLR) 4 to elicit full

Erard and Ryffel

[108]

[109]

[110]

[111] [112] [113]

[114] [115] [116]

[117]

[118]

[119] [120]

[121]

[122]

[123]

[124]

[125] [126] [127]

lipopolysaccharide and taxol-inducible gene expression. J. Immunol., 2001, 166, 574-581. Hemmi, H.; Kaisho, T.; Takeuchi, O.; Sato, S.; Sanjo, H.; Hoshino, K.; Horiuchi, T.; Tomizawa, H.; Takeda, K.; Akira, S. Small antiviral compounds activate immune cells via the TLR7 MyD88dependent signaling pathway. Nat. Immunol., 2002, 3, 196-200. Car, B.D.; Eng, V.M.; Schnyder, B.; LeHir, M.; Shakhov, A.N.; Woerly, G.; Huang, S.; Aguet, M.; Anderson, T.D.; Ryffel, B. Role of interferon-gamma in interleukin 12-induced pathology in mice. Am. J. Pathol., 1995, 147, 1693-1707. Gutierrez-Ramos, J.C.; Bluethmann, H. Molecules and mechanisms operating in septic shock: lessons from knockout mice. Immunol. Today, 1997, 18, 329-334. Beutler, B. Innate immune sensing of microbial infection: the mechanism and the therapeutic challenge. Wien Med. Wochenschr., 2002, 152, 547-551. Beutler, B. Endotoxin antagonism: conceptual basis and therapeutic potential. Expert Opin. Ther. Targets, 2002, 6, 147-158. Weighardt, H.; Kaiser-Moore, S.; Vabulas, R.M.; Kirschning, C.J.; Wagner, H.; Holzmann, B. Cutting edge: myeloid differentiation factor 88 deficiency improves resistance against sepsis caused by polymicrobial infection. J. Immunol., 2002, 169, 2823-2827. Ulevitch, R.J. New therapeutic targets revealed through investigations of innate immunity. Crit. Care Med., 2001, 29, S8-12. Calandra, T.; Bochud, P.Y.; Heumann, D. Cytokines in septic shock. Curr. Clin. Top Infect. Dis., 2002, 22, 1-23. Roger, T.; David, J.; Glauser, M.P.; Calandra, T. MIF regulates innate immune responses through modulation of Toll-like receptor 4. Nature, 2001, 414, 920-924. Schjetne, K.W.; Thompson, K.M.; Nilsen, N.; Flo, T.H.; Fleckenstein, B.; Iversen, J.G.; Espevik, T.; Bogen, B. Cutting edge: Link between innate and adaptive immunity: Toll-like receptor 2 internalizes antigen for presentation to CD4(+) T cells and could be an efficient vaccine target. J. Immunol., 2003, 171, 32-36. Means, T.K.; Jones, B.W.; Schromm, A.B.; Shurtleff, B.A.; Smith, J.A.; Keane, J.; Golenbock, D.T.; Vogel, S.N.; Fenton, M.J. Differential effects of a Toll-like receptor antagonist on Mycobacterium tuberculosis-induced macrophage responses. J. Immunol., 2001, 166, 4074-4082. Krieg, A.M. CpG motifs in bacterial DNA and their immune effects. Annu. Rev. Immunol., 2002, 20,709-760. Bieback, K.; Lien, E.; Klagge, I.M.; Avota, E.; SchneiderSchaulies, J.; Duprex, W.P.; Wagner, H.; Kirschning, C.J.; Ter Meulen, V.; Schneider-Schaulies S: Hemagglutinin protein of wildtype measles virus activates toll-like receptor 2 signaling. J. Virol., 2002, 76, 8729-8736. Gilliet, M.; Boonstra, A.; Paturel, C.; Antonenko, S.; Xu, X.L.; Trinchieri, G.; O'Garra, A.; Liu, Y.J The development of murine plasmacytoid dendritic cell precursors is differentially regulated by FLT3-ligand and granulocyte/macrophage colony-stimulating factor. J. Exp. Med., 2002, 195, 953-958. Harte, M.T.; Haga, I.R.; Maloney, G.; Gray, P.; Reading, P.C.; Bartlett, N.W.; Smith, G.L.; Bowie, A.; O'Neill, L.A. The poxvirus protein A52R targets Toll-like receptor signaling complexes to suppress host defense. J. Exp. Med., 2003, 197, 343-351. Murabayashi, N.; Kurita-Taniguchi, M.; Ayata, M.; Matsumoto, M.; Ogura, H.; Seya, T. Susceptibility of human dendritic cells (DCs) to measles virus (MV) depends on their activation stages in conjunction with the level of CDw150: role of Toll stimulators in DC maturation and MV amplification. Microbes. Infect., 2002, 4, 785-794. Schiavoni, G.; Mattei, F.; Sestili, P.; Borghi, P.; Venditti, M.; Morse, H.C.; 3rd; Belardelli, F.; Gabriele, L. ICSBP is essential for the development of mouse type I interferon-producing cells and for the generation and activation of CD8alpha(+) dendritic cells. J. Exp. Med., 2002, 196, 1415-1425. Alcami, A.; Structural basis of the herpesvirus M3-chemokine interaction. Trends Microbiol., 2003, 11, 191-192. Alcami, A.; Viral mimicry of cytokines, chemokines and their receptors. Nat. Rev. Immunol., 2003, 3, 36-50. Hubeau, C.; Singer, M.; Lagranderie, M.; Marchal, G.; Vargaftig, B. Extended freeze-dried Mycobacterium bovis Bacillus CalmetteGuerin induces the release of interleukin-12 but not tumour necrosis factor-alpha by alveolar macrophages, both in vitro and in vivo. Clin Exp. Allergy, 2003, 33,386-393.

Toll Like Receptor - Potential Drug Targets in Infectious Disease [128] [129]

[130] [131]

Krieg, A.M. CpG motifs: the active ingredient in bacterial extracts? Nat. Med., 2003, 9, 831-835. von Herrath, M.G.; Bot, A. Immune responsiveness, tolerance and dsRNA: implications for traditional paradigms. Trends Immunol., 2003, 24:289-292. Herrick, C.A.; Bottomly, K. To respond or not to respond: T cells in allergic asthma. Nat. Rev. Immunol., 2003, 3, 405-412. Eisenbarth, S.C.; Piggott, D.A.; Huleatt, J.W.; Visintin, I.; Herrick, C.A.; Bottomly, K. Lipopolysaccharide-enhanced, toll-like receptor 4-dependent T helper cell type 2 responses to inhaled antigen. J. Exp. Med., 2002, 196,1645-1651.

Received: June 10, 2008

Accepted: July 9, 2008

Infectious Disorders - Drug Targets 2008, Vol. 8, No. 4 [132]

[133]

231

Lagranderie, M.; Nahori, M.A.; Balazuc, A.M.; Kiefer-Biasizzo, H.; Lapa, e.; Silva, J.R.; Milon, G.; Marchal, G.; Vargaftig, B.B. Dendritic cells recruited to the lung shortly after intranasal delivery of Mycobacterium bovis BCG drive the primary immune response towards a type 1 cytokine production. Immunology, 2003, 108, 352-364. Liu, T.; Matsuguchi, T.; Tsuboi, N.; Yajima, T.; Yoshikai, Y. Differences in expression of toll-like receptors and their reactivities in dendritic cells in BALB/c and C57BL/6 mice. Infect. Immun., 2002, 70, 6638-6645.

232


Transient Responses Via Regulation of mRNA Stability as an Immunological Strategy for Countering Infectious Diseases Junichi Nakagawa* Department of Food Science and Technology, Faculty of Bio-Industry, Tokyo University of Agriculture, 196 Yasaka, Abashiri-city, Hokkaido 099-2493, Japan Abstract: Posttranscriptional regulation of gene expression plays a pivotal role as a fast control system for T-cells and Bcells operating in the defense reactions against rapidly growing infectious agents. The framework of this machinery involves cis-acting elements in the mRNAs of relevant cytokines and trans-acting factors interacting with these elements. The cis- and trans-acting factors enforce rapid mRNA decay with other proteins such as nucleases in the decay machinery. The most prominent cis-element contains A + U- rich sequence (ARE), and is located in the 3’-untranslated region of the target mRNAs. Some ARE-binding proteins promote the rapid decay, and others protect the mRNA from degradation. The 5’-end of nascent mRNA undergoes capping which protects the 5’-end together with the cap-binding protein, and the 3’ end is protected with poly (A) tail and associating poly (A) binding protein. Unlike in classical drawing of linear structure of mRNA, the end structures interact with each other through a common platform composed of translation initiation factors, revealing the cross-talk of the 5’-end cap structure and 3’-end poly (A) tail on the translational machinery. The rapid degradation and stabilization of mRNA is triggered by a cellular signaling cascade through phosphorylation of associating protein factors in response to environmental stimuli, and a large nucleolytic complex for specific decay reaction called exosome is formed with the 3’-UTR of mRNA through interaction with the ARE-binding proteins. Possible therapeutic agents modifying stability of ARE-containing mRNA are being screened in order to treat immunological disorders.

Keywords: Posttranscriptional regulation, ARE, cytokine, AUBP, mRNA decay, hematopoietic differentiation, chemotherapy, exosome. INTRODUCTION Upon infection of microorganisms, host turns on immunological responses to counter them by means of stimulating transient expression of genes involved in the defense machinery mostly associated with the activation of B-cells and T-cells. Otherwise, the immunological system is supposed to be quiescent in order not to harm the host itself. In mammalian animals and in human, cytokines and interferons (IFNs) operate versatile immunological activation in the host, and usually these groups of genes have very shortlived mRNAs which are expressed at minimal levels under normal situation, but, dramatically elevated in the need for defense against fast growing infectious agents. The underlying mechanism for such prompt response involves regulation of mRNA turnover as this fits to the speedy control of gene expression levels from their minimum to the maximum. It can be illustrated by considering mass balance of mRNA in a given cell that the steady state levels of mRNA is determined by the rate of transcription and degradation, as the water level of a bath tab is determined by the flow at the faucet and that at the drain outlet as shown in Fig. (1). In such scheme, when the drain outlet is wide open the steady state level is maintained at extremely low levels, and in case of need it can be quickly elevated by closing the outlet. This is the basic idea of rapid level control of immunologically relevant mRNAs, which are kept at low *Address correspondence to this author at the Department of Food Science and Technology, Faculty of Bio-industry, Tokyo University of Agriculture, 196 Yasaka, Abashiri-city, Hokkaido 099-2493, Japan; Tel: +81-152-483844; Fax: +81-152-48-3845; E-mail: [email protected]

1871-5265/08 $55.00+.00

Fig. (1). Fate and mass balance of mRNA A lifecycle of mRNA is schematically presented. In the nucleus mRNA is generated by transcription as illustrated by the faucet, directly followed by 5’-capping reaction, polyadenylation and splicing/editing. The processed mRNA is ready for nuclear export to go into cytoplasm. The capped and polyadenylated mRNA is bound by CABP at the cap site and PABP at the poly (A), respectively, and recruited to ribosome for translation. Certain extracellular stimuli can drive removal of the protecting groups from mRNA and recruit it to degradation site such as exosome or stress granules. The intracellular level of mRNA reaches its steady state through the equilibrium of transcription and degradation, and the short-lived mRNAs are prone to degrade as if the drain outlet was widely open. © 2008 Bentham Science Publishers Ltd.

Posttranscriptional Regulation of Hematopoietic Cytokine mRNA

abundance in a normal state and promptly elevated in case of infection. The first important report concerning this type of gene regulation was issued by Shaw and Kamen [1], who identified AU-rich sequences residing within the 3’untranslated regions (3’-UTRs) of the mRNAs of major IFNs and interleukines (ILs). Insertion of AU-rich sequences, which are now called ARE(s) as AU-rich element, into the 3’-untranslated region of a reporter gene rendered dramatic shortening of the half life of resulting mRNA, while insertion of a control GC-rich element of the same size did not modulate the half life of the resulting mRNA. This finding had a considerable impact in the field of gene expression for the importance of posttranscriptional gene regulation. In the following decades, survey for the relevant AREs and protein factors interacting with ARE was vigorously elucidated in several laboratories and resulted in identification of defined AU-rich cis-acting factors and interacting trans-acting factors [2, 3]. Furthermore, a series of recent investigations has begun shedding light on the regulatory proteins in the rapid decay mechanism and overall scheme including translational initiation complex and associating nucleases [4]. The mechanism also involves protein degradation system that removes proteins involved in the decay or the protection of various portions of mRNAs [5, 6]. Thus, the players are not just RNA sequences and its binding protein, but also nucleases, protector proteins, proteases, and platform proteins of the complex where these reactions take place, which has been recently designated as exosome [7, 8]. The aim of this article is to overview the rapid decay mechanism of immunologically relevant mRNAs and its implication in the defense reactions and in immunological disorders. Recent trials for drug discovery aiming pharmacological modulation of posttranscriptional regulation of cytokine gene will be discussed as well. I. AU-RICH ELEMENT (ARE) Defined analysis of the structure of ARE and its mode of action in the degradation of target mRNAs were studied in a series of elegant and persevering experiments carried out by the group of A.-B. Shyu, who used chimera constructs containing combined partial ARE sequence and control sequence made from 3’ UTR of -globin gene [9, 10]. The latter sequence is a well-studied example of 3’-UTR of stable mRNAs. The use of an early responsive gene c-fos promoter in the chimera construct was also carefully designed to artificially start and stop transcription without using drugs such as Actinomycin D which may cause broad changes in cellular physiological state and may perturb the response. Grouping of AREs and their mode of action in the shortening of half lives of defined target mRNAs were unraveled. Class I AREs contain repeating pentameric AUUUA (AU-box) sequences and are contained in major cytokine mRNAs such as GM-CSF, IL-2, IL-3, TNF-. The class I ARE is sufficient to render stability control in response to calcium immobilization when inserted in the 3’UTR of otherwise stable mRNAs. While, class II AREs contain at least one AU box which is surrounded by U-rich sequence such as 3’-UTRs of c-myc, c-fos, so called early response genes. Some of the interleukin mRNAs have AREs of this type as well (Table 1). The third group, class III


233

contains no canonical AU-box, but a cluster of U-rich sequences, as in c-jun mRNA. Apparently all three classes function in instability of mRNA, but the mode of nucleolytic action was revealed to be slightly different. Poly (A) shortening reaction precedes the exonucleolytic action of the mRNA body in case of both Class I and Class II mediated degradation, however, while the distinct decay intermediates with 30-60 (As) are generated in Class I mRNA, asynchronous decay intermediates with gradual poly (A) shortening are found in Class II mRNA [10], suggesting ARE influences poly (A) shortening reaction possibly with the associating proteins. This grouping was further defined into 5 groups, with basically similar principle [4]. The common core ARE is nailed down to a nonamer consisting of UUAUUUA (U/A)(U/A) [11]. Briefly, class I type ARE consistently functions in rapid degradation, but other less defined ARE may promote rapid decay depending on the surrounding context, and its significance is mostly influenced by the U-richness of the neighboring sequence. These features were used to conduct comprehensive analysis of the rapidly degrading mRNAs under certain situations [12, 13]. The ARE-containing RNAs make up some 11% of the whole mRNA species in a given cell, and their functions are not only restricted to proliferation control, but also to other cellular functions [14]. A comprehensive database covering the ARE containing genes of human, mouse and rat have been made and is available in the web site http://brp.kfshrc.edu.sa/ARED. Interestingly the repertoire of ARE-containing genes differs about 25% among human and mouse or rat. This suggests significant divergence in the mode of immunological response of these animals and human system has been evolved in a specific way in the course of the battle between the host and the infectious agents [14]. II. AU-BINDING PROTEINS Following discovery of the relevance of the ARE in the rapid decay of cytokine mRNAs, hunting of protein factors interacting with this motif heated up for some years, resulting in identification of several AU-binding proteins (AUBPs) [2,3]. They are common in having RNA-binding motif or domain in its structure, but subcellular localization varies from cytoplasm, nucleus, endoplasmic reticulum and even in the mitochondria. In fact a mitochondrial protein AUH, which stands for AU-binding hydratase, is an enzyme in the fatty acid -oxidation pathway, thus its RNA-binding site is different from those of usual RNA-binding proteins. This may be an example that metabolic control and response to extracellular stimuli could overlap under certain adaptive conditions. Most of these AU-binding proteins were demonstrated to interact with ARE in cell free systems, however, only limited number of such candidates were finally shown to function in vivo for the regulation of the half lives of target mRNAs. AUF1 or hnRNP D, is the first discovered AUBP by Brewer and his collaborator [15]. As indicated by its name, this protein is categorized as one of the small heterogenous nuclear RNP proteins and intrinsically able to shuttle between cytoplasm and nucleus upon appropriate stimulation. Moreover, this protein has four isomers with different


Table 1.

Junichi Nakagawa

Major AREs in the 3'-UTR of Cytokines mRNAs

Th1 group IFN-

UAUUUAUUAUUUAACAUUAUUUAUAU

IL-2

UAUUUAUUUAAUAUUUAAAUUUUAUAUUUAUU

IL-12 GUUUGUUUAUUUAUUUAUUUAUUUUUGCAU Th2 group IL-4 AUAUUUUUAAUUUAUGAGUUUUUGAUAGCUUUAUUUUUA IL-5

AUUUGGUAAAUUAGUAUUUAUUUAAUGUUAU

IL-10

AUUUAUUACC UCUGAUACCU CAACCCCCAUUUCUAUUUAUUUACUGAGCU

Th17 group IL-17A CUUGGGAAUUUUAUUAUUUAAAAGGUAAAACCUGUAUUUAUUUG AGCUAUUUAAGGAUCUAUUUAUGUUUAAGUAUUUAG IL-23A UGGGGACAGUUUGGGGAGGAUUAUUUAUUGUAUUUAUAUUUGAAUUA UGUACUUUUUUCAAUAAAGUCUUAUUUUGUGGCUAAAAAAA IL-6

ACACUAUUUAAUUAUUUUUAAUUUAUUAAUAUUUAAAUAUGUG AAGCUGAGUUAAUUUAUGUAAGUCAUAUUUAUAUUU

Treg group IL-10

IL-2

UCAACCCCCAUUUCUAUUUAUUUACUGAGCUUCUCUGUGAACGAUUUAG AAAGAAGCCCAAUAUUAUAAUUUUUUUCAAUAUUUAUUAUUUUCACCUGUUUUU UAUUUAUUUAAUAUUUAAAUUUUAUAUUUAUU

Other immunologically important cytokines IL-1

UAUUUAUUUAUUUAUUUGUUUGUUUGUUUUAUU

IL-8

UAUUUAUUAUUUAUGUAUUUAUUUAA

TNF- AUUAUUUAUUAUUUAUUUAUUAUUUAUUUAUUUA IL-13

AAUUUAUUGUUUUUCCUCGUAUUUAAAUAUUAAAUAUGUU

COX-2 UAUUAAUUUAAUUAUUUAAUAAUAUUUAUUAAAA Major interleukins critical for differentiation of or secreted from specific T-cells are listed. The canonical AU-box, AUUUA, is bold-lettered. All the sequences are of human.

apparent molecular weights, namely, p37, p40, p42 and p45, which form dimmers or multiple complexes with other proteins corresponding to various given situations [16]. AUF1 has been shown to function to promote rapid decay reaction of ARE-containing mRNA such as IL-3 and c-fos by in vivo experiments as reviewed in [2, 3]. On the other hand, its stabilizing function on C-rich element of -globin and parathyroidal mRNA was demonstrated, and furthermore, AUF1 was demonstrated to bind 3’-UTR of phosphoenolpyruvate carboxykinase mRNA and that influenced stability of the mRNA, indicating multiple roles of AUF1 in the processing of mRNA with the help of distinct accessory proteins or by its isomeric difference in the activity [17, 18]. Among four isomers cytoplasmically localized p37 and p40 isomers seem to be major destabilizing factors [19, 20], and the localization is regulated through interaction with 14-3-3 protein [21]. AUF1 is known to interact with translation initiation factor eIF4G, poly (A) binding protein (PABP), and hsp70, suggesting its interaction with the initiation

complex for protein translation [22, 23]. In this scheme, displacement of eIF4G from AUF triggers ubiqui-tination of AUF1 and leads to its proteolytic degradation [16]. As for immunological relevance, AUF1 knock out mouse was shown to be sensitive to septic shock, due to stabilization of mRNAs encoding TNF- and IL-1, showing its involvement in regulating over-reactive immune response against exogenous pathogen-loaded toxin [24]. Tristetraprolin (TTP) is a Zinc finger protein and most likely the major AU-binding protein directly involved in the rapid decay reaction of AU-rich mRNAs in immunological systems. TTP directly interacts with ARE in vitro and in vivo [25], and mice deficient of TTP has slower TNF- and GMCSF mRNA decay and consequently develops systemic syndrome of arthritis and autoimmunity, which apparently is derived from over production of TNF- in the cells that causes perturbation of healthy immunological development of the body [26]. It was also shown to be destabilizing IL-3


and other cytokine mRNAs in T-1080 cells [27]. Interestingly TTP was demonstrated in a cell free system to recruit ARE-containing mRNAs to exosome, a complex containing nuclease and other participants exerting AUmediated RNA decay [7] Recently a global analysis of mRNA targets for TTP was made by comparing whole set of transcripts from wild type and TTP knockout mouse embryonic fibroblast cells [28]. In activated macrophage TTP was shown to be responsible for rapid decay of IL-12 mRNA and MIP-2 mRNA [29]. TTP also acts in human dendritic cells as an efficient ARE-mRNA destabilizer. In fact dendritic cells are known to function both in innate and adaptive immunity, and a study using Affimetrix gene array allowed to identify 393 mRNAs as putative targets of TTP [30]. Interestingly, another genome wide screening of TTP target mRNA identified IL-10 mRNA among 137 mRNAs associated with TTP, and in TTP deficient mice IL-10 mRNA expression was elevated [31, 32]. Butylate response factor, BRF1, is a homolog of TTP, having tandem CCCH zinc finger motifs, and belongs to the same TIS11 family as TTP. Both proteins were indicated to be functioning in a putative processing body in which these proteins sequester mRNAs from polysomes, and may not only work for ARE-containing mRNA, but other types of RNA such as micro RNAs [33]. BRF1 is a circadian gene and was shown to be essential in mouse embryogenesis [34]. It is inactivated upon phosphorylation by MAPK-activated protein kinase (MK2) [35]. On the other hand, BRF1 gets phosphorylated by Akt/PKB kinase at Ser92, to which phospho-chaperon 14-3-3 protein binds and hinders the AUbinding activity of BRF1, leading to impairment of its destabilizing capacity for ARE-mRNAs [36, 37]. As Akt/PKB kinase functions in an insulin-dependent manner, it is intriguing to speculate that such pathological stabilization through insulin action may has a link to the pancreatic islet cell loss observed in the late stage of diabetic complication. KH-type splicing regulatory protein (KSRP) is a protein of structure similar to TTP and it has been demonstrated to exhibit similar behavior and function [7, 38]. AUH stands for AU-binding hydratese, meaning this protein not only binds to ARE of IL-3 and other cytokine mRNAs, but also it has activity for a metabolic enzyme in the fatty acid -oxidation pathway [39]. Its RNA-binding motif was located in a 20 amino acid sequence distinct from putative hydratase active site [40]. This was later confirmed by a crystallographic analysis at 2.2 resolution of the polypeptide showing a row of Lys residues aligned on the solvent-accessible surface [41]. As being imagined from the fact that -oxidation is one of the major functions of mitochondria, this enzyme was indeed shown to reside in mitochondria at the ultrastructural levels [42]. Although it is yet to be proven that AUH function in ARE-mediated rapid decay in vivo, it is reminiscent of another RNA-binding enzyme, aconitase, which functions in the TCA cycle and at the same time has RNA-binding activity for decay control of transferrin receptor mRNA [43, 44]. It was recently suggested that archaebacteria seems to be the ancestor of mitochondria and have short-lived mRNAs with (short) poly (A) tails, implying these bacteria have intrinsically fast


235

mRNA decay system, but not as an immunological tool, rather for nutritional response adjusting the bacteria to environmental changes. It would be intriguing to imagine that AUH is a prototype of the ARE-binder for rapid mRNA decay originated and evolved from bacterial system [45]. Contrary to these destabilizing proteins, there are protecting proteins recognizing specifically ARE, and such proteins consequently stabilize otherwise unstable mRNAs. HuR is a protein in a group of proteins first identified in Drosophilla as an essential visionary protein called ELAV, and categorized as ELAV-like proteins together with HuC and HuD and Hel-N1 neuronal RNA-binding proteins and was demonstrated to bind AREs [46-48]. HuR is composed of four distinct domains including three RNA binding domains called RRMs and preferentially bind to ARE than other sequences. Recent structural analysis revealed that RRM3 and a hinge region is important in the binding [49]. Unlike AUBPs described above, HuR is functioning in stabilization of ARE-containing RNAs by binding and protecting them by hindering nuclease activity. HuR resides predominantly in the nucleus but shuttles to the cytoplasm when stimulated (by phosphorylation) and consequently protects ARE-containing mRNA from degradation as reviewed in [50]. HuR not only stabilizes cytokine mRNAs but also mRNAs of VEGF, p21cip, p27KIP1, cyclinA, cyclinB1 and c-fos. Thus HuR plays a role in a broad range of ARE-containing mRNAs involved also in cell cycle control. In fact HuR is a substrate of Chk2, a cell-cycle check point kinase, and phosphorylation of HuR protein leads to dissociation of HuR-SIRT1mRNA complex to promote decay of the mRNA resulting in suppression of survival under oxidative stress conditions [51]. Usaing mastcytoma cells it was shown that TTP and HuR play opposite roles in the stability control of IL-3 mRNA responding to the extracellular stimuli. In Jurkat T-cells overexpression of HuR led to stabilize IL-13 mRNA [52], while translation of an ARE-containing inflammatory mRNA, COX-2 mRNA was shown to be enhanced with bound HuR, which is overridden by CUBGP2 protein which silences the translation [53]. HuR-mediated stabilization of COX-2 mRNA is suspected to be a cause of prostate cancer [54]. Concerning other disease onset, in the aorta of aged spontaneously hypertensive (SHR) rats HuR expression is significantly reduced compared to its healthy counterpart, Wister-Kyoto rats, and consequently ARE-containing mRNAs encoding NO receptors, soluble guanylate cyclase and , are destabilized leading to insufficient signal transduction from NO for relaxation of blood vessel, then to the onset of hypertension [55]. NF90 was shown to bind to IL-2 through its ARE and stabilizes the message [56], and like HuR, NF90 shuttles between nucleus and cytoplasm and stabilizes AREcontaining mRNA when it leaks out of the nucleus. YB-1 protein protects ARE-containing mRNA as well. YB-1 co-precipitates with GM-CSF mRNA. YB-1 binds to IL-2 mRNA following T-cell activation, which involves association of nucleolin, a nuculeolar shuttling protein, with the complex [57]. YB-1 was shown to protect mRNA from decapping reaction in Hela cell extracts. Immunodepletion of


YB-1 leads to destabilization of mRNA. YB-1 functions in a broad range, not just ARE-mediated decay, but other parts of mRNA such as 5’-UTR [58] by interacting with various factors other than nucleolin. III. DECAPPING, DEADENYLATION AND EXONUCLEOLYTIC ACTIVITIES INVOLVED IN THE DECAY REACTION Decay reaction is composed of multiple processes starting from the recognition of the target mRNA followed by its capture and subsequent degradation in a sequential array of enzymatic reactions. Eukaryotic mRNAs are generally equipped with protecting structures both at their 5’

Junichi Nakagawa

and 3’ ends. One protector, the cap structure, m7GpppX is located at 5’-ends, and another protector, poly (A) tail, is located at 3’-ends as illustrated in Fig. (2). In the beginning, poly (A) binding protein (PABP) got notion for its involvement in the decay reaction, because poly (A) shortening was obviously one of the critical steps preceding the decay of the mRNA body and the initial reaction was clearly demonstrated on electrophoretic gels [9]. It is natural to imagine that poly (A) tail of the most eukaryotic mRNAs with its associating PABP may function in protection of the mRNA from 3’-exonuclease. PABP on the one hand interacts with poly (A) though a couple of its N-terminal RNA binding motifs (RRM) of the four RRMs in its

Fig. (2). Protection, deprotection and degradation of ARE-mediated mRNA decay reation Protected and deprotected phases of ARE-containing mRNA are illustrated. Upper panel: The 5’- and 3’-ends of mRNA are connected on the translation initiation complex eIF4F consisting of a platform protein eIF4G, cap-binding protein eIF4E, and poly (A)-binding protein PABP. Thus, the 5’-end and 3’-end may well be crosstalking one another. This complex is recognized and captured by the protein translation machinery where the encoded protein is translated, while mRNA is protected by cap-eIF4E complex and poly (A)-PABP complex at the 5’and 3’- ends, respectively. A rate-limiting poly (A) exonucleolytic reaction is promoted by PARN (depicted as a sea bream which could be PAN2 or CCR4 as well), which starts digesting the 3’-end, and the cap-remover Dcp1/2 (depicted as a crab) is approaching to the cap site. Upon extracellular stimuli HuR may bind ARE to protect it, and under normal situation ARE is bound by TTP and other destabilizing AUBPs such as AUF1, BRF1, or KSRP. Lower panel: Following removal of the 5’-cap, the 5’-3’ exonuclease Xrn1 vigorously digests mRNA from its 5’-end, supposedly in stress granules. At the 3’-end PABP fails to bind poly (A) tail when it gets chopped to shorter than a critical length for binding, then comes a 3’-5’ exonuclease associated with a mRNA decay complex called exosome, which fiercely digests mRNA from the 3’ end. These 5’-3’ and 3’-5’ exonucleolytic reactions on the deprotected mRNA body are very fast, as depicted as sharks. Destabilizing AUBP such as TTP is supposed to recruit mRNA to exosome. Another decay site is the stress granule which may primarily promote 5’-3’ exonucleolytic reaction.


structure, and on the other, interacts simultaneously with the translation initiation factor, eIF4G. Furthermore, the mRNA 5’-cap site is bound by eIF4E which is at the other end binds to eIF4G, forming eIF-4F translation initiation complex [59]. This illustrates that unlike appearing in most of the classic biochemistry textbooks for easy understanding, mRNA may not exit as a linear structure, but rather as a circular structure with its tail bound to its head. In such scheme, ARE may be located close to the eukaryotic translation initiation factors together with poly (A) tail as in Fig. (2). It was suggested that there is a critical number of PABP attaching to the poly (A) tail to function as a protector, and that as the poly (A) nuclease chops off the tail, and when its length becomes too short to bind PABP anymore, a strong 3’-5’ exonuclease starts degrading the body of the mRNA as illustrated as a shark in Fig. (2). In addition recent report showed that PARN interacts with 5’ cap structure and competes with eIL4E for cap binding [60], suggesting significantly delicate functional crosstalk between the 5’ and 3’ end of mRNAs. So, how do nucleases responsible for the rapid decay of ARE-bearing mRNA attack the circular mRNA-protein complex? This question was initially tackled by Roy Parker and colleagues using genetic approaches in yeast, and they identified a 5’ exonuclease called Xrn1 which resides in a site called Processing body (P-body) [61]. The decay processes in yeast was revealed to be weighed more on 5’-3’ direction than 3’-5’ direction through mutational analyses. The protecting cap structure is removed by the decapper enzymes, Dcp1 and Dcp2 [62-64]. Subsequently the naked 5’-end is prone to be degraded by Xrn1 in a 5’-3’ exonucleolytic manner [61]. The corresponding 5’-3’ exonucleases in mammals were later identified as CCR4 and nocturnin, of which the latter is involved in the circadian rhythm regulation as its name implies [65, 66]. Though the results from yeast genetics indicated that 5’-3’ decay is predominant in yeast, 3’-5’ decay system seems to be the major pathway in mammalian mRNA degradation [67]. In mammals, following removal of poly (A) tail, 3’-5’ exonucleolytic reaction is operated in a decay complex, exosome [8]. The deadenylase that removes poly (A) tail is PARN which is the major enzyme responsible for the removal of poly (A) tail, whereas CCR4 and nocturne seem to function in circadian rhythm-dependent manner to deadenylate mRNAs expressed according to a circadian-rhythm [66]. PAN2 is another decapping enzyme and seems to work at the initial stage of poly (A) shortening followed by the action of CCR4 [68]. It was proposed that in mammalian cytoplasmic mRNA decay process, the deadenylation reaction takes place as an initial step followed by the decapping reaction possibly as a compensatory mechanism [68]. The recruitment of mRNAs to exosome is facilitated by ARE and its binding proteins, for example, KSRP, TTP and AUF1 [7]. Stabilizing AUBP such as HuR is believed to replace these destabilizing AUBPs and hamper recruitment. It seems that TTP not only works for degradation at the 3’end but for 5’-end processing as well by activating decapping enzymes [69]. In addition recent studies on micro RNA revealed an overlapping event of the RNA digestion in Dicer where microRNAs and siRNAs are digested, with ARE-mediated


237

decay [70]. This unexpected finding was made using Drosophila S2 cells and Hela cells, in that, Dicer1, Argonaute1 (Ago1) and Ago2, known to be involved in micro RNA processing, are required for the decay of TNF- mRNA degradation. Furthermore, the complementary sequence to a minimal ARE, UAAAUAUU, is encoded in the miRNA. In this setup TTP is required for decay. This reaction seems to cut ARE directly and may compose the third path to the ARE-mediated decay other than known exosome and stress granule-mediated decay [71]. IV. SIGNAL TRANSDUCTION IN MEDIATED RAPID DECAY OF mRNA

THE

ARE-

Activation of T-cell and B-cell is known to be associated with signal transduction initiated by environmental stimuli. Lindsten and colleagues demonstrated that such signal generated by stimulating T-cells by antibody to CD28 along with concomitant cross-linking of TCR-CD3 with antibody to CD-3 triggered marked stabilization of IL-2 mRNA [72]. T-cell activation is one of the most studied areas of the signal transduction and is known at least involvement of Ca2+ mobilization, activation of PKC, pI3K, p38MAPK, and JNK. Obviously protein phosphorylation plays a key role in this mechanism. Involvement of Ca2+ mobilization and subsequent activation of PKC in the ARE-mediated mRNA decay is an extensively studied example. Lindsten and colleagues already noticed the effect of PMA in the stabilization of ARE-containing cytokine mRNAs, and soon Malter reported using Jurkat cells that PMA and ionomycin induced binding of a protein of 32 KDa to the ARE of GMCSF displayed on a gel, and named the protein AUBP as AU-binding protein [73]. This led to a line of experiments to identify the protein factors and kinases that phosphorylate AUBPs, and the groups of Christoph Moroni, Michael Karin and others demonstrated that JNK, p38MAPK and PI3K are responsible for the stabilizing effect on these types of mRNAs upon extracellular stimulation [7, 74-75]. Phosphorylation of proteins may cause changes in the electric charge of the protein that could hinder the binding of negatively charged RNA molecules, and may also cause allosteric changes of the AUBP that may modulate its association with other factors of the members of exosome. Indeed, TTP, a destabilizing AUBP, was less prone to bind ARE at its phosphorylated state as compared to its dephosphorylated state. Furthermore, the phosphorylated TTP gets recognized by a phosphor-dependent chaperon 14-3-3 protein which binds TTP and brings it out of stress granules where TTP plays a role in degradation of stress-sensitive mRNAs therein [76]. HuR, a stabilizing AUBP shuttles from the nucleus to the cytoplasm upon phosphorylation, which is a critical step for stabilization of cytoplasmic AU-containing RNAs [77]. And this protein can still reside in the stress granules and therefore, it is supposed to replace TTP and stabilize otherwise rapidly degrading mRNAs [76]. In human monocytic THP-1 cells treatment with TPA, a PKC stimulating drug with a similar structure to PMA, induces dephosphorylation of an AUBP, p40AUF1 isoform, at Ser83 and Ser87. This seems to increase the binding affinity of p40AUF1 to ARE-containing mRNA, which in turn causes stabilization of the bound mRNAs. AUF1 protein can thus function as both destabilizer and stabilizer of ARE-


containing mRNAs under given circumstances with its isomers with distinct intrinsic functions [78]. Several more experiments revealed the relevance of protein phosphorylation in the mRNA decay control. Activation of stress-induced c-jun terminal kinase (JNK) led to stabilization of IL-2 and Il-3 mRNA [74, 79]. In human monocytes COX2 mRNA was stabilized by activation of p38 mitogen-activated protein kinase (MAPK) [80], and using LPS-stimulated THP-1 cells mRNA species stabilized through activation of p38 MAPK was analyzed by cDNA array containing 950 ARE mRNAs resulting in identification of over 40 stabilized ARE-mRNAs including colony stimulating factor (CSF) mRNA [81]. MAPKAP kinase (MK2) was shown to modulate stability of TNF- and Il-6 [82]. PI 3 kinase stabilizes IL-3 mRNA in mastocytoma cells [75]. V. IMMUNOLOGICAL RELEVANCE OF mRNA DECAY REACTION ON THE REGULATION OF SELECTIVE DIFFERENTIATION AND FUNCTION OF T CELLS Recent advances in the field of immunological development of hematopoietic cells provided a definitive breakthrough in the classical theory of immunological defense mechanism involving Th1 and Th2 cells, both of which are differentiated from a common precursor cells called naïve T cells (details are reviewed in the chapter of Vernal and Garcia-Sanz of this issue). Th1 cells have been supposed to differentiate and proliferate and interact with cytotoxic Tcells and macrophages, promoting cytotoxicity and macrophage-mediated defense reactions aiming for the removal of intracellular invasive agents, while Th2 cells have been proposed to be the functional counterparts promoting antibody production against extracellular infectious agents. Although Th1/Th2 cells attack exogenous invaders, they can also become harmful to the host itself when the immunological system is perturbed. Along this line, Th1 was suspected to be the cause of delayed-type hypersensitivity reactions (DHR) and organ specific autoimmune disorders, while Th2 as the cause for systemic autoimmune disorders (reviewd in Vernal and Garcia-Sanz). The pivotal lymphokines for the development of Th1 cells from the progenitor cells are interferon (IFN)-, IL-2, and IL-12, while those required for proliferation of Th2 type cells are IL-4, IL-5, and IL-10. Until recently this classification held up. However, studies of the pathological mechanism underlying the onset of Rheumatoid Arthritis (RA) led to accumulate several lines of evidence that Rheumatoid Arthritis (RA) may not be simply due to the Th1 cells, because IFN- was rarely found in the synovial membranes of the joints of RA patients. Furthermore, mice deficient in IFN- displayed even severer collagen-induced arthritis, a standard animal model for RA [83]. The paradoxical observation implied existence of the third group of cells that should be propagated by the signal induced by IL-17, and it needs to be verified by the action of IL-23. Indeed Th17 cells stimulated by IL-23 was shown to promote osteoclastogenesis mainly through production of IL17 and the ligand for the receptor activator of nuclear factorB (RANKL) [84]. Th17 cells are unique in that they do not require IFN- nor IL-4, and promote differentiation of osteoclasts. Later Th17 was reported to need also IL-6 and

Junichi Nakagawa

TGF- for its development (TGF- mRNA is devoid of ARE). These findings suggested the importance of Stat3 which is in the downstream of signal transduction of IL-17 and IL-6 [85]. T regulatory cells (Treg), formerly called suppressor T cells, function conversely to Th17 subset. Treg cells provide restriction of immunological reactions to self antigens in the healthy tissues to avoid autoimmune diseases and acute transplant rejection. Both in vitro and in vivo studies suggest that Treg cells can suppress the proliferation and/or cytokine production of effecter T cells [86]. A critical regulator of Treg cell development is the transcription factor Foxp3, and IL-2 and TGF- are essential for the expression of Foxp3, generation of Treg cells, and maintenance of immunological tolerance [87]. It has been recently proposed that IL-10 and TGF- appear to be important for the regulation of activity of Treg cells [88]. When the interleukins and other cytokines involved in the differentiation and proliferation of these four types of immunological cells are examined for ARE composition in the 3’-UTR of their mRNAs, class I type ARE is predominantly found in Th1 and Treg type cytokines, while class II type ARE is more in the Th2 and Th17 type cytokines as their mRNA decay signals (Table 1). Although this notion has to be substantiated with a larger number of examples not only in human but also in other mammals, this might suggest a possibility that ARE-mediated regulation of mRNA half lives of relevant cytokine genes may differentially function in the fast and slow defense and even in the immunological disorders causing various host-harming immunological reactions. VI. TRIALS FOR SCREENING THERAPEUTIC AGENTS TARGETING ARE-MEDIATED REGULATION OF CYTOKINE mRNAs Prevention of self-destruction, rather than potentiating defense reaction, has been up to now the subject of screening drug candidates able to interfere with ARE-mediated decay reaction. Drugs hindering ‘stabilizing’ AUBPs were screened to develop drug candidates for treatment of abnormal immunological reactions such as autoimmune diseases including RA. This trial involves drug screening in a set-up consisting of target RNA, namely, ARE-containing RNA, and its interacting protein such as HuR, which is believed to increase the half-lives of ARE-containing RNAs, leading to cytokine overproduction. For example, Il-4 mRNA is stabilized in the CD4+ T-cells by action of HuR [89]. One early such trial led to identification of a compound called radicicol-analog, RAA [90]. Radicicol has been known for many years as a potential cancer drug, originally discovered in the fermentation products of actinomycetes. RAA is a synthetic derivative of radiciol and was shown to affect/ destabilize ARE-containing mRNAs expressed in IFN/lipopolisaccharide-stimulated THP-1 human monocytes, and the fact that only 34 expressed tags were destabilized by RAA among 17,608 tags in the serial analysis of gene expression indicated its specificity. The half-lives for mRNAs coding for IL-6, IL-1, IL-1, IL-8, IL-10RA, TNF-, CCL3, CCL4, CCL8 and COX-2 were significantly destabilized, indicating the potential of RAA to ameliorate inflammatory responses [91]. Another approach for the drug


discovery aiming inhibition of HuR dimeri-zation, which is a prerequisite for its binding to ARE, was reported from a pharmaceutical company, showing screening of actinomyces broth gave hits with three ‘drugable’ chemicals, MS-444, dehydromutactin and okicenone. These findings may encourage trials for drug development targeting AREmediated decay mechanism, which is certainly a new mode of action assigned to a drug [92]. Other possible drug targets involving mRNA decay control may overlap with the existing fields. Cyclosporin A and FK-506 have been well-recognized powerful drugs for the prevention of graft-versus-host reaction and other selfharming immunological reactions. These drugs were demonstrated to suppress IL-3 mRNA production through destabilization of malignantly stabilized IL-3 mRNA in the mastcytoma model [93]. As discussed in the previous section, protein kinase modulators would be reasonable compounds which may function in the modulation of mRNA decay rate. For example, a p38 MAPK inhibitor, SB203580, repressed IL1-mediated IL-6 production in osteoblast cells though posttranscriptional mechanisms [94]. Currently proposed mechanism for the kinase inhibitor includes all the aspects of the downstream events, however, a specific RNA binding protein or nuclease, or adaptor protein for escorting or to binding to the exosome of the ARE-containing mRNAprotein complex would be the hidden targets of such drug that may regulate expression of cytokine molecules functioning in specific type of T cell progenitor to differentiate and propagate. Implication of such therapeutic effect on mRNA stability may be extended to other fields than immunological disorders. For example, world-wide concern on dramatic increase in the number of diabetic patients pushes drug development for a cooperative drug with novel pharmacologic action that compensates incomplete efficacy of existing drugs. In both type 1- and type 2-diabetes, the most critical phase of the disease is the self-destruction of pancreatic islet cells which secret insulin to regulate serum glucose levels. In type 1 diabetes this is the primary cause of the disease onset, and in type 2 diabetes apoptosis of cells is a critical irreversible step at the late stage of the disease, and in both case, the cell apoptosis is led by inappropriate immunological action of the host. Furthermore, mRNA coding for a glucose transporter, Glut1 is posttrasncriptionally regulated in 3T3L1 adipocyte by HuR protein [51]. Thus, a drug modulating mRNA stability might hold a broad possibility not restricted to direct immunological disorders, but also to the field of cancer and diabetic complications. Possible involvement of mRNA stability control concerning human diseases was reviewed elsewhere [95]. VII. CONCLUSION The 3’-UTR of cytokine mRNAs clearly plays an important role in the immunological responses through regulating promptly the abundance of differentiating cytokines for the progenitors of hematopoietic cells. ARE is a hallmark of rapidly degrading mRNAs and the trans-acting factors including AUBPs respond to extracellular stimuli to either stabilize or destabilize the target mRNAs by first


239

recruiting mRNAs to the exosome, or stress granules where they undergo processing, and later regulate the physiological state of the T-cell repertoire. Thus, the immunological response reaches the balancing state of Th1, Th2, and Th17 cells that directly defend against exogenous pathogens and in pathological situation are able to attack the host itself. Treg cells on the contrary, function in suppressing self-destroying activities of the effecter T cells. The abundance of key cytokines for differentiation and propagation of these immunologically important cells is regulated via prompt control through ARE-mediated decay system. Although the precise mechanism of the mRNA decay still needs to be elucidated in detail, discovery of therapeutic agents targeting components in the specific mRNA decay process is awaited for the treatment of immunological disorders, infectious diseases, diabetes, and cancer. ACKNOWLEDGMENT I thank Dr. Jose A. Garcia-Sanz for his helpful comments on the manuscript. REFERENCES [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20]

[21] [22] [23]

[24] [25] [26] [27]

Shaw, G.; Kamen, R. Cell, 1986, 46, 659. Brewer, G. Aging Res. Rev., 2002, 1, 607. Barreau, C.; Paillard, L.; Osborne, H. B. Nucleic Acid Res., 2005, 33, 7138. Shim, J.; Karin, M. Mol. Cells, 2002, 14, 323. Wilusz, C. J.; Wilustz, J. Trends in Genetics, 2004, 20, 491. Meyer, S.; Temme, C.; Wahle, E. Crit. Rev. Biochem. Mol. Biol., 2004, 39, 197. Chen, C.-Y.; Gherzi, R.; Ong, S.-E.; Chan, E. L.; Rajimakers, R.; Pruijn, G. J. M.; Stoecklin, G.; Moroni, C.; Mann, M.; Karin, M. Cell, 2001, 107, 451. Mukherjee, D.; Gao, M.; O’Connor, J. P.; Raijmakers, R.; Pruijn, G.; Lutz, C. S.; Wilustz, J. EMBO J., 2002, 21, 165. Shyu, A. B.; Belasco, J. G.; Greenberg, M. E. Genes Dev., 1991, 5, 221. Chen, C-Y. A.; Shyu, A-B. Trends Biochem. Sci., 1995, 20, 465. Lagnado, C. A.; Brown, C. Y.; Goodall, G. J. Mol. Cell Biol., 1994, 14, 7984. Bakheet, T.; Frevel, M.; Williams, B.R.; Greer, W.; Khabar, K. S. Nucleic Acid Res., 2001, 29, 246. Bakheet, T.; Williams, B. R.; Khabar, K. S. Nucleic Acid Res., 2006, 34, D111. Halees, A. S.; El-Badrawi, R.; Khabar, K. S. Nucleic. Acid Res., 2008, 36, D137 Brewer, G. Mol. Cell Biol., 1991, 11, 2460. Laroia, G.; Cuesta, R.; Brewer, G.; Shneider, R. J. Science, 1999, 284, 499-502. Keledijan, M.; DeMaria, C. T.; Brewer, G.; Novik, K. Mol. Cell Biol., 1997, 17, 4870. Hajarnis, S.; Schroeder, J. M.; Cuthoys, N. P. J. Biol. Chem., 2005, 280, 28272. Sarker, B.; Xi, O.; He, C.; Schneider, R. J. Mol. Cell. Biol., 2003, 23, 6685. Arao, Y.: Kikuchi, A.; Kishida, M.; Yoneyama, M.; Inoue, A; Yasuda, S.; Wada, S.; Ikeda, K.; Kayama, F. Mol. Endocrinol., 2004, 18, 2255. He, C.; Schneider, R.J. EMBO J., 2006, 25, 3823. Lu, J. Y.; Bergman, N.; Sadri, N.; Schneider, R. J. RNA, 2006, 12, 883 Sagliocco, F.; Laloo, B.; Cosson, B.; Laborde, L.; Castroviejo, M.; Rosenbaum, J.; Ripoche, J.; Grosset, C. Biochem, J., 2006, 400, 337. Lu, J.-Y.; Sadre, N.; Schneider, R. J. Genes Dev., 2006, 20, 3174. Caballo, E.; Lai, W. S.; Blackshear, P. J. Science, 1998, 281, 1001. Taylor, G. A. et.al. Immunity, 1996, 4, 445. Stoechklin, G.; Ming, X.-F.; Looser, R.; Moroni, C. Mol. Cell Biol., 2000, 20, 3753.

240 Infectious Disorders - Drug Targets 2008, Vol. 8, No. 4 [28] [29] [30]

[31] [32] [33] [34]

[35] [36] [37] [38]

[39] [40] [41] [42] [43] [44] [45] [46] [47] [48] [49] [50] [51] [52]

[53] [54]

[55] [56] [57] [58] [59] [60] [61]

Lai, W. S.; Parker, J. S. Grissom, S. F.; Stumpo, D. J.; Blackshear, P. J. Mol. Cell Biol., 2006, 26, 9196. Jalonen, U.; Nieminen, R.; Vuolteenaho, K.; Kankaanranta, H.; Moilanen, E. Mediators Inflammation, 2006, 2006, 1-8. Emmons, J.; Towley-Tilson, W. H.; Deleault, K. M.; Skimmer, S. J.; Gross, R. H.; Whitfield, M. L.; Brooks, S. A. RNA, 2008, 14, 888. Stoecklin, G.; Tenenbaum, S. A.; Mayo, T.; Chittur, S. V.; George, A. D.; Baroni, T.E.; Blackshear, P. J.; Anferson, P. J. Biol. Chem., 2008, 283, 11689. Sandler, H.; Stoecklin, G. Biochem. Soc. Trans,. 2008, 36, 491. Franks, T., M.; Lykke-Andersen, J. Genes Dev., 2007, 21, 719. Stumpo, D. J.; Byrd, N. A.; Phillips, R. S.; Ghosh, S.; Maronpot, R. R.; Castranio, T.; Meyers, E. N.; Mishina, Y.; Blackshear, P. J. Mol. Cell Biol., 2004, 24, 6445. Maitra, S.; Chou, C. F.; Luber, C. A.; Lee, K. Y.; Mann, M.; Chen C. Y. RNA, 2008, 14, 950. Schmidin, M.; Lu, M.; Leuenberger, S. A.; Stoecklin, G.; Mallun, M.; Gross, B.; Gherzi, R.; Hess, D.; Hemmings, B. A.; Moroni, C. EMBO J., 2004, 23, 4760. Benjamin, D.; Schmidin, M.; Min, L.; Gross, B.; Moroni, C. Mol. Cell Biol., 2006, 26, 9497. Winzen, R.; Thakur, B. K.; Dittrich-Breiholz, O.; Shah, M.; Redich, N.; Dhamija, S.; Kracht, M.; Holtmann, H. Mol. Cell Biol., 2007, 27, 8388. Nakagawa, J.; Waaaldner, H.; Meyer-Monard, S.; Hofsteenge, J.; Jen, P.; Moroni, C. Proc. Natl. Acad. Sci. USA, 1995, 92, 2051. Nakagawa, J.; Moroni, C. Eur. J. Biochem., 1977, 244, 890. Kurimoto, K.; Fukai, S.; Nureki, O.; Muto, Y.; Yokoyama, S. Structure, 2001, 9, 1253. Brennan, L., E.; Nakagawa, J.; Egger, D.; Bienz, K.; Moroni, C. Gene, 1999, 228, 85. Muellner, E.; W., Neupert, B.; Kuehn, L, C. Cell, 1989, 53, 373. Rouault, T.A.; Stout, C. D.; Kaptain, S.; Hrford J. B.; Klausner, R. D. Cell, 1991, 64, 881. Gagliardi, D.; Stepien, P. P.; Tempeley, R. J.; Lightwlers, R. N.; Chrzanowska-Lightwlers, Z. M. A. Trends Genetics, 2004, 20, 260. Szabo, A.; Dalmau, J.; Manley, G.; Rosenfeld, M.; Wong, E.; Henson, J.; Posner, J. B.; Furneaux, H. M. Cell, 1991, 67, 325. Myer, V. E.; Fan, X. C.; Steitz, J. A. EMBO J., 1997, 16, 2130. Zhu, H.; Hasman, R. A.; Barron, V. A. Mol. Biol. Cell., 2006, 17, 5105. Fialcowiz-White, E. J.; Brewer, B. Y..; Ballin, J. D.; Willis, C. D.; Toth, E. A.; Wilson, G. M. J. Biol. Chem., 2007, 282, 20948. Brennan, G. M.: Steitz, J. A. Cell. Mol. Life Sci., 2001, 58, 266. Abdelmohsen, K.; Pullmann, R. Jr.; lai, A.; Kim, H. H.; Galban, S.; Yang, X.; Blethrow, J. D.; Walker, M.; Shubert, J.; Gillespie, D. A.; Furneaux, H.; Gorospe, M. Mol. Cell, 2007, 25, 543. Casoralo, V.; Fang, X.; Tancowny, B.; Fan, J.; Wu, F.; Srikantan, S.; Asaki, S. Y.; DeFanis, U.; Huang, S. K.; Gorospe, M.; Atasoy, U. X.; Stellato, C. J. Allergy Clin. Immunol., 2008, 121, 853. Sureban, S. M.; Murmu, N.; Rodriguez, P.; May, R.; Maheshwari, R.; Diekgraefe, B. K.; Houchen, C. W.; Anant, S. Gastroenterology, 2007, 132, 1055. Niesporek, S.; Kristiansen, G.: Thoma, A.; Weichert, W.; Noske, A.; Buckendahl, A. C.; Jung, K.; Stephan, C.; Dietel, M.; Denkert, C. Int. J. Oncol., 2008, 32, 341. Kloess, S.; Rodenbach, D.; Bordel, R.l; Muelsh, A. Hypertension, 2005, 45, 1200. Shim, J.; Lim, H. R.; Yates, J.; Karin, M. Mol. Cell, 2002, 10, 1331. Chen, C. Y.; Gherzi, R.; Anderson, J. S.; Gaietta, G.; Juerchott, K.; Royer, H. D.; Mann, M.; Karin, M. Genes Dev., 2000, 14, 1236. Evdokimova, V.; Ruzanov, P.; Imataka, H.; Raught, B.; Svitkin, Y.; Ovchinnikov, L. P.; Sonnenberg, N. EMBO J., 2001, 20, 5491. Sonnenberg, N. Biochem. Cell Biol., 2008, 86, 178. Seal, R.; Temperley, R.; Wilustz, J.; Lightowlers, R. N.; Chrzanowska-Lightowlers, Z. M. Nucleic Acid Res., 2005, 33, 376. Sheth, U.; Parker, R. Science, 2003, 300, 5620.



Junichi Nakagawa [62] [63] [64] [65] [66] [67] [68] [69] [70] [71] [72] [73] [74] [75] [76] [77] [78]

[79] [80] [81] [82] [83] [84] [85] [86] [87] [88] [89] [90] [91] [92]

[93] [94] [95]

Beelman, C. A.; Stevens, A.; Caponigro, G.; LaGrandeur, T. E.; Hatfield, L.; Fortner, D. M.; Parker, R. Nature, 1996, 283, 642. Dunckley, T.; Parker, R. EMBO J., 1999, 18, 5411. Deshmukh, M. V.; Jones, B. N.; Quang-Dang, D. U.; Flinders, J.; Floor, S. N.; Kim. C.; Jemielity, J.; Kalek, M.; Darzynkiewicz, E.; Gross, J. D. Mol. Cell, 2008, 29, 324. Tucker, M.; Valencia-Sanchez, M. A.; Staples, R. R.; Chen, J.; Denis. C. L.; Parker, R. Cell, 2001, 104, 377. Baggs, J. E.; Green, C. B. Curr. Biol., 2003, 13, 189. Wang, Z.; Kiledjian, M. Cell, 2001, 107, 751. Yamashita, A.; Chang, T. C.; Yamashita, Y.; Zhu, W.; Zhong, Z.; Chen, C. Y.; Shyu, A.-B. Nat. Struct. Mol. Biol., 2005, 12, 1054. Fenger-Groen, M.; Fillman, C.; Norrild, B.; Lykke-Andersen. J. Mol. Cell, 2005, 20, 905. Valencia-sanchez, M. Liu, J.; Hannon, G. J; Parker, R. Genes Dev., 2006, 20, 515. Jing, Q.; huang, G.; Guth, S.; Zarubin, T.; Motoyama, A.; Chen, J.; Di Padova, F.; Lin, S. C.; Gram, H.; Han, J. Cell, 2005, 120, 623. Lindsten, T.; June, C. H.; Ledbetter, J. A.; Stella, G.; Thompson, C. B. Science, 1989, 244, 339. Malter, J. S. Science, 1989, 246, 664. Ming, X.-F.; Kaiser, M.; Moroni, C. EMBO J., 1998, 20, 6039. Ming, X.-F.; Stoecklin, G.; Lu, M.; Looser, R.; Moroni, C. Mol. Cell. Biol., 2001, 21, 5778. Stoecklin, G.; Stubbs, T. Kedersha, N.; Wax, S.; Rigby, W. F.; Blackwell, T. K.; Anderson, P. EMBO J., 2004, 23, 1313. Fan, X. C.; Steitz, J. A. Proc. Natl. Acad. Sci. USA, 1998, 95, 15293. Wilson, G. M.; Lu, J.; Sutphen, K.; Suarez, Y.; Sinha, S.; Brewer, B.; Villanueva-Feliciano, E. C.; Ysia, R. M.; Charles, S.; Brewer, G. J. Biol. Chem., 2003, 273, 33039. Chen, C. Y.; DelGatto-Konczak, F.; Wu, Z; Karin, M. Science, 1998, 280, 1945. Dean, J. L.; Brook, M; Clark, A. R.; Saklatvala, J. J. Biol. Chem., 1999, 274, 264. Frevel, M. A.; Bakheet, T.; Silva, A. M.; Hissong, J. G.; Khabar, K. S. A.; Williams, B. R. G. Mol. Cell Biol., 2003, 23, 425. Neininger, A.; Kontoyjannis, D.; Kotlyarov.; Winzen, R.; Eckert, R.; Volk, H. D.; Holtman, H.; Kollas, G.; Gaestel, M. J. Biol. Chem., 2002, 277, 3065. Chu, C. Q.; Song, Z.; Mayton, L.; Wu, B.; Wooley, P. H. Ann. Rheum. Dis., 2003, 62, 983. Sato, K.; Suematsu, A.; Okamoto, K.; Yamaguchi, A. J. Exp. Med., 2006, 203, 2673. Yang, X. O.; Panopoulos, A. D.; Nurieva, R.; Chang, S. H.; Wang, D.; Watowich, S. S.; Dong, C. J. Biol. Chem., 2007, 282, 9358. Tang, Q.; Bluestone, J. A. Immunol. Rev., 2006, 212, 217. Tang, Q.; Adams, J. Y.; Penaranda, C.; Melli, K.; Piaggio, E.; Sgouroudis, E.; Piccirillo, C. A.; Salomon, B. L.; Bluestone, J. A. Immunity, 2008, 28, 687. Askenasy, N.; Kaminitz, A.; Yarkoni, S. Autoimmun. Rev., 2008, 7, 370. Yarovinsky, T. O.; Butler, N. S.; Monick M. M.; Hunninghake, G. W. J. Immunol., 2006, 177, 4426. Kastelic, T.; Schnyder, J.; Leutwiler, A.; Traber, R.; Streit, B.; Niggli, H.; MacKenzie, A.; Cheneval, D. Cytokine, 1996, 8, 751. Mak, I., W., Y.; Liu, L.; Ling, V.; Kastelic, T. Genomics, 2007, 90, 723. Meisner, N. C.; Hintersteiner, M.; Mueller, K.; Bauer, R.; selfert, J. M.; Naegeli, H. U.; Ottl, J.; Oberer, L.; Guenat, C.; Moss, S.; Harrer, N.; Woisetschlaeger, M.; Buehler, C.; Uhi, V.; Auer, M. Nat. Chem. Biol., 2007, 3, 508. Nair, A. P.; Hahn, S.; Banholzer, R.; Hirsch, H. H.; Moroni, C. Nature, 1994, 369, 239. Patil, C.; Zhu, X.; Rossa, C, Jr.; Kim, Y. J.; Kirkwood, K. L. Immun. Invest., 2004, 33, 213. Hollams, E. M.; Giles, K. M.; Thomson, A. M.; Leedman, P. J. Neurocchem. Res., 2002, 27, 957.


241

Differential Splicing, Disease and Drug Targets O. Villate, A. Rastrojo, R. López-Díez, F. Hernández-Torres and B. Aguado* Centro de Biología Molecular Severo Ochoa (CBMSO), CSIC, Campus Cantoblanco, 28049 Madrid, Spain Abstract: Genome complexity and diversity can be due to Alternative Splicing (AS), a process by which one gene can generate multiple mRNA isoforms and then several proteins. This is part of a normal process of variation on an individual, and when it is disrupted or modified, may trigger disease. To date, there are many pathologies described due to the effects of altered splicing isoforms, and effort is focused on the description of new ones. The design of drug target has to consider splicing, as in many occasions, a drug might have effect on different isoforms, instead of on the particular one implicated in the pathology. Interestingly, the strategies used to alter splicing can be used to modify a form towards the canonical one, or towards an aberrant one, when the latter one has a beneficial effect on the individual. Here we describe differential splicing, diseases produced by alterations on the mRNA isoforms, and drugs or methods used to restore these alterations.

Keywords: Alternative splicing, miRNA, siRNA, mRNA isoform, antisense oligonucleotide, SSOs. INTRODUCTION Alternative Splicing (AS) is a major mechanism for modulating the gene expression of an organism, and enables a single gene to increase its coding capacity, allowing from an unique gene the synthesis of several structurally and functionally distinct mRNA and protein isoforms (Fig. (1)). This is of great relevance, considering that the number of genes among different species is quite similar. For example, the human genome contains ~25.000-30.000 genes and the C elegans genome ~27.000 according to Ensembl (http://www. ensembl.org/) databases. However, the number of transcripts and proteins are quite different with nearly 50.000 reference mRNA sequences on Ensembl human databases and with ~29.000 for C elegans. These numbers are expected to be even greater in relation to protein sequences. The result of AS is the introduction of variable segments from particular genes (Fig. (1)), within otherwise identical mRNAs. In humans, about 80% of this variability falls within Open Reading Frame (ORFs), greatly expanding the human proteome [1, 2], and the 20% that falls within untranslated regions affects cis-elements that control mRNA stability, translation efficiency (including miRNA binding sites), and mRNA localization. Furthermore, one-third of AS events introduce premature termination codons (PTCs), which in many cases cause mRNA degradation by nonsense-mediated decay (NMD) [2, 3]. Therefore, regulation of AS controls the temporal and spatial expression of functionally diverse isoforms, on-off regulation by NMD, or other post-transcriptional regulatory responses. Hence, the knowledge of AS and its regulation is necessary for understanding gene expression in different tissues and species, considering that their mRNA isoforms can also show specificity on function. This mechanism is part of a normal process of variation, generating diversity and complexity genetics and, when this process is disrupted or altered, may trigger disease. THE SPLICING CODE In general, control and regulation of splicing are mediated by two molecular elements: cis and trans-elements. *Address correspondence to this author at the Centro de Biología Molecular Severo Ochoa (CBMSO), CSIC, Campus Cantoblanco, 28049 Madrid, Spain; E-mail: [email protected] 1871-5265/08 $55.00+.00

Together, cis and trans elements make up what is now recognized as the “Splicing Code” resumed on the Fig. (2). Cis-elements could be defined as small necessary sequences present at mRNA level which can be identified by the splicing machinery (spliceosome) to perform an adequate splicing process. Trans-elements include the proteins (spliceosome) which are involved in processes required to identify intron/exon boundaries and catalysis of the cut and paste reactions that remove introns and join exons in a correct order. Cis-Elements Involved in Splicing 3’, 5’, and Branch Splice Sites The typical human gene contains an average of eight exons. Internal exons average 145 nucleotides in length, and introns average more than 10 times this size and can be much larger [4, 5]. Exons are defined by three short and degenerate classical splice-site sequences 3’ and 5’ splice sites at the intron/exon borders, and the branch splice site within introns (Fig. (2)). Components of the basal splicing machinery bind to the classical splice-site sequences and promote assembly of the multicomponent splicing complex known as the spliceosome. These consensus splice sites are relatively easy to identify from alignments of exon–intron boundary sequences (Fig. (2)). Splicing Enhancers and Repressors In addition to the splice sites, exons are defined by other cis-acting regulatory elements, which can be divided into four functional categories: 1) Exonic Splicing Enhancers (ESEs), 2) Exonic Splicing Silencers (ESSs), 3) Intronic Splicing Enhancers (ISEs) also known as intronic activators of splicing (IASs) and 4) Intronic Splicing Silencers (ISSs) (Fig. (2)). At exons sequence level, ESEs activate exons recognition and promote their inclusion in mature transcripts, whereas ESSs repress inclusion in mature transcripts [6, 7]. In the other hand, at intron sequence level, ISEs activate inclusion to the adjacent exons [6, 8, 9], whereas ISSs inhibit exon definition by recruit splicing repressors that directly bind and occlude critical cis-acting elements of regulated exons [6, 10] or by recruiting repressors to binding sites that flank regulated exons creating a zone of silencing [6, 10].

© 2008 Bentham Science Publishers Ltd.


Aguado et al.

Trans-Elements Involved in Splicing The spliceosome is composed of five small nuclear ribonucleoproteins (snRNPs) and more than other 150 proteins, including kinases, phosphatases and helicases, many of which are required for spliceosomal function, as well as associated proteins such as mRNA-export factors and transcription factors [2, 11]. The branch and 5 splice sites (Fig. (2)) serve as binding places for the RNA components of U2 and U1 small nuclear ribonucleoproteins (snRNPs), respectively. This RNA:RNA base pairing determines the precise joining of exons at the correct nucleotides. Exons and introns contain diverse sets of enhancer and suppressor elements that refine bona fide exon recognition. At exon level, some ESEs bind SR proteins and recruit and stabilize binding of spliceosome components such as U2AF, other ESEs bind different splicing enhancer proteins which contribute to the correct splicing process. In addition, some ESSs bind protein components of heterogeneous nuclear ribonucleoproteins (hnRNP) to repress exon usage. At intron level, some ISEs and ISS bind auxiliary splicing factors that are not normally associated with the spliceosome to regulate AS (Fig. (2)). SPLICING CODE ALTERATIONS AND DISEASE The mechanisms causing altered splicing can involve disruption of either cis-elements, within the affected gene, or trans-elements that are required for normal splicing or splicing regulation. The distinction between cis- and transelements effects has important mechanistic implications. Effects in cis have a direct impact on the expression of only one gene, whereas effects in trans have the potential to affect the expression of multiple genes. Therefore, a failure or deregulation of either trans or cis-elements could flow in a pathology. Cis-Elements Alterations Cis-elements mutations can affect non-coding and coding regions. Mutations located in non-coding regions, such those affecting 5 and 3 splice sites, branch sites or polyadenylation signals, are frequently the cause of hereditary disease. Mutations on the ORF of a single gene can generate synonymous, nonsense or missense mutations. Fig. (1). Different types of possible Alternative Splicing processes. Modified from Blencowe, B. J. 2006 [74].

Synonymous single-nucleotide polymorphisms (SNPs) located in coding regions (cSNPs), although seemingly

Fig. (2). The Splicing Code. Cis-elements sequences (Branch site, 3’ and 5’ splice sites, ESEs, ESSs, ISEs and ISSs) within and around introns and exons are required for recognition and regulation by trans-elements (spliceosome). Modified from Wang, G. S. et al 2007 [2].

Differential Splicing, Disease and Drug Targets


translationally silent, could have a profound influence on AS. In fact, cSNPs can disrupt (or eventually create) ESE’s and ESS’s; create new splice sites or strengthen cryptic ones; alter pre-mRNA secondary structures important for exondefinition; and, conceivably, modify the pausing architecture of a gene, causing changes in RNAPol II processivity [12, 13], which might in turn affect splice site choice. These defects are not exclusive of cSNPs: nonsense and missense mutations as well as exonic deletions or insertions can affect AS in similar ways. In fact, it has recently been proposed that 60% of mutations that cause disease do so by disrupting the splicing code [2, 14], rather than by the predicted disruption of the protein reading frame. Table (1) summarizes examples of hereditary disorders caused by Table 1.

243

exonic point mutations that affect AS. Nonsense mutations may provoke premature termination codons, which in the case of being early on the ORF, this mRNA normally is targeted for degradation by NMD, which involves an mRNA quality-control step [12, 15, 16], disabling the mutated mRNA. Missense mutations generate an amino-acid change, which might have functional relevant implications, such as different protein localization, substrate affinity or ligand binding. Trans-Elements Alterations Mutations and non-genetics alterations of factors required for splicing have been implicated in the pathophysiology of human disease [5, 6]. In fact, they seem to be

Diseases Due to Aberrant Splicing

Disease

OMIN number

Elements alterations

Comments

Reference

Acute intermittent porphyria

#176000

cis-element

Nucleotide substitutions (C to G) in exon 3 of porphobilinogen deaminase

[75]

-thalassemia

#603902

cis-element

Mutations in the intron 2 of -globin that generates a cryptic 3´ acceptor site

[55]

Bilateral periventricular nodular heterotopia (BPNH)

#300049

cis-element

Missense mutation in exon 6 (G to C) of Filamin A (FLNA) gene

[76]

Breast and ovarian cancer

+113705

cis-element

Nonsense mutation of BRCA1 in exon 18 (G to T)

[41]

Leukemias and sarcomas

*605221

trans-element

Interaction of FUS-interacting protein 1 (FUSIP1/SRp38/SRRp40) with FUS is disrupted

[77]

Liposarcomas, acute myeloid leukemia (AML)

*137070

trans-element

Translocation of FUS gene (TLS)

[78, 79]

Hepatocellular carcinoma

*604739

trans-element

Autoantibodies to the splicing factor HCC1

[80]

Papillary renal cell carcinoma

*605199

trans-element

Translocation of SFPQ (splicing factor proline- and glutamine-rich) and fused with the TFE3 gene.

[81]

Cystic fibrosis (CF)

#219700

cis-element

Four nonsense mutations of CFTR gene in exons 3 (G to U, and C to T), 11 (C to T) and 20 (G to A)

[24]

Fanconi anemia (FA)

#227650

cis-element

Nonsense mutations of FANCG in exon 8 (C to T)

[82]

Hemophilia A

+306700

cis-element

Nonsense mutations of Factor VIII in exons 19 (G to T) and 22 (C to T)

[24]

Metachromatic leukodystrophy

#250100

cis-element

Missense mutation of Arylsulfatase A in exon 8 (C to T)

[83]

trans-element #160900

Sequestration of CUG binding proteins (CUGBP1) by trinucleotide repeat disorders (CUG)n>50 in DMPK gene.

[84]

Myotonic dystrophy 1 (DM1)

trans-element

Sequestration of MBNL1 (MBNL) proteins

[85, 86]

trans-element

More than thirty conserve mutations in genes involved in snRNP function

[28, 29]

cis-element

Deletion complete of SMN1

[35]

cis-element

Nonsense mutations of SMN1 in exon 3 (G to A)

[87]

cis-element

Nucleotide substitutions (C to T) in SMN2 disrupts an ESE in exon 7 that causes exon skipping

[39]

Cancer

Retinitis pigmentosa

Spinal muscle atrophy (SMA)

#268000

#253300


implicated in a high range of pathologies, including cancer, blindness, and muscular distrophies [6]. Trans-elements splicing mutations can affect the function of the basal splicing machinery or factors that regulate AS. Mutations that affect the basal splicing machinery have the potential to affect splicing of all pre-mRNAs, whereas mutations that affect a regulator of AS will affect only the subset of premRNAs that are targets of the regulator. Table (1) summarizes examples of splicing trans-element factors associated with human diseases. Pathologies Due to AS Mis-Regulation There are an increasing number of diseases generated by alterations on the splicing code, and many more are expected to be described as we increase our knowledge on the different AS isoforms of the human genome. Some of the better described are: Myotonic Dystrophy Myotonic Dystrophy Type 1 (DM1) is the most common form of adult muscular dystrophy. It is an autosomal dominant neuromuscular disease associated with CTG repeat expansion in the 3’ untranslated region of the DM protein kinase (DMPK) gene. A key molecular feature of DM1 is the misregulation of developmentally regulated AS for a subset of genes, such that embryonic and neonatal splicing patterns are retained in adult myotonic dystrophy tissues [2, 17-19]. Disease symptoms such as myotonia and insulin resistance result from the inappropriate expression of embryonic proteins in adult tissues. This is one of the best examples of disease caused by alteration of trans-elements which are involved in altered splicing of many other non-related genes. The expanded CUG-RNA disrupts normal postnatal AS transitions that are regulated by two families of proteins: the MBNL and CELF families. The best characterized members of these families are MBNL1 and CUGBP1, which were first identified as CUG-repeat RNA binding proteins. For the genes tested, these two proteins regulate the same splicing events antagonistically by binding to separate regulatory elements. The mechanism of normal postnatal transitions seems to involve a loss of nuclear CUGBP1 owing to decreased protein expression [2, 20, 21], and a gain of nuclear MBNL1 activity owing to translocation from the cytoplasm [2, 20]. The activities of both proteins are disrupted in DM1 by the toxic RNA. Nuclear MBNL1 is depleted as a result of its sequestration into RNA foci, whereas CUGBP1 steady-state levels increase owing to phosphorylation and increased protein half-life [2, 22]. Mouse models support a primary role for loss of MBNL1 function as well as a gain of CUGBP1 function in the splicing abnormalities. Cystic Fibrosis Cystic fibrosis (also known as CF, Mucoviscoidosis, or Mucoviscidosis) is a hereditary disease that affects the exocrine (mucus) glands of the lungs, liver, pancreas, and intestines, causing progressive disability due to multisystem failure abnormalities. CF is one of the most common lifeshortening, childhood-onset inherited diseases. In the United States, 1 in 3,900 children is born with CF. It is most common among Europeans and Ashkenazi Jews; where one in twenty-two people of European descents are carriers of

Aguado et al.

one gene for CF, making it the most common genetic disease in these populations. The disease is linked with the disruption of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene. This gene encompasses approximately 180,000 base pairs on the long arm of chromosome 7. The most common mutation is a deletion (F508) of three nucleotides that results in a loss of the amino acid phenylalanine (F) at the 508th position on the protein [23]. However, currently more than 1000 disease-associated mutations in CFTR gene have been described in the coding sequence, messenger RNA splice signals, and other regions. Focusing our attention in those mutations that affect RNA splice signals, scientific findings have unraveled the presence of SNPs that affect cis-elements involved in splicing all over the CFTR gene. In fact, there are examples of mutations that affect ESEs elements in exons 3, 11 and 20 [24] and examples of mutations that affect intronic elements, as is the case of mutation 3849+10 kb C3T mutation in intron 19, which lead to inclusion of a cryptic exon of 84-nucleotides [25]. Retinitis Pigmentosa Retinitis pigmentosa (RP) is one of the most common forms of inherited retinal degeneration [26] affecting 1 in 4000 people worldwide. This disorder is characterized by the progressive loss of photoreceptor cells and may eventually lead to blindness [27]. RP is caused by conserve mutations (more than thirty) in genes involved in snRNP function [2, 28, 29] such as HPRP3, PRPF31 and PRPC8, which encode proteins required for proper assembly and function of the U4-U5-U6-snRNP of the spliceosome component [30-32]. The failure of this component generates a fault in transelements of the splicing phenomenon. Spinal Muscular Atrophy Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disorder characterized by degeneration of the anterior horn cells of the spinal cord motor neurons leading to symmetrical muscle weakness and atrophy. SMA is the second most common lethal autosomal recessive disease in Caucasians after cystic fibrosis [33], specially on childhood. This disease is caused by homozygous disruption of the survival motor neuron 1 (SMN1) gene by deletion, conversion, or mutation [34]. SMN1 gen product is involved in snRNP assembly. SMA occurs due to the complete deletion of SMN1 in 96% of cases [33, 35], because the deletion of this gene prevents assembly of the U1 RNP complexes in the cytoplasm the results is a global defects in the binding of trans-elements to the pre-mRNA molecule [36], and loss of snRNP production has been directly linked with this disease [37]. The duplicated gene SMN2 is transcribed when SMN1 is deleted but the SMN2 gene does not completely compensate for the loss of SMN1 function. SMN2 may contain as well nucleotide substitutions which do not alter the protein coding sequence although one of the nucleotide substitutions (C to U) disrupts an ESE in exon 7 that causes a exon skipped in the majority of SMN2 mRNAs [38, 39]. As a result SMN2 mRNA encodes a truncated protein missing the C-terminal 16 residues with the consequent loss of functionality. Thus,


low but some expression of SMN2 generates a less severe disease. Cancer The development of many cancer diseases is associated with splicing alterations. Cancer-specific alterations in splice site selection affect genes controlling cellular proliferation (e.g., FGFR2, p53, MDM2, FHIT, and BRCA1), cellular adhesion, invasion (e.g., CD44, Ron) angiogenesis (e.g., VEGF), and apoptosis (e.g., Fas, Bcl-x, and caspase-2). The development or progression of cancer can be attributed to cis-element mutations within a single gene or trans-element mutations that affect most gene encoding. Cis-element mutations that affect the splicing of proto-oncogenes, tumour suppressors and DNA repair genes can have multiple roles in cancer initiation and progression [40], for example a BRCA1 nonsense mutation causes exon skipping by the loss of a functional ESE element [41]. But most cancer associated splicing alterations affect trans-elements. These splicing factors most commonly associated with cancer belong to the SR protein family, as a result of changes in SR protein phosphorylation [42, 43]. Other examples of trans-element factors that affect AS in cancer include ASF/SF2 and PTB. SPLICING AND DRUGS Because alterations in RNA splicing can cause many different diseases [5], characterization of these splice specific alterations can provide new therapeutic targets. Information on AS has been accumulated at a rapid rate during the last years, but the core drug discovery processes still entail techniques that cannot distinguish between splice variants. If the phenomenon of AS is ignored, drug discovery process is exposed to only a fraction of the actual proteomic world and therefore misses many potential protein targets [44]. AS has big impact on drug development and on diagnostic applications. Splice variants may have a different function due to different regulatory properties and/or structural changes that create new domains. Moreover, soluble variants with therapeutic or disease-related functions may be naturally occurring in specific tissues, so they may be candidates for drug targets. In this context, a drug may target various splice variants causing side effects, so an effective drug is needed to target specifically the splice variant of interest. The recognition of the importance of splicing has proved that splicing reactions are potential therapeutic targets. Mutations causing human diseases may affect splice sites as well as regulatory sequences leading to the production of defective or altered proteins [6]. Thus, targeting either the mutated sequences or the factors that bind them may prove to be a valuable strategy to correct aberrant splicing, and many different approaches, from conventional smallmolecules drugs to RNA-based gene therapy have been used. RNA-based strategies offer a series of novel therapeutic applications, including altered processing of the target premRNA transcript, reprogramming of genetic defects through mRNA repair, and the targeted silencing of allele- or isoform-specific gene transcripts.


245

Targeting Protein Isoforms The first approach in the therapy of a particular aberrant splicing disease is the specific inhibition/blockage of the altered protein with a specific drug. An example of this approach can be cyclo-oxigenases (COX) enzymes which function is the catalyses of the main reaction of prostaglandin synthesis. There are two genes encoding COX enzymes (COX1 and COX2), and it has been recently discovered that these genes are able to carry out AS [45-48]. COX1 was considered a constitutive gene which product is related to the synthesis of physiologically relevant prostanoids such as those that regulate the stomach mucosa and platelets aggregation. By contrast COX2 was thought to be an inducible gene in response to inflammation, fever or injury [49-51]. Non-steroidal anti-inflammatory drugs (NSAIDs), such as Phenacetin, have been largely used to trait the inflammation, pain and fever. These drugs are thought to inhibit the two well known products of COX1 and COX2 genes and scientists are trying to improve these drugs to reduce secondary effects due to their broad range of action. Therefore, the discovery of various alternatively spliced products of these two genes open a new point of view in the use of specific treatments for pain/inflammation. Now, it is possible to study the implication of each splice variant in specific pain pathways and thus it will be possible to inhibit a specific kind of pain avoiding undesired side effects. For example, COX-3, a recent discovered isoform produced by AS (intron 1 reteined) of COX1 gene, is thought to be implicated in the control of fever, because of its brain distribution and the inhibition by some NSAIDs fever specific (Fig. (3)). Another therapy strategy to correct aberrant splice variants is the use of specific antibodies against proteins regions which can be controlled by AS due to exon insertion/exclusion or intron retention leading to the modification of some domains in the final protein. This particular domain or region can be useful in the design of antibodies which can discriminate one splice variant from the others. For example, the human CD44 gene encodes type 1 transmembrane glycoproteins involved in cell to cell and cell to matrix interactions. This gene undergoes AS generating at least 20 different proteins that may suffer many post-translational modifications like glycosylation (N- or Oglycosylation) and phosphorylation. Some CD44 isoforms decorated with heparin sulphate side chains bind growth factors and can promote growth factor receptor-mediated signaling [52, 53]. Of special interest is the splice variant CD44v6 (generated by exon inclusion) which is overexpressed in many different tumors. The use of specific antibodies against the domain encoded by exon v6 in combination with radionuclides (e.g. 186 Re) made radiotherapy more specific in killing tumor cells disabling sideeffects (Fig. (3)) [52-54]. Targeting Specific mRNA RNA targeting is emerging as a powerful alternative to conventional DNA gene replacement therapies for the treatment of genetic disorders. The potential of such approaches ranges from elimination of the mRNA in


Fig. (3). Therapeutic approaches against protein isoforms. A) COX3 enzyme is generated by AS of the COX1 gene due to intron 1- retention. B) CD44v6 protein is a splice variant that contain a specific domain (v6). Specific antibodies linked with radionuclides against this specific domain may kill tumour cells that overexpressed this protein.

question, to modification of the mature mRNA product by the removal or addition of natural elements or exons, and to repair the mRNA transcript by the addition of foreign mRNA elements to create a chimeric gene product [55]. RNA interference (RNAi) and antisense oligonucleotides, which depend on RNase-H mechanism, induce the degradation of mRNA, whereas steric-blocker oligonucleotides physically prevent or inhibit the progression of splicing or the translation machinery. RNA Interference (RNAi) RNAi has become a powerful tool in functional and medical genomic research through directed post-transcriptional gene silencing. The discovery that 21-23 nucleotide RNA duplexes, known as small interfering RNAs (siRNAs), can knockdown the homologous mRNAs in mammalian cells has revolutionized many aspects of drug discovery including down-regulation of disease-associated splicing isoforms. In addition, RNAi-mediated silencing of splicing regulators has the potential to define the complex network of AS regulation and to analyze gene function [56]. RNAi has been used for targeting disease-linked splicing isoforms. For example, in the case of Bcl-x, a member of Bcl-2 gene family, that undergoes AS to generate two isoforms, Bcl-xL and Bcl-xS (Fig. (4)). Bcl-xL is antiapoptotic while forced over-expression of Bcl-xS sensitizes cells to a variety of antineoplastic agents and radiation. Bcl-xL

Aguado et al.

Fig. (4). RNA interference (RNAi)-mediated down-regulation of a splicing isoform. Bcl-x undergoes AS to generate two major isoforms, Bcl-xL (anti-apoptotic) and Bcl-xS (pro-apoptotic). A siRNA which recognizes the specific sequence of Bcl-xL induces that RNA to degradation.

specific small interfering RNA down-regulates Bcl-xL protein and inhibit the proliferation of 5-fluorouracil and tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-resistant cells [57]. Antisense Oligonucleotides Traditionally, antisense oligonucleotides have been employed to down-regulate gene transcription. On the basis of mechanism of action, two classes of antisense oligonucleotide can be discerned: (a) the RNase H-dependent oligonucleotides, which induce the degradation of mRNA; and (b) the steric-blocker oligonucleotides, which physically prevent or inhibit the progression of splicing or the translational machinery [58]. Oligonucleotide-assisted RNase Hdependent reduction of targeted RNA expression can be quite efficient, reaching 80-95% down-regulation of protein and mRNA expression. In contrast to the steric-blocker oligonucleotides, RNase H-dependent oligonucleotides can inhibit protein expression when targeted to virtually any region of the mRNA. Most steric-blocker oligonucleotides are efficient only when targeted to the 5'- or AUG initiation codon region. Steric blockade of translation can be demonstrated by the arrest of the polypeptide chain elongation, as shown by Dias et al. in 1999 [58]. The optimal use of antisense oligonucleotides in the treatment of disease requires the resolution of problems relating to the effective design and efficient target delivery. Reprogramming the Splicing The reprogramming of splicing is a new form of therapy that modifies mRNA without directly changing the sequence of the gene. This strategy can be sub-divided into three different approaches: drugs against splicing regulators,


modifying the processing of the mRNA, and altering mRNA sequence (trans-splicing). Drugs Against Splicing Regulators The use of small-molecule drug therapy is an attractive approach to modifying splicing patterns because of the relative ease of delivery and dosage control [2]. The most common regulators are the serine-arginine-rich RNA binding proteins (SR proteins) and the heterogeneous nuclear ribonucleoproteins (hnRNPs). They modulate splice-site choice by interacting with components of the splicing machinery and binding to the exonic and intronic cis-element signals [59]. The phosphorylation status of SR proteins affects their RNA binding specificity, protein-protein interactions and intracellular distribution, so small molecules that affect the activities of these enzymes can be used to alter splicing patterns (Fig. (5)) [2]. Numerous studies have reported several approaches allowing correction of aberrant splicing events by targeting the splicing regulators whose binding is affected by the mutation. Blanchette and colleagues [60] tackled the identification of targets of four splicing regulators in D melanogaster with a splicing-sensitive microarray, while Soret et al. [61] screened for chemical compounds that directly bind to SR proteins in human cells and interfere with spliceosomal assembly. Members of the SR protein family are thought to play a major role in the regulation of HIV-1 pre-mRNA splicing. To express key viral proteins, HIV-1 uses a combination of several alternative 5ánd 3´splice sites to generate more than 40 different mRNAs. The choice of these sites depends on specific interaction between HIV pre-mRNA sequences and trans-element factors, SR proteins and hnRNPs [62]. Bakkour et al [63] showed that an indole derivative (IDC16) that interferes with exonic splicing enhancer activity of the SR protein splicing factor SF2/ASF suppresses the production of key viral proteins, thereby compromising subsequent synthesis of full-length HIV-1 pre-mRNA and assembly of infectious particles. IDC16 can efficiently block HIV-1 viral production in peripheral blood mononuclear cells, or


247

PBMCs, or macrophages infected with different laboratory strains or clinical isolates from patients resistant to anti-HIV multitherapies. Modifying the Splice-Process of the Pre-mRNA By using modified DNA or RNA oligonucleotides it is possible to alter an exon skipping/inclusion caused by a silent mutation, which has altered the consensus splice sitesequences or the enhancers/inhibitors-sequences, thus guiding the spliceosome to the right splice variant [64]. These oligonucleotides have been named Splice-Switching Oligonucleotides (SSOs). Unlike antisense down-regulation of gene expression via RNAse H or RNA interference degradation pathways, SSOs modulate AS of targeted pre-mRNA, up-regulating expression of desirable protein isoforms, while down-regulating undesirable isoforms. SSOs that block aberrant splice sites can restore normal splicing, whereas those targeting alternative splice sites can switch splicing patterns from detrimental to beneficial isoforms or produce non-functional mRNAs that lead to gene knockdown [65]. Exon skipping is an approach that uses SSOs to modulate splicing by hiding specific sites essential for exon inclusion from the splicing machinery. An example of this approach is the induction of the expression of the recent discovered splice variant of the TNF receptor 2 gene (TNFR2). In inflammatory diseases like collagen-induced arthritis (CIA) or TNF- induced hepatitis has been discovered a weak over-expression of the novel soluble-splice variant of the TNFR2 lacking the exon 7 of the normal receptor. Therefore, the soluble protein can sequester some of the TNF- responsible of many of the symptoms of these pathologies [66]. Graziewicz et al [66] have developed an efficient SSO capable of induce exon 7 skipping of TNFR2 and therefore increasing the amount of the soluble receptor that can block TNF- signal (Fig. (6A)). These SSOs were much more effective in reducing TNF- effect than the drugs commonly used for the treatment of such inflammatory disease. Actually, SSO exon skipping is currently one of the most promising therapeutic approaches for Duchenne muscular dystrophy (DMD)[67]. The disease is caused by mutations in

Fig. (5). Rescuing aberrant splicing with small-molecule drugs. A gene that is normally spliced with four exons is represented. The filled circles represent splicing regulators that act at the sites depicted by the black bars to promote splicing. The filled rectangle represents part of an intron with a mutation (white vertical line) creating a binding site for a regulator (white circle) which activates a cryptic 5' splice site, leading to the splicing of an additional sequence into the final mRNA and the production of a defective protein. The therapy consists of a specific drug that abolishes binding of the new regulator and restores normal splicing.


the DMD gene that abolish the production of functional dystrophin. DMD deletions and duplications mainly occur in two hot spot regions, the major hot spot region (involving exon 45 to exon 53) and the minor hot spot region (between exon 2 and exon 20). The most notable example is exon 51 skipping. In DMD the open reading frame is disrupted, by deletion of exons 48-50 (the most common mutation), resulting in a premature stop codon and a truncated dystrophin. Specific SSOs hybridize to exon 51 and hide this exon to the splicing machinery, resulting in the splicing of exon 51 with its flanking intron. In this case, the approach restores the ORF generating a shorter but functional dystrophin protein. A successful first-in-man trial has recently been completed [68-70]. Using this approach it is also possible to block a cryptic splicing promote by an intron mutation. This is the case of thalassemia; -globin gene has a mutation in the intron 2 and because of this the spliceosome use a cryptic 3’ acceptor that produces the inclusion of a new exon [55]. SSOs can modify this wrong splicing blocking the cryptic acceptor sequence and therefore inducing the spliceosome to make the right splicing (Fig. (6B)) [55, 71]. In this way, it has also been

Aguado et al.

recently described exon inclusion using this strategy. This is the case of SMA caused by a deletion of the SMN1 gene. The severity of SMA is compensated for the expression of its paralogous gene SMN2. In many cases, SMN2 gene has a mutation in an ESE element that produces a SMN2 mRNA lacking exon 7 and therefore a truncated protein. Using SSOs that masks the mutated ESE of SMN2 pre-mRNA, and introducing a consensus one, the recovery of the normal splice has been demonstrated in cell lines and patient-derived cells (Fig. (6C)). Altering mRNA Sequence Trans-Splicing Another abnormality on mRNA splicing, apart of mutations in cis and trans-elements is the phenomenon known as trans-splicing. Trans-splicing is a natural process, although rare in mammals, which involves splicing between two separately transcribed mRNAs such that a composite transcript is produced. Manipulation of this process offers the potential for induction of isoform switching or the correction of mutations by conversion to a wild gene product. There are two common methodologies, spliceosome mediated RNA trans-splicing (SMaRT) and ribozyme mediated trans-splicing (Fig. (7)) [55].

Fig. (6). SSOs methods to restore normal or desired splicing. A) TNFR2 exon 7 skipping to over-express the natural soluble isoform of the receptor which reduce TNF- level in inflammatory sites. B) Blockage of the cryptic exon created by an intron-mutation in -globin gene using a SSO that restores the normal splice variant. C) The excluded exon 7 of the SMN2 gene may be included using a SSO that carries the ESE-consensus sequence for SF2/ASF protein.



249

Fig. (7). RNA Trans-splicing. (A) Correction of CF mutations in the CFTR gene using SMaRT. A PTM containing a binding domain, splicing domain and a coding domain incorporating exons 10-24 of wild-type CFTR mRNA binds to intron 9 of CFTR pre-mRNA containing disease-causing mutations (stars). SMaRT removes the mutant pre-mRNA so the reprogrammed transcript allows synthesis of a functional protein. (B) Ribozyme-mediated trans-splicing and its application to correct trinucleotide repeat expansions in myotonic dystrophy. Ribozymes containing a reduced number of CUG repeats are targeted to the mutant DMPK transcript. Binding of the ribozyme allows transsplicing and smaller CTG repeat expansion produce a non-toxic DMPK mRNA transcript.

SMaRT: An engineered pre-mRNA trans-splicing molecule (PTM) binds to target pre-mRNA in the nucleus such that it triggers trans-splicing in a process mediated by the spliceosome. The PTM has a 5´ binding sequence specific for the target, a splicing region that contains motifs necessary for the trans-splicing reaction to occur and a coding domain that includes the new or modified genetic information that will reprogram the target (Fig. (7)). Functional correction using spliceosome-mediated trans-splicing has been reported in several preclinical disease models, including cystic fibrosis, haemophilia A and X-linked immunodeficiency [55, 72]. SMaRT has several advantages over conventional gene therapy. As the gene is repaired rather than introduced, the spatial and temporal expression of the gene should be controlled by endogenous regulation. Other advantage is that PTM constructs are easily accommodated in current vector systems. As repair will only occur where the target transcript is expressed, adverse effects would not be anticipated in cells that were nonspecifically targeted during delivery. The main disadvantage is that a single PTM, in most cases, would not be able to address all the mutations in an affected population. Ribozyme-mediated trans-splicing: Ribozyme-mediated trans-splicing consists of a 5´ guide sequence complementary to the target sequence, the ribozyme domain, and a

3´terminal exon that is to be trans-spliced (Fig. (7)). Following binding, the ribozyme catalyses trans-splicing between the 3´ exons of the ribozyme and the 5´ target mRNA. In DM1, increased levels of trinucleotide repeat CUG expansion in the 3úntranslated region of the dystrophia myotonica-protein kinase (DMPK) gene, are responsible for the clinical condition. A specifically designed ribozyme was used to reduce the lenght of expansions from high to low CUG repeats, at the 3énd of DMPK transcripts [73]. As well as correcting disease-causing mutations, trans-splicing ribozymes have the potential to create chimeric gene transcripts by splicing foreign cDNA to a targeted mRNA [55]. ACKNOWLEDGEMENTS The laboratory is supported by grants from the Ministerio de Educación y Ciencia (Plan Nacional BFU2005-03683), the Comunidad de Madrid, the Fundación Ramón Areces and Genoma España. We also thank the Fundación Ramón Areces for Departmental support. BA holds a Ramón y Cajal Programme Fellowship and OV a FPI studentship from the Comunidad de Madrid. REFERENCES [1] [2]

Modrek, B.; Lee, C. Nat. Genet., 2002, 30, 13. Wang, G.S.; Cooper, T.A. Nat. Rev. Genet., 2007, 8, 749.

250 Infectious Disorders - Drug Targets 2008, Vol. 8, No. 4 [3] [4]

[5] [6] [7] [8]

[9] [10] [11] [12] [13] [14] [15] [16] [17]

Lewis, B.P.; Green, R.E.; Brenner, S.E. Proc. Natl. Acad. Sci. USA, 2003, 100, 189. Lander, E.S.; Linton, L.M.; Birren, B.; Nusbaum, C.; Zody, M.C.; Baldwin, J.; Devon, K.; Dewar, K.; Doyle, M.; FitzHugh, W.; Funke, R.; Gage, D.; Harris, K.; Heaford, A.; Howland, J.; Kann, L.; Lehoczky, J.; LeVine, R.; McEwan, P.; McKernan, K.; Meldrim, J.; Mesirov, J.P.; Miranda, C.; Morris, W.; Naylor, J.; Raymond, C.; Rosetti, M.; Santos, R.; Sheridan, A.; Sougnez, C.; Stange-Thomann, N.; Stojanovic, N.; Subramanian, A.; Wyman, D.; Rogers, J.; Sulston, J.; Ainscough, R.; Beck, S.; Bentley, D.; Burton, J.; Clee, C.; Carter, N.; Coulson, A.; Deadman, R.; Deloukas, P.; Dunham, A.; Dunham, I.; Durbin, R.; French, L.; Grafham, D.; Gregory, S.; Hubbard, T.; Humphray, S.; Hunt, A.; Jones, M.; Lloyd, C.; McMurray, A.; Matthews, L.; Mercer, S.; Milne, S.; Mullikin, J.C.; Mungall, A.; Plumb, R.; Ross, M.; Shownkeen, R.; Sims, S.; Waterston, R.H.; Wilson, R.K.; Hillier, L.W.; McPherson, J.D.; Marra, M.A.; Mardis, E.R.; Fulton, L.A.; Chinwalla, A.T.; Pepin, K.H.; Gish, W.R.; Chissoe, S.L.; Wendl, M.C.; Delehaunty, K.D.; Miner, T.L.; Delehaunty, A.; Kramer, J.B.; Cook, L.L.; Fulton, R.S.; Johnson, D.L.; Minx, P.J.; Clifton, S.W.; Hawkins, T.; Branscomb, E.; Predki, P.; Richardson, P.; Wenning, S.; Slezak, T.; Doggett, N.; Cheng, J.F.; Olsen, A.; Lucas, S.; Elkin, C.; Uberbacher, E.; Frazier, M.; Gibbs, R.A.; Muzny, D.M.; Scherer, S.E.; Bouck, J.B.; Sodergren, E.J.; Worley, K.C.; Rives, C.M.; Gorrell, J.H.; Metzker, M.L.; Naylor, S.L.; Kucherlapati, R.S.; Nelson, D.L.; Weinstock, G.M.; Sakaki, Y.; Fujiyama, A.; Hattori, M.; Yada, T.; Toyoda, A.; Itoh, T.; Kawagoe, C.; Watanabe, H.; Totoki, Y.; Taylor, T.; Weissenbach, J.; Heilig, R.; Saurin, W.; Artiguenave, F.; Brottier, P.; Bruls, T.; Pelletier, E.; Robert, C.; Wincker, P.; Smith, D.R.; DoucetteStamm, L.; Rubenfield, M.; Weinstock, K.; Lee, H.M.; Dubois, J.; Rosenthal, A.; Platzer, M.; Nyakatura, G.; Taudien, S.; Rump, A.; Yang, H.; Yu, J.; Wang, J.; Huang, G.; Gu, J.; Hood, L.; Rowen, L.; Madan, A.; Qin, S.; Davis, R.W.; Federspiel, N.A.; Abola, A.P.; Proctor, M.J.; Myers, R.M.; Schmutz, J.; Dickson, M.; Grimwood, J.; Cox, D.R.; Olson, M.V.; Kaul, R.; Raymond, C.; Shimizu, N.; Kawasaki, K.; Minoshima, S.; Evans, G.A.; Athanasiou, M.; Schultz, R.; Roe, B.A.; Chen, F.; Pan, H.; Ramser, J.; Lehrach, H.; Reinhardt, R.; McCombie, W.R.; de la Bastide, M.; Dedhia, N.; Blocker, H.; Hornischer, K.; Nordsiek, G.; Agarwala, R.; Aravind, L.; Bailey, J.A.; Bateman, A.; Batzoglou, S.; Birney, E.; Bork, P.; Brown, D.G.; Burge, C.B.; Cerutti, L.; Chen, H.C.; Church, D.; Clamp, M.; Copley, R.R.; Doerks, T.; Eddy, S.R.; Eichler, E.E.; Furey, T.S.; Galagan, J.; Gilbert, J.G.; Harmon, C.; Hayashizaki, Y.; Haussler, D.; Hermjakob, H.; Hokamp, K.; Jang, W.; Johnson, L.S.; Jones, T.A.; Kasif, S.; Kaspryzk, A.; Kennedy, S.; Kent, W.J.; Kitts, P.; Koonin, E.V.; Korf, I.; Kulp, D.; Lancet, D.; Lowe, T.M.; McLysaght, A.; Mikkelsen, T.; Moran, J.V.; Mulder, N.; Pollara, V.J.; Ponting, C.P.; Schuler, G.; Schultz, J.; Slater, G.; Smit, A.F.; Stupka, E.; Szustakowski, J.; Thierry-Mieg, D.; Thierry-Mieg, J.; Wagner, L.; Wallis, J.; Wheeler, R.; Williams, A.; Wolf, Y.I.; Wolfe, K.H.; Yang, S.P.; Yeh, R.F.; Collins, F.; Guyer, M.S.; Peterson, J.; Felsenfeld, A.; Wetterstrand, K.A.; Patrinos, A.; Morgan, M.J.; de Jong, P.; Catanese, J.J.; Osoegawa, K.; Shizuya, H.; Choi, S.; Chen, Y.J. Nature, 2001, 409, 860. Faustino, N.A.; Cooper, T.A. Genes Dev., 2003, 17, 419. Garcia-Blanco, M.A.; Baraniak, A.P.; Lasda, E.L. Nat. Biotechnol., 2004, 22, 535. Del Gatto-Konczak, F.; Olive, M.; Gesnel, M.C.; Breathnach, R. Mol. Cell Biol., 1999, 19, 251. Del Gatto-Konczak, F.; Bourgeois, C.F.; Le Guiner, C.; Kister, L.; Gesnel, M.C.; Stevenin, J.; Breathnach, R. Mol. Cell Biol., 2000, 20, 6287. Del Gatto, F.; Plet, A.; Gesnel, M.C.; Fort, C.; Breathnach, R. Mol. Cell Biol., 1997, 17, 5106. Valcarcel, J.; Singh, R.; Zamore, P.D.; Green, M.R. Nature, 1993, 362, 171. Jurica, M.S.; Moore, M.J. Mol. Cell, 2003, 12, 5. Caceres, J.F.; Kornblihtt, A.R. Trends Genet., 2002, 18, 186. Roberts, G.C.; Gooding, C.; Mak, H.Y.; Proudfoot, N.J.; Smith, C.W. Nucleic Acids Res., 1998, 26, 5568. Lopez-Bigas, N.; Audit, B.; Ouzounis, C.; Parra, G.; Guigo, R. FEBS Lett., 2005, 579, 1900. Maquat, L.E.; Carmichael, G.G. Cell, 2001, 104, 173. Iborra, F.J.; Jackson, D.A.; Cook, P.R. Science, 2001, 293, 1139. Ranum, L.P.; Cooper, T.A. Annu. Rev. Neurosci., 2006, 29, 259.

Aguado et al. [18] [19] [20] [21] [22] [23] [24] [25]

[26] [27] [28] [29] [30]

[31]

[32]

[33] [34] [35] [36] [37]

[38] [39] [40] [41] [42] [43]

[44] [45] [46]

[47] [48] [49] [50] [51] [52]

Cho, D.H.; Tapscott, S.J. Biochim. Biophys. Acta, 2007, 1772, 195. Osborne, R.J.; Thornton, C.A. Hum. Mol. Genet., 2006, 15 Spec No 2, R162. Lin, X.; Miller, J.W.; Mankodi, A.; Kanadia, R.N.; Yuan, Y.; Moxley, R.T.; Swanson, M.S.; Thornton, C.A. Hum. Mol. Genet., 2006, 15, 2087. Ladd, A.N.; Stenberg, M.G.; Swanson, M.S.; Cooper, T.A. Dev. Dyn., 2005, 233, 783. Kuyumcu-Martinez, N.M.; Wang, G.S.; Cooper, T.A. Mol. Cell, 2007, 28, 68. Rowe, S.M.; Miller, S.; Sorscher, E.J. N. Engl. J. Med., 2005, 352, 1992. Liu, H.X.; Cartegni, L.; Zhang, M.Q.; Krainer, A.R. Nat. Genet., 2001, 27, 55. Chiba-Falek, O.; Kerem, E.; Shoshani, T.; Aviram, M.; Augarten, A.; Bentur, L.; Tal, A.; Tullis, E.; Rahat, A.; Kerem, B. Genomics, 1998, 53, 276. Hartong, D.T.; Berson, E.L.; Dryja, T.P. Lancet, 2006, 368, 1795. Farrar, G.J.; Kenna, P.F.; Humphries, P. EMBO. J., 2002, 21, 857. Briese, M.; Esmaeili, B.; Sattelle, D.B. Bioessays., 2005, 27, 946. Mordes, D.; Luo, X.; Kar, A.; Kuo, D.; Xu, L.; Fushimi, K.; Yu, G.; Sternberg, P., Jr.; Wu, J.Y. Mol. Vis., 2006, 12, 1259. Chakarova, C.F.; Hims, M.M.; Bolz, H.; Abu-Safieh, L.; Patel, R.J.; Papaioannou, M.G.; Inglehearn, C.F.; Keen, T.J.; Willis, C.; Moore, A.T.; Rosenberg, T.; Webster, A.R.; Bird, A.C.; Gal, A.; Hunt, D.; Vithana, E.N.; Bhattacharya, S.S. Hum. Mol. Genet., 2002, 11, 87. Vithana, E.N.; Abu-Safieh, L.; Allen, M.J.; Carey, A.; Papaioannou, M.; Chakarova, C.; Al-Maghtheh, M.; Ebenezer, N.D.; Willis, C.; Moore, A.T.; Bird, A.C.; Hunt, D.M.; Bhattacharya, S.S. Mol. Cell, 2001, 8, 375. McKie, A.B.; McHale, J.C.; Keen, T.J.; Tarttelin, E.E.; Goliath, R.; van Lith-Verhoeven, J.J.; Greenberg, J.; Ramesar, R.S.; Hoyng, C.B.; Cremers, F.P.; Mackey, D.A.; Bhattacharya, S.S.; Bird, A.C.; Markham, A.F.; Inglehearn, C.F. Hum. Mol. Genet., 2001, 10, 1555. Wirth, B. Hum. Mutat., 2000, 15, 228. Lunn, M.R.; Wang, C.H. Lancet, 2008, 371, 2120. Rodrigues, N.R.; Owen, N.; Talbot, K.; Ignatius, J.; Dubowitz, V.; Davies, K.E. Hum. Mol. Genet., 1995, 4, 631. Rossoll, W.; Kroning, A.K.; Ohndorf, U.M.; Steegborn, C.; Jablonka, S.; Sendtner, M. Hum. Mol. Genet., 2002, 11, 93. Winkler, C.; Eggert, C.; Gradl, D.; Meister, G.; Giegerich, M.; Wedlich, D.; Laggerbauer, B.; Fischer, U. Genes Dev., 2005, 19, 2320. Cartegni, L.; Krainer, A.R. Nat. Genet., 2002, 30, 377. Lorson, C.L.; Hahnen, E.; Androphy, E.J.; Wirth, B. Proc. Natl. Acad. Sci. USA, 1999, 96, 6307. Srebrow, A.; Kornblihtt, A.R. J. Cell Sci., 2006, 119, 2635. Mazoyer, S.; Puget, N.; Perrin-Vidoz, L.; Lynch, H.T.; SerovaSinilnikova, O.M.; Lenoir, G.M. Am. J. Hum. Genet., 1998, 62, 713. Karni, R.; de Stanchina, E.; Lowe, S.W.; Sinha, R.; Mu, D.; Krainer, A.R. Nat. Struct. Mol. Biol., 2007, 14, 185. Ghigna, C.; Giordano, S.; Shen, H.; Benvenuto, F.; Castiglioni, F.; Comoglio, P.M.; Green, M.R.; Riva, S.; Biamonti, G. Mol. Cell, 2005, 20, 881. Levanon, E.Y.; Sorek, R. Targets, 2003, 2, 109. Kowalski, M.L.; Borowiec, M.; Kurowski, M.; Pawliczak, R. Allergy, 2007, 62, 628. Censarek, P.; Steger, G.; Paolini, C.; Hohlfeld, T.; Grosser, T.; Zimmermann, N.; Fleckenstein, D.; Schror, K.; Weber, A.A. Thromb. Haemost., 2007, 98, 1309. Kis, B.; Snipes, J.A.; Gaspar, T.; Lenzser, G.; Tulbert, C.D.; Busija, D.W. Inflamm. Res., 2006, 55, 274. Schneider, C.; Boeglin, W.E.; Brash, A.R. Biochem. J., 2005, 385, 57. Warner, T.D.; Mitchell, J.A. Proc. Natl. Acad. Sci. USA, 2002, 99, 13371. Vane, J.R. J. Physiol. Pharmacol., 2000, 51, 573. Mitchell, J.A.; Warner, T.D. Br. J. Pharmacol., 1999, 128, 1121. Bennett, K.L.; Jackson, D.G.; Simon, J.C.; Tanczos, E.; Peach, R.; Modrell, B.; Stamenkovic, I.; Plowman, G.; Aruffo, A. J. Cell Biol., 1995, 128, 687.

Differential Splicing, Disease and Drug Targets [53]

[54] [55] [56] [57] [58] [59] [60] [61]

[62] [63]

[64] [65] [66] [67] [68] [69]

[70]


Bennett, K.L.; Modrell, B.; Greenfield, B.; Bartolazzi, A.; Stamenkovic, I.; Peach, R.; Jackson, D.G.; Spring, F.; Aruffo, A. J. Cell Biol., 1995, 131, 1623. Heider, K.H.; Kuthan, H.; Stehle, G.; Munzert, G. Cancer Immunol. Immunother., 2004, 53, 567. Wood, M.; Yin, H.; McClorey, G. PLoS Genet., 2007, 3, e109. Gaur, R.K. Biotechniques, 2006, Suppl, 15. Zhu, H.; Guo, W.; Zhang, L.; Davis, J.J.; Teraishi, F.; Wu, S.; Cao, X.; Daniel, J.; Smythe, W.R.; Fang, B. Mol. Cancer Ther., 2005, 4, 451. Dias, N.; Stein, C.A. Mol. Cancer Ther., 2002, 1, 347. Yeo, G.W. Genome Biol., 2005, 6, 240. Blanchette, M.; Green, R.E.; Brenner, S.E.; Rio, D.C. Genes Dev., 2005, 19, 1306. Soret, J.; Bakkour, N.; Maire, S.; Durand, S.; Zekri, L.; Gabut, M.; Fic, W.; Divita, G.; Rivalle, C.; Dauzonne, D.; Nguyen, C.H.; Jeanteur, P.; Tazi, J. Proc. Natl. Acad. Sci. USA, 2005, 102, 8764. Freed, E.O.; Mouland, A.J. Retrovirology, 2006, 3, 77. Bakkour, N.; Lin, Y.L.; Maire, S.; Ayadi, L.; Mahuteau-Betzer, F.; Nguyen, C.H.; Mettling, C.; Portales, P.; Grierson, D.; Chabot, B.; Jeanteur, P.; Branlant, C.; Corbeau, P.; Tazi, J. PLoS Pathog., 2007, 3, 1530. Resina, S.; Kole, R.; Travo, A.; Lebleu, B.; Thierry, A.R. J. Gene Med., 2007, 9, 498. Kurreck, J. Eur. J. Biochem., 2003, 270, 1628. Graziewicz, M.A.; Tarrant, T.K.; Buckley, B.; Roberts, J.; Fulton, L.; Hansen, H.; Orum, H.; Kole, R.; Sazani, P. Mol. Ther., 2008, Yin, H.; Lu, Q.; Wood, M. Mol. Ther., 2008, 16, 38. Aartsma-Rus, A.; van Ommen, G.J. RNA, 2007, 13, 1609. van Deutekom, J.C.; Janson, A.A.; Ginjaar, I.B.; Frankhuizen, W.S.; Aartsma-Rus, A.; Bremmer-Bout, M.; den Dunnen, J.T.; Koop, K.; van der Kooi, A.J.; Goemans, N.M.; de Kimpe, S.J.; Ekhart, P.F.; Venneker, E.H.; Platenburg, G.J.; Verschuuren, J.J.; van Ommen, G.J. N. Engl. J. Med., 2007, 357, 2677. Arechavala-Gomeza, V.; Graham, I.R.; Popplewell, L.J.; Adams, A.M.; Aartsma-Rus, A.; Kinali, M.; Morgan, J.E.; van Deutekom, J.C.; Wilton, S.D.; Dickson, G.; Muntoni, F. Hum. Gene Ther., 2007, 18, 798.



[71] [72] [73] [74] [75] [76] [77] [78] [79] [80] [81] [82] [83] [84]

[85] [86]

[87]

251

Kole, R.; Williams, T.; Cohen, L. Acta. Biochim. Pol., 2004, 51, 373. Garcia-Blanco, M.A. Prog. Mol. Subcell. Biol., 2006, 44, 47. Phylactou, L.A.; Darrah, C.; Wood, M.J. Nat. Genet, 1998, 18, 378. Blencowe, B.J. Cell, 2006, 126, 37. Buratti, E.; Dork, T.; Zuccato, E.; Pagani, F.; Romano, M.; Baralle, F.E. EMBO. J., 2001, 20, 1774. Tsuneda, S.S.; Torres, F.R.; Montenegro, M.A.; Guerreiro, M.M.; Cendes, F.; Lopes-Cendes, I. J. Mol. Neurosci., 2008, 35, 195. Yang, L.; Embree, L.J.; Hickstein, D.D. Mol. Cell Biol., 2000, 20, 3345. Crozat, A.; Aman, P.; Mandahl, N.; Ron, D. Nature, 1993, 363, 640. Ichikawa, H.; Shimizu, K.; Hayashi, Y.; Ohki, M. Cancer Res., 1994, 54, 2865. Imai, H.; Chan, E.K.; Kiyosawa, K.; Fu, X.D.; Tan, E.M. J. Clin. Invest., 1993, 92, 2419. Clark, J.; Lu, Y.J.; Sidhar, S.K.; Parker, C.; Gill, S.; Smedley, D.; Hamoudi, R.; Linehan, W.M.; Shipley, J.; Cooper, C.S. Oncogene, 1997, 15, 2233. Yamada, T.; Tachibana, A.; Shimizu, T.; Mugishima, H.; Okubo, M.; Sasaki, M.S. J Hum Genet., 2000, 45, 159. Hasegawa, Y.; Kawame, H.; Ida, H.; Ohashi, T.; Eto, Y. Hum. Genet., 1994, 93, 415. Roberts, R.; Timchenko, N.A.; Miller, J.W.; Reddy, S.; Caskey, C.T.; Swanson, M.S.; Timchenko, L.T. Proc. Natl. Acad. Sci. USA, 1997, 94, 13221. Kanadia, R.N.; Johnstone, K.A.; Mankodi, A.; Lungu, C.; Thornton, C.A.; Esson, D.; Timmers, A.M.; Hauswirth, W.W.; Swanson, M.S. Science, 2003, 302, 1978. Miller, J.W.; Urbinati, C.R.; Teng-Umnuay, P.; Stenberg, M.G.; Byrne, B.J.; Thornton, C.A.; Swanson, M.S. EMBO J., 2000, 19, 4439. Sossi, V.; Giuli, A.; Vitali, T.; Tiziano, F.; Mirabella, M.; Antonelli, A.; Neri, G.; Brahe, C. Eur. J. Hum. Genet., 2001, 9, 113.

252


Translation Controlled mRNAs: New Drug Targets in Infectious Diseases? Eva Diaz-Guerra*, Rolando Vernal*,¥, Walter Cantero*, Ernst W. Müllner$ and Jose A. Garcia,1 Sanz* *Centro de Investigaciones Biologicas-CSIC, Madrid, Spain, ¥Dentistry School, University of Chile, and $Max F. Perutz Laboratories, Department of Medical Biochemistry, Medical University of Vienna, Dr Bohr-Gasse 9, 1030 Vienna, Austria Abstract: Recent data from a series of laboratories has pinpointed the relevant role of translation control on the regulation of gene expression. In particular, an analysis of T cell activation has led to demonstrate that during this physiological transition about 20% of the regulated mRNAs are controlled at the translation level. Furthermore, modulating the host mRNA translation is one of the mechanisms used by infectious agents to achieve a productive infection. In the present review, we summarize the current knowledge on the translation machinery, the translational control mechanisms during the immune response, as well as the mechanisms used by different pathogens to avoid, inhibit or postpone the host response; and suggest that the analysis on genome-wide screening of the host-pathogen interactions, identifying translationally regulated mRNAs, might unravel new drug targets in infectious diseases.

GENERAL INTRODUCTION It has been widely established that all cells from a multicellular organism carry the same genetic information [1]. Notable exceptions are germinal cells with their haploid set of chromosomes and lymphocytes in which TCR or Ig loci undergo gene rearrangements with concomitant loss of genetic material. Thus, the wide range of phenotypes displayed by cells from different tissues and organs has been ascribed to differential gene expression [1]. From the beginning, more than 30 years ago, when differential utilization of genetic material started to be analyzed at the level of gene transcription, this field has continued to attract much attention [1,2,3]. It is obvious, however, that protein expression levels depend, in addition to transcription rates of the corresponding genes, on additional control mechanisms which include splicing [4], nuclear export [5], mRNA localization [6], transcript stability [7,8], miRNA [9], translational control [10], post-translational modifications (glycosylation, phosphorylation, myristilation, etc) [11] and protein processing and degradation [12,13,14]. Translational control is one of the steps regulating the amount of protein in a cell and has often either been neglected or underestimated in its impact [15]. Recent data indicate, however, that mRNA translational control is a general mechanism [16], playing a central role in the regulation of gene expression [17,18] as demonstrated for a variety of physiological and pathological situations [19,20,21,22,23,24,25]. WHAT IS TRANSLATIONAL CONTROL? The term translational control has been in use since the late 1960’s when it was described in four distinct physiological models: developing embryos [26,27,28,29], reticulocytes [30], virus or phage infected cells [31,32], as well as cells responding to a variety of external stimuli including heat, hormones, starvation or mitosis [33,34,35,36,37]. Translational control is defined as the change in mRNA *Address correspondence to this author at the Centro de Investigaciones Biologicas-CSIC, Ramiro de Maeztu, 9, 28040 Madrid, Spain; Tel: +34918373112; Fax: +34915360432; E-mail: [email protected] 1871-5265/08 $55.00+.00

translation rate (efficiency), i.e. the change in the number of completed protein products per molecule of mRNA per unit of time [10]. It is generally believed that in protein synthesis the number of peptide chains initiated is about the same as the number of full length protein molecules completed [38]. Therefore, under steady-state conditions, the number of initiation events over time approximates the number of protein molecules produced during the same interval. Thus, the synthesis rate of a given protein can be determined by the initiation rate of its mRNA [10,38,39]. In other words, since translational control takes place mainly at the initiation step, ribosome loading of a transcript is a robust indicator of translational efficiency [10,38,39]. This can be experimentally assessed upon separation of cytoplasmic messenger ribonucleoprotein particles (mRNPs), ribosome subunits and engaged ribosomes from the cell on sucrose density gradients Fig. (1). Although translational control implies both, differential utilization of mRNAs by the cellular translation machinery and differential utilization of a given mRNA under different physiological or pathological conditions (net change on the translation rate of the mRNA) Fig. (2), most work carried out so far deals with the latter situation, and very little is known regarding mechanisms regulating more or less efficient utilization of particular mRNAs by the translation machinery under steady-state conditions. WHY TO CONTROL TRANSLATION? In eukaryotes, translational control takes place in the cytoplasm and plays a central role in biological processes. It provides a fast and reversible quantitative control of gene expression (rather than on-off decisions) and thus fine-tunes a cell response to external stimuli, also allowing a spatiotemporal regulation of the response in the context of a multicellular organism. Therefore, while transcriptional control dominates all-or-none decisions on the synthesis of mRNAs, the final levels of the synthesized proteins are largely regulated at the post-transcriptional level, including translational control processes as well as changes of mRNA stability. © 2008 Bentham Science Publishers Ltd.

Translational Controlled mRNAs: New Drug Targets in Infectious Diseases?


253

Fig. (1) Sucrose gradient fractionation of cytoplasmic extracts. The cytoplasmic extract of a cell is prepared by mild cell lysis in the presence of 1.5 – 5 mM Mg++ (to avoid disruption of the mRNA-ribosome complexes) and 1.5 mg/ml cycloheximide (cycloheximide is a translation inhibitor which interferes with the translocation step of the ribosome, allowing the mRNA to stay “frozen” in place and thereby protected against some RNAses during migration through the gradient). After removing the nuclei by a short centrifugation (14000 x g, 10 seconds) the cytoplasmic extract is loaded onto a 15-40% linear sucrose gradient and centrifuged for 2 hours at 38000 rpm (SW41Ti rotor or equivalent). After centrifugation, the gradient is fractionated and the RNA from each fraction recovered. A picture of the ethidium bromide staining of the RNA from each fraction separated on a formaldehyde-denaturing agarose gel shows the typical profile obtained on these fractionations. On top of the gradient (left side of the gel) migrate the molecules with slow sedimentation coefficients (i.e. tRNAs are visible), on the subsequent fractions there is a peak of 18S rRNA (indicative of the migration of the small ribosomal subunit -40S-) followed by a peak of 28S rRNA (indicative of the migration of the large ribosomal subunit -60S-). The following fractions show a ratio 28S rRNA to 18S rRNA of 2:1 indicative of the presence of a 40S ribosomal subunit per each 60S ribosomal subunit (i.e. 80S ribosomes). This ratio is maintained throughout the gradient, since these fractions correspond to mRNAs harboring an increasing number of ribosomes attached on each subsequent fraction.

Translation initiation is a multi-step and multi-factorial process [40], expected to be regulated at different levels. Two main types of control have been described. First, global control of translation, which impacts the entire mRNA population within a cell, is usually exerted by substantial alterations in the activity of general components of the protein synthesis machinery [41]. It acts in a more or less non-specific manner such as during oocyte fertilization or late stages of erythroid maturation. The second type of control is more selective. It affects specific subsets of mRNAs and is usually achieved by exploiting differential sensitivity of mRNAs to more subtle changes like alterations in the activity of some general components of the translation machinery such as eIF4E or eIF2, or to changes in the activity of mRNA-binding proteins [42,43]. In this context, it may come as no surprise that for some examples for which control was initially described as “global”, recent data point towards "selective" or specific translation control. This includes cases involving general components of the protein synthesis machinery, which after all apparently do not affect equally all mRNAs, rendering a strict distinction between the two modes of translational control somewhat artificial.

TARGETS AND MECHANISMS OF TRANSLATION CONTROL The following aspects have all been shown to influence the final outcome of translation of a given mRNA: i) intrinsic efficiency of mRNA via structural determinants; ii) ribosome abundance; iii) activity of the protein synthesis machinery; and finally, iv) elongation rates. Considering all these issues, the question arises regarding the rate-limiting and regulated phase of protein synthesis. Conceptually at least, translational control can affect each of the three translation phases: i) initiation, which implies putting together the mRNA with the components of the translation machinery via the action of initiation factors; ii) elongation, during which new aminoacids are added to the nascent protein; and iii) termination, which involves the recognition of the STOP codon and disengaging the ribosomal subunits. As already mentioned and widely accepted, modulation of initiation rates is the most common way of control. The vast majority of translationally controlled mRNAs are regulated at this step [10]. With regard to elongation rates, there are only few but well characterized cases of translation control at


Diaz-Guerra et al.

Fig. (2) Translational control. Since control of translation takes place mainly at the level of translation initiation, ribosome-loading of a transcript is a robust indicator of translational efficiency. This can be analyzed by determining the expression profile of a given mRNA on sucrose gradients (also known as polysome gradients). Translational control implies both (A) the differential utilization of different mRNAs by the cellular translation machinery and (B) the differential utilization of a given mRNA in different physiological of pathological conditions (which implies a net change on the translation rate of this particular mRNA). Differential utilization of mRNAs by the cellular translation machinery is exemplified (A) by differential loading of p38MAPK, GADD153 and NT4 mRNAs with ribosomes, where NT4 represents the most efficiently translated and p38MAPK the least efficiently translated mRNA. Conversely, ferritin mRNA is differentially translated in the presence or absence of Fe+++ (B), where a small change (5%) of mRNA shifting towards polysome-bound fractions leads to a 25-fold increase in protein levels, as determined by western blot (C).

this level. A stop on elongation can represent a safety measure to halt further peptide bond formation [44]. An example described in detail is the translation control of heat shock proteins [45]. Finally, control at the level of termination is found when a ribosome is unable to properly recognize a translation stop codon and keeps adding amonoacids to the synthesized protein. This occurs through a frameshifting mechanism [46], frequently encountered on viral RNAs but rarely on host mRNAs. The specific translational efficiency of a given mRNA depends on the potential presence or absence of several cisacting RNA elements which can be divided into: i) elements that act alone or interact with general translation factors (e.g. the 5'cap structure, initiator AUG-sequence context, upstream Open Reading Frames = uORFs) [47] and ii) cisacting elements that bind specific trans-acting factors; for instance, cytoplasmic poly-adenylation elements or AU-rich elements in 3úntranslated regions (3’UTR) of mRNAs or 5’-terminal poly-pyrimidine tracts. Another example of the second type are the iron-response elements (IREs) in the 5’UTRs of ferritin and -aminolevulinate synthase mRNAs, which modulate translation depending on iron concentration via iron-regulatory proteins 1 and 2 (IRP1 and IRP2) [43].

IRP binding is also responsible for iron-dependent changes of transferrin receptor mRNA stability [48,49]. TRANSLATION CONTROL AS GENERALIZED MECHANISM OF REGULATING GENE EXPRESSION Even though many individual examples of translationally controlled mRNAs had been described before, with the burst of proteomics and genomics techniques and their application to the identification of translationally regulated genes, during the last decade, it became clear that translational control plays a larger role than previously appreciated. Large-scale analyses searching for translationally controlled genes demonstrated that a high percentage of transcripts were translationally regulated during physiological transitions such as T cell activation [20], epithelial-mesenchymal transition [22] or terminal erythropoieses [50]. These analyses were corroborated by profiling analyses using a differential screening in which translationally controlled genes were directly identified [23]. These data, together with the severe lack of correlation between protein expression levels and mRNA abundances observed on various biological systems [51,52,53,54] and the fact that in profiling experiments signals from total cytoplasmic RNA always equaled the sum


from free mRNPs plus polysome-bound signals [55], led us propose to perform expression profiling with polysomebound mRNA. This approach is expected to better represent cell phenotypes [16] since it would allow to uncover translationally regulated genes that would remain obscured in profiling experiments using total or cytoplasmic RNA samples. Although this hypothesis has not yet been formally verified by observing an improved correlation of polysomebound mRNA expression profiling data with proteomics data, results from experiments in which Jurkat T cells were treated with the drug rapamycin (selectively interfering with phosphorylation of key components of the translation machinery) [21] clearly support this concept. Further support came from other groups using the outlined approach which successfully identified translationally regulated targets in a wide variety of experimental designs, dealing with development, signal transduction, terminal differentiation, malignant transformation, etc. [21,22,24,25,50,56,57] TRANSLATIONAL CONTROL AND THE IMMUNE RESPONSE The innate immune response represents the first barrier against infection. Upon an antigenic challenge, cells of the innate immune system (mast cells, phagocytes, neutrophils, basophils, eosinophils and NK cells) are recruited to the infection site through antigen-unspecific mechanisms and secrete cytokines and chemokines to attract phagocytes as well as T and B-lymphocytes, where type I interferons (IFN) play an important role. Virus-induced expression of interferon regulatory factor 7 (IRF7, a master transcription factor driving IFN expression by plasmacytoid dendritic cells) occurs through a translational control program that confers rapid protein production from a pre-existing but translationally silent mRNA pool [58,59]. Another example of translationally regulated mRNAs during an innate immune response involve the transcription factor retinoic acid receptor (RAR) in response to platelet activating factor (PAF), in a process involving mammalian target-of-rapamycin (mTOR) [60]. RAR in turn regulates expression of interleukin (IL) -8 in activated polymorphonuclear leukocytes (PMNs). The mTOR pathway also controls translation efficiency of mRNAs for key IFN and IFN-inducible proteins through direct control of Akt activity [61]. Other examples include enhancement of histamine and IL-2 production by eukaryotic translation initiation factor 6 (eIF6) in mast cells [62], or the translation of pre-existing pools of granzyme B and perforin mRNA during acquisition of murine NK cell cytotoxicity [63] (distinct from CTL cells and CTL hybrids where the control of these genes was mainly transcriptional [64]). Furthermore, CsA has been shown to inhibit IL-6 mRNA translation [65] and TGFß transcripts are translationally regulated in macrophages [66]. Inability of the innate immune response to successfully deal with infection leads to activation of the adaptive immune response, which would fight infection through specific responses against antigens from the infectious agent, providing a more versatile defense and immunological memory (protection from subsequent re-infection by the same pathogen). The cells and inflammatory cytokines and chemokines released during the innate response are essential


255

for initiation of the adaptive immune reaction as well as to determine the type of response to be developed. Antigen presenting cells (APCs), which mature and became activated during this process, play a crucial role in this context. They take up antigens, process them and present the corresponding peptides in the context of the major histocompatibility complex (either MHC class I class II) to T lymphocytes. Maturation involves inhibition of CD83 cell surface expression, which occurs by interference with nuclear export of CD83 mRNA [67] in which APRIL (for a proliferationinducing ligand), the ligand for the embryonic lethal abnormal visual (ELAV) RNA-binding protein HuR is implicated [68]. Translationally controlled mRNAs have also been identified during macrophage activation. These include the mRNAs for the and - chains of MHC class II following either IFN treatment [69] or after LPS activation [70], something that has been shown not only for macrophages but also for B cells. For tumor necrosis factor (TNF) - mRNA, both LPS and superantigens are able to increase translation efficiency [71]. During LPS stimulation, the regulatory mechanism leads to an increase in TNF mRNA-polyA size [72], indicating that cytoplasmic re-adenylation of mRNAs does not only take place in early embryogenesis but can also occur during an immune response. Naïve T lymphocytes are resting cells in the G0 phase of the cell cycle with a very low metabolic rate. T cell activation via proper antigen presentation triggers a series of rapid biochemical changes including induction of the protein tyrosine kinase pathway, mobilization of Ca++ from intracellular reservoirs and up-regulation of protein kinase C activity [73]. The initial biochemical changes in T cells, which can be detected in vivo within 15-30 min after antigenic challenge [74], lead to a burst in protein synthesis (7 to 10-fold increase) [75] correlating with increased availability of translation initiation factors [76,77,78], including eIF2B and p70S6 kinase [79]. Also eIF3 complex formation and its association with ribosomes might contribute to increased translation rates during T lymphocyte activation [80,81]. Furthermore, ELAV1, which plays an important role in mRNA stability and translation, is up-regulated during T cell activation [82]. The increased availability of translation initiation factors is concomitant with a large scale mobilization of mRNAs from single ribosomes to polyribosomes [75,83], leading to a burst of protein synthesis which apparently is a key event in the activation process since a partial inhibition of translation delays and depresses the extent of T cell activation [84]. The burst in mRNA translation precedes a massive 30 to 40-fold increase in mRNA synthesis (JAGS and EWM, unpublished) due to the transcriptional activation of a large number of genes. In addition to the effects of global changes in translation, individual mRNAs are targets for specific translational control. For instance, genes such as p56lck, IL2Rec and IL15 contain upstream open reading frames (5’UTR-ORFs), which are responsible for their low rates of translation initiation [85,86,87]. Furthermore, the translation efficiency of some mRNAs such as rpL32 [88], rpL7 [89], April [90], TNF [91,92], ferritin [93] and RANTES [94] have been shown to change between resting and activated T cells and others such as IL-2 between different activation stimuli [95]. In addition, cyclosporin A promotes translational silencing


Diaz-Guerra et al.

of IL-3 transcripts via ribosome-associated deadenylation [96]. T cell receptor (TCR) engagement also leads to the activation-induced splicing of the nuclear pre-mRNAs for TNF [4] and IL-16 [97] or the intergenic splicing between Tweak and April, giving rise to the new transcript TWEPRIL which is translated into protein in activated T cells [90]. Translational efficiency of mature mRNAs can also be modulated by alternative exon usage, like for murine IL-15 transcripts [98]. These are mere examples of transcripts regulated by changes in translation efficiency, since translational control represents a much more general mechanism of gene regulation [20]. Indeed, it affects about 20% of the regulated genes during T cell activation, as demonstrated in a dedicated screen searching for transcripts regulated by translation [23]. Also, the effects of some drugs such as rapamycin (Rapamun®, Wyeth) at the genomic and proteomic level demonstrated a huge effect on global and specific translation control during T cell activation [21]. Following the transcriptional and translational processes outlined above, successful T cell activation by engagement of both T cell receptor and CD28 results in clonal proliferation of the cells (8-10 divisions) [99] and acquisition of effector functions (secretion of lymphokines, cytotoxic activity, contribution to B cell activation, etc). Finally, following antigen clearance, a small fraction of the cells remain as memory T cells, while the vast majority that have initially responded to the antigenic stimulation die by apoptosis [100]. This process is accompanied by massive degradation of cellular mRNA [101], concomitant with reduction of protein synthesis [102]. As expected for a general mechanism, translational control is not restricted to macrophages or T lymphocytes, examples have also been reported for B cell activation and maturation. Among others, these include the translation control of BCL-6 mRNA within germinal centers [103], translational activation of MHC class II mRNAs following either LPS or IFN treatment [70] or the membrane expression of IgM in secretory B cells [104]. In addition to these examples, there are also reports of changes in mRNA stability as key events in B cell physiology such as the regulated expression of IgM and IgD [105]. Taken together, these data may serve to illustrate that translation control plays a significant role during immune responses [20,106]. Thus, it is likely that infectious agents take advantage of some of these mechanisms to fight the host defense system and establish a stronger and more persistent infection. TRANSLATIONAL INFECTIONS

CONTROL

DURING

Any infection triggers defensive measures, aiming to control pathogen multiplication. These include i) responses of the infected host cell through modifications of some initiation factors, ii) triggering of the apoptosis program within the infected cell and iii) activation of the immune system. But like in every other waging war, there are also countermeasures from the pathogen i) to avoid detection by the host, ii) to overcome its response and iii) to maintain a latent status for a given period of time. In this context, different pathogens use different strategies in which

translation control is a highly relevant mechanism. In the following we will address some of the available information with respect to different classes of pathogens. VIRAL INFECTIONS As “intracellular parasites”, viruses fully depend on the host cell synthetic machinery for their life cycle. In terms of evolution, this battle resulted in extremely cunning interactions between the virus and the host cell, in which the latter makes various efforts to combat infection, each of which has to be undermined successfully by the virus to avoid extinction. Given the focus of this review, gaining versus maintaining control over the translational machinery will be our main issue. Already during the 1960's, it became apparent that cellular protein synthesis is suppressed during a viral attack [41]. As a prototype example, within 2 hours, poliovirus infection results in a drastic shut-off on host-cell mRNA translation, leading to a reduction functional size from polysomes to monosomes [107]. Then, virus specific polysomes form leading to a wave of viral protein synthesis [32]. Despite the selective initiation of viral mRNAs, host mRNAs remain intact but are no longer associated with polysomes [108]. It has been shown that the underlying mechanism involves the modification of the cap-binding structure by proteolytic cleavage of the translation initiation factor eIF4G, which normally circularizes cellular mRNAs by interacting with eIF-4E and poly(A) binding protein, binding at the 5’ and 3’ end of transcripts, respectively. As a consequence, eIF-4E cleavage leads to a shut-off of capdependent translation initiation (translation of >90% of the host mRNAs is cap-dependent), but does not interfere with cap-independent translation (translation of a small fraction of host mRNAs and viral RNAs, where initiation occurs through internal ribosome entry sites, so called IRES) [38,109]. The shut-off in host mRNA translation, during productive viral infections, is a widespread phenomenon described among others for Epstein-Barr virus [110], herpes virus [111], vesicular stomatitis virus [112], adenovirus [113,114], mengovirus [115] and influenza virus [114]. Unlike picornavirus IRES, the hepatitis C virus (HCV) IRES (and the ones in the closely related pestiviruses) allows direct binding of the 40S ribosomal subunit to initiate translation, not requiring any of the canonical translation initiation factors (eIF4A, 4B, 4E, and 4G) [116]. Polysome-bound mRNA expression profiling of virally infected cells allowed to demonstrate the high proportion of host mRNAs that were translationally down-regulated without effect on the expression levels of these mRNAs. The group of host transcripts that remained associated with polysomes represents mRNAs particularly translated in response to cellular stress through internal ribosome entry sites (IRES) on a cap-independent translation [117,118]. Interestingly, some cellular IRES-containing mRNAs (e.g. coding for XIAP, DAP5/NAT1 or APAF-1) are involved in apoptosis and thus contribute to the organism defense line against viral infection [119]. As expected, the effects of non-cytopathic viruses on host mRNA translation are milder. It is evident, however, that they have to start translating their own mRNAs and thus


compete with host transcripts for components of the translation machinery. Some, such as human cytomegalovirus (CMV) rather than to shut-off host cell translation [120], they inhibit translation of particular mRNAs such as MHC class II transcripts [121], which would be instrumental for the establishment of an effective immune response. Also, other viruses are responsible for the inhibition of particular genes [122,123]. For example, HIV interferes with the cellsurface expression of CD4 in T cells [124], while others secrete proteins able to inhibit immune responses such as the NS1 protein of influenza virus [125]. On the host side, part of the response to keep viral infection under control can be linked to translational control. For instance, IFN suppresses replication of hepatitis C virus RNA through the induction of distinct translational control programs [126]. Recently, microRNAs (miRNAs) and their biology have received a lot of attention. They are small non-coding RNAs able to control gene expression by regulating either mRNA stability and/or translation [127]. Some viruses, including EBV, HIV and CMV encode miRNAs of their own able to silence both viral and host genes [128,129,130,131]. This is exploited by some virus as a mechanism for immune evasion in particular since the corresponding miRNAs are able to down-modulate genes such as MHC class I-related chain B, relevant in NK cell signaling [132]; and it has been suggested that miRNAs could also down-regulate production of CD28, CD4 and interleukins [128]. Again, there are mechanistically related countermeasures by the host, as recently described for endogenous inhibition of HIV replication involving miRNA pathways [133]. BACTERIAL INFECTIONS An in vitro model of macrophage infection by Yersinia enterocolitica, which we analyzed several years ago, shall serve to introduce some of the complex strategies used by bacteria for immune evasion. Y. enterocolitica infectivity is strictly dependent on the presence of the Yop virulon (pYV), which enables extracellular bacteria to inject six Yop effectors (YopE, -H, -T, -O, -P, -M) into the host cell. Comparison of expression profiles from macrophages, either in the absence or presence of Y. enterocolitica being infective (carrying wild-type YV), not infective (devoid of YV) or with YV but carrying particular mutations on YopP or YopM, demonstrated that the main role of the virulon is to counteract the host cell pro-inflammatory response to infection. YopP, but not YopM, and at least another Yop protein down-regulate the expression of NFb-target genes, inhibiting the pro-inflammatory responses from the APC. Conversely, YopM up-regulates expression of host genes involved in cell cycle and growth [134]. Although the role of translational control on these interactions remains to be fully evaluated, translational control of IL-1 and IL-1 mRNAs has been demonstrated during Y. enterocolica infections in vivo [135]. Another example of pathogen-host protein interactions is the ability of Pseudomonas aeruginosa to resist complement-mediated killing by binding to Factor H and plasminogen. Also in other bacteria, proteins that bind to these host factors have been recognized as surface-expressed virulence factors. Surprisingly, the binding protein from P. aeruginosa turned out to be the elongation factor-Tu (EF-Tu), a


257

ribosome-associated protein involved in translation. Surface expression of the cytoplasmic protein EF-Tu enables P. aeruginosa to acquire host proteins in its surface, which allow the bacteria to evade the host innate immune response [136]. Several bacterial species, including Staphylococcus aureus, secrete exotoxins which induce CD4+ T cells anergy upon re-stimulation with their natural ligand [137]. Translational control of IL-2 mRNA has been suggested to play a relevant role in this situation [95]. During S. aureus infections, the translational control of BCL-6 mRNA in germinal center B cells has also been reported [103]. Mycobacterium tuberculosis regulates translation of CD1 transcripts in APCs upon signaling through Toll-like receptor (TLR) -2 [138]. In addition, M. tuberculosis remains infective for the host for long time periods. Its strategy consists of inducing IL-6 secretion by infected macrophages, which inhibits their response to IFN-, limiting its ability to stimulate macrophages to kill M. tuberculosis, and thus contributing to the inability of the adaptive immune response to eradicate the infection [139]. A similar strategy, i.e. downregulating IFN- responses, is also used by Listeria monocytogenes [140]. These bacteria escape from the phagosome using listeriolysin O, a translationally regulated secreted cytolysin. Translation of listeriolysin O mRNA in the cytosol is minimized, however, to prevent pore formation in the host plasma membrane, which would expose the intracellular bacteria to extracellular host defenses [141]. Finally, other strategies imply the inhibition of apoptosis on the host cell. Chlamydia pneumoniae multiplies in neutrophil granulocytes and delays their spontaneous apoptosis [142] through expression of the apoptosis inhibitor c-IAP2 [143], involving cap-independent translation via an IRES. Thus, bacteria utilize a wide variety of strategies to either avoid or overcome the immune response. Most of them are based on very elaborate interactions with the host, many of which remain to be addressed in detail. Only a clear understanding of them will allow pinpointing relevant and new drug target genes in the future. PARASITIC INFECTIONS As outlined for bacteria in the previous section, also eukaryotic infectious organisms have developed a plethora of highly complex mechanisms in co-evolution/competition with their hosts to ensure survival. Most strategies again address interactions with or escape from the immune system. With special emphasis on trypanosomatids, we will outline some exemplary cases of translational regulation, this time less in conjunction with host-pathogen interactions but in their own right. Like in other trypanosomatids, a poly-cistronic transcriptional process mediates Leishmania gene expression, where post-transcriptional regulatory mechanisms, including RNA processing and protein translation, are highly relevant [144,145,146,147,148]. The Leishmania life cycle consists of two morphologically distinct stages: intracellular amastigotes residing in the phagolysosome of mammalian macrophages and extracellular promastigotes living in the gut of the sandfly vector. The transition from promastigote to amas-


tigote involves a sequence of steps enabling the parasite to adapt to its new environment and can be partially mimicked by a temperature shift from 26ºC to 37ºC. During this transition, translational control is highly relevant: despite significant changes in the polypeptide complement of the cell, no major changes at the level of expressed mRNAs were observed, as determined by translation in a cell-free system [149]. For example, temperature shift to 37ºC induced a rapid cessation of -tubulin synthesis in several species of Leishmania, although abundance and sizes of tubulin mRNAs remained unaltered, indicating translational regulation [149,150,151]. In other species, however, it seemed that changes in -tubulin synthesis were paralleled by changes in mRNA [152]. In Leishmania chagasi the intercoding region of the -tubulin gene turned out to be responsible for keeping mRNA abundance constant, despite protein synthesis inhibition [153]. In addition, a 450-nt region within the amastin 3'-UTR has been identified to confer amastigote-specific gene expression by a mechanism increasing mRNA translation without affecting stability [154,155]. Codon usage analyses also suggested that translation has a major impact on protein expression in trypanosomatids [156]. A shift from 26ºC to 37ºC induces a typical heat-shock response in trypanosomes. In Leishmania infantum, the heat shock protein HSP70 is encoded by six genes of two types that differ only in their 3'-untranslated regions (3'-UTRs). HSP70 type I transcripts (i.e. hsp70 genes 1-5) are associated with ribosomes in promastigotes at normal and heat-shock temperatures, whereas the HSP70 type II transcripts (from gene number 6) appear to be preferentially translated at elevated temperatures, but not at 26ºC [157]. Interestingly, there is yet another level of post-transcriptional regulation for these genes. Although mature hsp70 gene 6 mRNA is 50fold more abundant than the others, transcription rates (as determined by nuclear run-on assays) are the same for all members [158]. Apparently, hsp70 gene 6 transcripts are stored in L. infantum to provide de novo synthesis of HSP70 when the parasites encounter stress conditions. The Leishmania genome harbors four homologues of the eukaryotic translation initiation factor 4E (LeishIF4E-1 to LeishIF4E-4), coding all for cytoplasmic proteins. LeishI F4E-1 and LeishIF4E-4 are reasonable translation initiation factor candidates, since they interact with the mammalian eIF4E-binding protein 4EBP1, though with different efficiencies. LeishIF4E-1 mRNA is abundant in amastigotes and contains a 3'UTR element typically found in transcripts of amastigote-specific genes. Conversely, LeishIF4E-2 has been implicated in stabilization of trypanosomatid polysomes whereas the function of LeishIF4E-3 remains unknown [159]. Other examples of translationally controlled transcripts include the cell-cycle-dependent translation of histone mRNAs in L. infantum [160,161] and Hsp83 expression, both regulated at the level of mRNA stability and translation, involving 5’ and 3’ UTR sequences, by temperature and stage-specific differentiation [162,163,164,165, 166]. Genetic analysis of mutants from L. tarentolae splice leader (SL) sequences defined two regions as essential for association with polysomes. Furthermore, mutants that do not associate with polysomes also contain under-methylated

Diaz-Guerra et al.

cap structures [167], indicating a role for the L. tarentolae splice leader on translation. In addition, other genes are mainly regulated by changes in mRNA stability, such as the three 63 kDa surface glycoprotein GP63 classes (mspC, mspS and mspL), which are involved in several steps of promastigote infection of host cells. These transcripts are constitutively transcribed during virulent promastigote growth. In attenuated promastigotes, mspS, mspC and mspL mRNAs display half-lives of 120, 60 and 84 min, respectively. In virulent promastigotes, however, mspL mRNA half-live decreases 5-fold from 84 to 17 min from early logarithmic growth to a stage intermediate between logarithmic and stationary phase [168], demonstrating a link between the change in mspL mRNA stability and virulence. Furthermore, degradation of amastin mRNA is stage-specific and deadenylation-independent, but dependent on an unusual URE-mediated pathway of mRNA degradation [169]. In comparison, relatively little is known about effects of Leishmania infection on the expression of host genes. It has been shown that NRAMP-1 expression prevents full macrophage PTP induction, correlating with higher nitric oxide production and lower parasite survival, consequently, promoting positive signal transduction as a backbone for induction of proinflammatory phagocyte functions [170]. L. major stimulates IL-1 promoter activity and mRNA expression in macrophages through MyD88-dependent pathways, although additional anti-inflammatory pathways must also be activated which down-regulate transcription and ultimately inhibit translation of the IL-1 protein [171]. In addition, bone marrow-derived macrophages infected with L. donovani exhibit 2 to 3-fold specific viability increase in the absence of exogenous growth factor (M-CSF) as compared to uninfected cells [172]. The block to Trypanosoma cruzi cell invasion upon protein synthesis inhibition has demonstrated the relevance of protein synthesis in trypanosome infections. Since inhibition of host protein synthesis had no effect on cell invasion, apparently the parasite can establish itself and replicate within cells, relying on its own protein synthesis ability [173] but coding for some specialized translation components [174,175]. Continuous changes of the variant surface glycoprotein (VSG) allowed blood borne African trypanosomes to escape from the host immune response and thus to develop chronic infection. Antigenic variation results either from DNA rearrangements or from a change in telomeric chromatin structure. Stage-specific regulation of antigen synthesis, however, is linked to differential control of RNA elongation, processing, mRNA stability, and/or translation [176], an issue currently under investigation. Lets finish by briefly turn towards another prominent example of intracellular parasite such as Plasmodium falciparum, where translation control has also been described in. For example, during the parasite’s sexual cycle, mRNA translation is repressed by the RNA helicase DOZI, which plays a key role in sexual differentiation [177]. In addition, there is the case of dihydrofolate reductase-thymidylate synthase (DHFR-TS), which inhibits translation of its own mRNA. Since DHFR-TS mRNA binding sites are not coupled to the enzymatically active sites, standard antifolate



drugs like methotrexate do not relieve translational inhibition, rendering malaria parasites sensitive to selective chemotherapy with inhibitors targeted at DHFR-TS active sites [178].

[18]

CONCLUDING REMARKS

[19]

Aiming to establish a productive infection, pathogens were known for long to utilize a wide range of mechanisms to inhibit apoptosis of the infected host cell, avoid recognition by the appropriate cells of the immune system, inhibit the response of these cells, etc. Until recently, most studies have analyzed the specific (internal) features of the pathogen while host-pathogen interactions have been, to a large extent, neglected. Recent data on such interactions have often demonstrated a very elaborate interplay of molecular components and, in some of these examples, an important role for translation control could be firmly established. Since the data currently available indicate that about 20% of the genes whose expression is modulated by physiological or pathological transitions are translationally regulated, we suggest that careful analysis of translationally controlled transcripts during host-pathogen interactions may indeed unravel potential new drug targets that can eventually lead to novel therapies to fight infections. ACKNOWLEDGEMENTS The work in the author’s laboratories has been financed by grants SAF2007-63631 from the Spanish Ministry of Science and Education (to JAGS) and SFB F-2809 from the Austrian Science Foundation (FWF, to EWM). RV is on leave from the Dentistry School, University of Chile and is the recipient Chilean Government fellowship (CONICYT26080046). The authors declare no competing financial interests. REFERENCES [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17]

Alberts, B.; Johnson, A.; Lewis, J.; Raff, M.; Roberts, K.; Walter, P. Molecular Biology of the Cell, 4th ed.; Garland: New York, 2002. O'Malley, B.W.; Towle, H.C.; Schwartz, R.J. Annu. Rev. Genet., 1977, 11, 239. Dallmann, H.G.; Dunn, S.D. J. Bacteriol., 1994, 176, 1242. Yang, Y.; Chang, J.F.; Parnes, J.R.; Fathman, C.G. J. Exp. Med., 1998, 188, 247. Dargemont, C.; Kuhn, L.C. J. Cell Biol., 1992, 118, 1. Lipshitz, H.D.; Smibert, C.A. Curr. Opin. Genet. Dev., 2000, 10, 476. Shyu, A.B.; Belasco, J.G.; Greenberg, M.E. Genes Dev., 1991, 5, 221. Shyu, A.B.; Greenberg, M.E.; Belasco, J.G. Genes Dev., 1989, 3, 60. Stadler, B.M.; Ruohola-Baker, H. Cell, 2008, 132, 563. Sonenberg, N.; Hershey, J.W.B.; Mathews, M.B. Translational Control of Gene Expression; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, 2000. Temporini, C.; Calleri, E.; Massolini, G.; Caccialanza, G. Mass Spectrom Rev., 2008, 27, 207. Bochtler, M.; Ditzel., L.; Groll, M.; Hartmann, C.; Huber, R. Annu. Rev. Biophys. Biomol. Struct., 1999, 28, 295. Kirschner, M. Trends Cell Biol., 1999, 9, M42. Voges, D.; Zwickl, P.; Baumeister, W. Annu. Rev. Biochem., 1999, 68, 1015. Day, D.A.; Tuite, M.F. J. Endocrinol., 1998, 157, 361. Pradet-Balade, B.; Boulme, F.; Beug, H.; Mullner, E.W.; GarciaSanz, J.A. Trends Biochem. Sci., 2001, 26, 225. Richter, J.D. In Translational Control of Gene Expression; Sonenberg, N., Hershey, J. W. B., Mathews, M. B., Eds.; Cold

[20] [21] [22]

[23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38]

[39] [40]

[41]

[42]

[43]

[44] [45]

[46]

[47]

[48] [49]

259

Spring Harbor Laboratory Press: Cold Spring Harbor, New York, 2000, p 785. Wickens, M.; Goodwin, E.B.; Kimble, J.; Strickland, S.; Hentze, M.W. In Translational Control of Gene Expression; Sonenberg, N., Hershey, J. W. B., Mathews, M. B., Eds.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, 2000, p 295. Blazquez-Domingo, M.; Grech, G.; von Lindern, M. Mol. Cell Biol., 2005, 25, 8496. Garcia-Sanz, J.A.; Mikulits, W.; Livingstone, A.; Lefkovits, I.; Mullner, E.W. FASEB J., 1998, 12, 299. Grolleau, A.; Bowman, J.; Pradet-Balade, B.; Puravs, E.; Hanash, S.; Garcia-Sanz, J.A.; Beretta, L. J. Biol. Chem., 2002, 277, 22175. Jechlinger, M.; Grunert, S.; Tamir, I.H.; Janda, E.; Ludemann, S.; Waerner, T.; Seither, P.; Weith, A.; Beug, H.; Kraut, N. Oncogene, 2003, 22, 7155. Mikulits, W.; Pradet-Balade, B.; Habermann, B.; Beug, H.; GarciaSanz, J.A.; Mullner, E.W. FASEB J., 2000, 14, 1641. Rajasekhar, V.K.; Viale, A.; Socci, N.D.; Wiedmann, M.; Hu, X.; Holland, E.C. Mol. Cell, 2003, 12, 889. Tominaga, Y.; Tamguney, T.; Kolesnichenko, M.; Bilanges, B.; Stokoe, D. Mol. Cell Biol., 2005, 25, 8465. Gross, P.R.; Cousineau, G.H. Biochem. Biophys. Res. Commun., 1963, 10, 321. Gross, P.R.; Cousineau, G.H. Exp. Cell Res., 1964, 33, 368. Hultin, T. Exp. Cell Res., 1961, 25, 405. Humphreys, T. Dev. Biol., 1971, 26, 201. Bruns, G.P.; London, I.M. Biochem. Biophys. Res. Commun., 1965, 18, 236. Penman, S.; Summers, D. Virology, 1965, 27, 614. Summers, D.F.; Maizel, J.V., Jr.; Darnell, J.E., Jr. Proc. Natl. Acad. Sci. USA, 1965, 54, 505. Fan, H.; Penman, S. J. Mol. Biol., 1970, 50, 655. Fan, H.; Penman, S. Science, 1970, 168, 135. Hodge, L.D.; Robbins, E.; Scharff, M.D. J. Cell Biol., 1969, 40, 497. McCormick, W.; Penman, S. J. Mol. Biol., 1969, 39, 315. Steward, D.L.; Shaeffer, J.R.; Humphrey, R.M. Science, 1968, 161, 791. Mathews, M.B.; Sonenberg, N.; Hershey, J.W.B. In Translational Control of Gene Expression; Sonenberg, N., Hershey, J. W. B., Mathews, M. B., Eds.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, 2000, p 1. McCarthy, J.E.G. Microbiol. Mol. Biol. Rev., 1998, 62, 1492. Hershey, J.W.B.; Merrick, W.C. In Translational Control of Gene Expression; Sonenberg, N., Hershey, J. W. B., Mathews, M. B., Eds.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, 2000, p 33. Raught, B.; Gingras, A.C.; Sonenberg, N. In Translational Control of Gene Expression; Sonenberg, N., Hershey, J. W. B., Mathews, M. B., Eds.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, 2000, p 245. Kimball, S.R.; Jefferson, L.S. In Translational Control of Gene Expression; Sonenberg, N., Hershey, J. W. B., Mathews, M. B., Eds.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, 2000, p 561. Rouault, T.A.; Harford, J.B. In Translational Control of Gene Expression; Sonenberg, N., Hershey, J. W. B., Mathews, M. B., Eds.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, 2000, p 655. Proud, C. In Translational Control of Gene Expression; Sonenberg, N., Hershey, J. W. B., Mathews, M. B., Eds.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, 2000, p 719. Schneider, R.J. In Translational Control of Gene Expression; Sonenberg, N., Hershey, J. W. B., Mathews, M. B., Eds.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, 2000, p 581. Farabaugh, P.J.; Qian, Q.; Stahl, G. In Translational Control of Gene Expression; Sonenberg, N., Hershey, J. W. B., Mathews, M. B., Eds.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, 2000, p 741. Geballe, A.P.; Sachs, M.S. In Translational Control of Gene Expression; Sonenberg, N., Hershey, J. W. B., Mathews, M. B., Eds.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, 2000, p 595. Mullner, E.W.; Kuhn, L.C. Cell, 1988, 53, 815. Mullner, E.W.; Neupert, B.; Kuhn, L.C. Cell, 1989, 58, 373.

260 Infectious Disorders - Drug Targets 2008, Vol. 8, No. 4 [50] [51] [52] [53] [54]

[55] [56] [57] [58]

[59] [60]

[61] [62] [63] [64] [65]

[66] [67] [68]

[69] [70] [71] [72] [73] [74]

[75] [76] [77] [78] [79] [80] [81] [82] [83] [84] [85] [86] [87] [88] [89]

Grech, G.; Blázquez-Domingo, M.; Kolbus, A.; Bakker, W.J.; Müllner, E.W.; Beug, H.; von Lindern, M. Blood, 2008, in press. Anderson, L.; Seilhamer, J. Electrophoresis, 1997, 18, 533. Anderson, N.L.; Anderson, N.G. Electrophoresis, 1998, 19, 1853. Gygi, S.P.; Rochon, Y.; Franza, B.R.; Aebersold, R. Mol. Cell Biol., 1999, 19, 1720. Tew, K.D.; Monks, A.; Barone, L.; Rosser, D.; Akerman, G.; Montali, J.A.; Wheatley, J.B.; Schmidt, D.E., Jr. Mol. Pharmacol., 1996, 50, 149. Pradet-Balade, B.; Boulme, F.; Mullner, E.W.; Garcia-Sanz, J.A. Biotechniques, 2001, 30, 1352. Zong, Q.; Schummer, M.; Hood, L.; Morris, D.R. Proc. Natl. Acad. Sci. USA, 1999, 96, 10632. Sampath, P.; Pritchard, D.K.; Pabon, L.; Reinecke, H.; Schwartz, S.M.; Morris, D.R.; Murry, C.E. Cell Stem Cell, 2008, 2, 448. Colina, R.; Costa-Mattioli, M.; Dowling, R.J.; Jaramillo, M.; Tai, L.H.; Breitbach, C.J.; Martineau, Y.; Larsson, O.; Rong, L.; Svitkin, Y.V.; Makrigiannis, A.P.; Bell, J.C.; Sonenberg, N. Nature, 2008, 452, 323. Erickson, A.K.; Gale, M., Jr. Cell Res., 2008, 18, 433. Yost, C.C.; Denis, M.M.; Lindemann, S.; Rubner, F.J.; Marathe, G.K.; Buerke, M.; McIntyre, T.M.; Weyrich, A.S.; Zimmerman, G.A. J. Exp. Med., 2004, 200, 671. Kaur, S.; Sassano, A.; Dolniak, B.; Joshi, S.; Majchrzak-Kita, B.; Baker, D.P.; Hay, N.; Fish, E.N.; Platanias, L.C. Proc. Natl. Acad. Sci. USA, 2008, 105, 4808. Oh, C.K.; Filler, S.G.; Cho, S.H. J. Immunol., 2001, 166, 3606. Fehniger, T.A.; Cai, S.F.; Cao, X.; Bredemeyer, A.J.; Presti, R.M.; French, A.R.; Ley, T.J. Immunity, 2007, 26, 798 Garcia-Sanz, J.A.; Podack, E.R. Eur. J. Immunol., 1993, 23, 1877. Garcia, J.E.; Lopez, A.M.; de Cabo, M.R.; Rodriguez, F.M.; Losada, J.P.; Sarmiento, R.G.; Lopez, A.J.; Arellano, J.L. Mediators Inflamm., 1999, 8, 253. McDonald, P.P.; Fadok, V.A.; Bratton, D.; Henson, P.M. J. Immunol., 1999, 163, 6164. Kruse, M.; Rosorius, O.; Kratzer, F.; Bevec, D.; Kuhnt, C.; Steinkasserer, A.; Schuler, G.; Hauber, J. J. Exp. Med., 2000, 191, 1581. Fries, B.; Heukeshoven, J.; Hauber, I.; Gruttner, C.; Stocking, C.; Kehlenbach, R.H.; Hauber, J.; Chemnitz, J. J. Biol. Chem., 2007, 282, 4504. Gonalons, E.; Barrachina, M.; Garcia-Sanz, J.A.; Celada, A. J. Immunol., 1998, 161, 1837. Barrachina, M.; Gonalons, E.; Celada, A. Tissue Antigens, 1999, 54, 461. Espel, E.; Garcia-Sanz, J.A.; Aubert, V.; Menoud, V.; Sperisen, P.; Fernandez, N.; Spertini, F. Eur. J. Immunol., 1996, 26, 2417. Crawford, E.K.; Ensor, J.E.; Kalvakolanu, I.; Hasday, J.D. J. Biol. Chem., 1997, 272, 21120. Kane, L.P.; Lin, J.; Weiss, A. Curr. Opin. Immunol., 2000, 12, 242. Sanjuan, M.A.; Pradet-Balade, B.; Jones, D.R.; Martinez-A, C.; Stone, J.C.; Garcia-Sanz, J.A.; Merida, I. J. Immunol., 2003, 170, 2877. Ahern, T.; Kay, J.E. Mol. Cell Biochem., 1977, 16, 105. Cohen, R.B.; Boal, T.R.; Safer, B. EMBO J., 1990, 9, 3831. Mao, X.; Green, J.M.; Safer, B.; Lindsten, T.; Frederickson, R.M.; Miyamoto, S.; Sonenberg, N.; Thompson, C.B. J. Biol. Chem., 1992, 267, 20444. Welsh, G.I.; Miyamoto, S.; Price, N.T.; Safer, B.; Proud, C.G. J. Biol. Chem., 1996, 271, 11410. Kleijn, M.; Proud, C.G. BMC Biochem., 2002, 3, 11. Miyamoto, S.; Qin, J.; Safer, B. Protein Sci., 2001, 10, 423. Miyamoto, S.; Patel, P.; Hershey, J.W. J. Biol. Chem., 2005, 280, 28251. Atasoy, U.; Watson, J.; Patel, D.; Keene, J.D. J. Cell Sci., 1998, 111 ( Pt 21), 3145. Cooper, H.L.; Braverman, R. Biochim. Biophys. Acta., 1978, 517, 84. Varesio, L.; Holden, H.T. J. Immunol., 1980, 124, 2288. Marth, J.D.; Overell, R.W.; Meier, K.E.; Krebs, E.G.; Perlmutter, R.M. Nature, 1988, 332, 171. Weinberg, A.D.; Swain, S.L. J. Immunol., 1990, 144, 4712. Bamford, R.N.; Battiata, A.P.; Burton, J.D.; Sharma, H.; Waldmann, T.A. Proc. Natl. Acad. Sci. USA, 1996, 93, 2897. Kaspar, R.L.; Gehrke, L. J. Immunol., 1994, 153, 277. Neumann, F.; Krawinkel, U. Exp. Cell Res., 1997, 230, 252.

Diaz-Guerra et al. [90]

[91] [92]

[93] [94] [95] [96] [97] [98] [99] [100] [101] [102] [103] [104] [105] [106] [107] [108] [109] [110] [111] [112] [113] [114] [115] [116] [117]

[118] [119] [120] [121] [122] [123] [124] [125] [126] [127] [128] [129] [130]

Pradet-Balade, B.; Medema, J.P.; Lopez-Fraga, M.; Lozano, J.C.; Picard, A.; Martinez-A., C.; Garcia-Sanz, J.A.; Hahne, M. EMBO. J., 2002, 21, 5711. Buxade, M.; Ramirez-Alvarado, M.; Fernandez-Troy, N.; MacKenzie, S.; Casaroli-Marano, R.P.; Vilella, R.; Espel, E. Immunology, 2001, 102, 416. Buxade, M.; Parra, J.L.; Rousseau, S.; Shpiro, N.; Marquez, R.; Morrice, N.; Bain, J.; Espel, E.; Proud, C.G. Immunity, 2005, 23, 177. Campbell, C.H.; Solgonick, R.M.; Linder, M.C. Biochem. Biophys. Res. Commun., 1989, 160, 453. Nikolcheva, T.; Pyronnet, S.; Chou, S.Y.; Sonenberg, N.; Song, A.; Clayberger, C.; Krensky, A.M. J. Clin. Invest., 2002, 110, 119. Garcia-Sanz, J.A.; Lenig, D. J. Exp. Med., 1996, 184, 159. Nair, A.P.; Hirsch, H.H.; Colombi, M.; Moroni, C. Mol. Cell Biol., 1999, 19, 889. Wu, D.M.; Zhang, Y.; Parada, N.A.; Kornfeld, H.; Nicoll, J.; Center, D.M.; Cruikshank, W.W. J. Immunol., 1999, 162, 1287. Nishimura, H.; Washizu, J.; Nakamura, N.; Enomoto, A.; Yoshikai, Y. J. Immunol., 1998, 160, 936. Kaech, S.M.; Ahmed, R. Nat. Immunol., 2001, 2, 415. Diaz-Guerra, E.; Vernal, R.; del Prete, M.J.; Silva, A.; Garcia-Sanz, J.A. J. Immunol., 2007, 179, 7352. del Prete, M.J.; Robles, M.S.; Guio, A.; Martinez-A, C.; Izquierdo, M.; Garcia-Sanz, J.A. FASEB J., 2002, 16, 2003. Shan, X.; Chang, Y.; Lin, C.L. FASEB J., 2007, 21, 2753. Allman, D.; Jain, A.; Dent, A.; Maile, R.R.; Selvaggi, T.; Kehry, M.R.; Staudt, L.M. Blood, 1996, 87, 5257. Sitia, R.; Neuberger, M.S.; Milstein, C. EMBO J., 1987, 6, 3969. Reed, D.J.; Hawley, J.; Dang, T.; Yuan, D. J. Immunol., 1994, 152, 5330. Beretta, L. Int. Rev. Immunol., 2004, 23, 347. Summers, D.F.; Maizel, J.V., Jr. Virology 1967, 31, 550. Leibowitz, R.; Penman, S. J. Virol., 1971, 8, 661. Hellen, C.U.; Sarnow, P. Genes Dev., 2001, 15, 1593. Rowe, M.; Glaunsinger, B.; van Leeuwen, D.; Zuo, J.; Sweetman, D.; Ganem, D.; Middeldorp, J.; Wiertz, E.J.; Ressing, M.E. Proc. Natl. Acad. Sci. USA, 2007, 104, 3366. Fenwick, M.L.; McMenamin, M.M. J. Gen. Virol., 1984, 65 ( Pt 7), 1225. Lynch, K.R.; Pennica, D.; Ennis, H.L.; Cohen, P.S. Virology, 1981, 108, 277. Theodorakis, N.G.; Morimoto, R.I. Mol. Cell Biol., 1987, 7, 4357. Katze, M.G.; DeCorato, D.; Krug, R.M. J. Virol., 1986, 60, 1027. Pensiero, M.N.; Lucas-Lenard, J.M. J. Virol., 1985, 56, 161. Pestova, T.V.; Shatsky, I.N.; Fletcher, S.P.; Jackson, R.J.; Hellen, C.U. Genes Dev., 1998, 12, 67. Carter, M.S.; Kuhn, K.M.; Sarnow, P. In Translational Control of Gene Expression; Sonenberg, N., Hershey, J. W. B., Mathews, M. B., Eds.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, 2000, p 615. Johannes, G.; Carter, M.S.; Eisen, M.B.; Brown, P.O.; Sarnow, P. Proc. Natl. Acad. Sci., (USA) 1999, 96, 13118. Holcik, M.; Sonenberg, N.; Korneluk, R.G. Trends Genet., 2000, 16, 469. Walsh, D.; Perez, C.; Notary, J.; Mohr, I. J. Virol., 2005, 79, 8057 Miller, D.M.; Rahill, B.M.; Boss, J.M.; Lairmore, M.D.; Durbin, J.E.; Waldman, J.W.; Sedmak, D.D. J. Exp. Med., 1998, 187, 675. Dehlin, E.; von Gabain, A.; Alm, G.; Dingelmaier, R.; Resnekov, O. Mol. Cell Biol., 1996, 16, 468. Savard, M.; Belanger, C.; Tremblay, M.J.; Dumais, N.; Flamand, L.; Borgeat, P.; Gosselin, J. J. Immunol., 2000, 164, 6467. Geleziunas, R.; Bour, S.; Wainberg, M.A. FASEB J., 1994, 8, 593. Fernandez-Sesma, A. Infect. Disord. Drug Targets, 2007, 7, 336. Wang, C.; Pflugheber, J.; Sumpter, R., Jr.; Sodora, D.L.; Hui, D.; Sen, G.C.; Gale, M., Jr. J. Virol., 2003, 77, 3898. Meister, G. Cell, 2007, 131, 25. Couturier, J.P.; Root-Bernstein, R.S. J. Theor. Biol., 2005, 235, 169. Grey, F.; Meyers, H.; White, E.A.; Spector, D.H.; Nelson, J. PLoS Pathog., 2007, 3, e163. Felli, N.; Fontana, L.; Pelosi, E.; Botta, R.; Bonci, D.; Facchiano, F.; Liuzzi, F.; Lulli, V.; Morsilli, O.; Santoro, S.; Valtieri, M.; Calin, G.A.; Liu, C.G.; Sorrentino, A.; Croce, C.M.; Peschle, C. Proc. Natl. Acad. Sci. USA, 2005, 102, 18081

Translational Controlled mRNAs: New Drug Targets in Infectious Diseases? [131]

[132] [133]

[134] [135] [136]

[137] [138]

[139] [140] [141] [142]

[143] [144]

[145] [146] [147] [148]

Pfeffer, S.; Zavolan, M.; Gr‰sser, F.A.; Chien, M.; Russo, J.J.; Ju, J.; John, B.; Enright, A.J.; Marks, D.; Sander, C.; Tuschl, T. Science, 2004, 304, 734. Clancy, J.L.; Nousch, M.; Humphreys, D.T.; Westman, B.J.; Beilharz, T.H.; Preiss, T. Methods Enzymol., 2007, 431, 83. Triboulet, R.; Mari, B.; Lin, Y.L.; Chable-Bessia, C.; Bennasser, Y.; Lebrigand, K.; Cardinaud, B.; Maurin, T.; Barbry, P.; Baillat, V.; Reynes, J.; Corbeau, P.; Jeang, K.T.; Benkirane, M. Science, 2007, 315, 1579. Sauvonnet, N.; Pradet-Balade, B.; Garcia-Sanz, J.A.; Cornelis, G.R. J. Biol. Chem., 2002, 277, 25133. Rausch, U.P.; Jordan, M.; Rodel, F.; Aigner, T.; Otterness, I.G.; Beuscher, N.; Rollinghoff, M.; Beuscher, H.U. Cytokine, 1994, 6, 504. Kunert, A.; Losse, J.; Gruszin, C.; H¸hn, M.; Kaendler, K.; Mikkat, S.; Volke, D.; Hoffmann, R.; Jokiranta, T.S.; Seeberger, H.; Moellmann, U.; Hellwage, J.; Zipfel, P.F. J. Immunol., 2007, 179, 2979 O'Hehir, R.E.; Buelow, R.; Yssel, H.; Lamb, J.R. Immunol. Lett., 1991, 30, 165. Roura-Mir, C.; Wang, L.; Cheng, T.Y.; Matsunaga, I.; Dascher, C.C.; Peng, S.L.; Fenton, M.J.; Kirschning, C.; Moody, D.B. J. Immunol., 2005, 175, 1758. van Deuren, M.; Netea, M.G.; Hijmans, A.; Demacker, P.N.; Neeleman, C.; Sauerwein, R.W.; Bartelink, A.K.; van der Meer, J.W. J. Infect. Dis., 1998, 177, 1401. Stoiber, D.; Stockinger, S.; Steinlein, P.; Kovarik, J.; Decker, T. J. Immunol., 2001, 166, 466. Schnupf, P.; Hofmann, J.; Norseen, J.; Glomski, I.J.; Schwartzstein, H.; Decatur, A.L. Mol. Microbiol., 2006, 61, 999. van Zandbergen, G.; Gieffers, J.; Kothe, H.; Rupp, J.; Bollinger, A.; Aga, E.; Klinger, M.; Brade, H.; Dalhoff, K.; Maass, M.; Solbach, W.; Laskay, T. J. Immunol., 2004, 172, 1768. Wahl, C.; Maier, S.; Marre, R.; Essig, A. Int. J. Med. Microbiol., 2003, 293, 377. Beverley, S.M.; Akopyants, N.S.; Goyard, S.; Matlib, R.S.; Gordon, J.L.; Brownstein, B.H.; Stormo, G.D.; Bukanova, E.N.; Hott, C.T.; Li, F.; MacMillan, S.; Muo, J.N.; Schwertman, L.A.; Smeds, M.R.; Wang, Y. Philos Trans R Soc. Lond. B. Biol. Sci., 2002, 357, 47. Clayton, C.; Shapira, M. Mol. Biochem. Parasitol., 2007, 156, 93. Cohen-Freue, G.; Holzer, T.R.; Forney, J.D.; McMaster, W.R. Int. J. Parasitol., 2007, 37, 1077. Haile, S.; Papadopoulou, B. Curr. Opin. Microbiol., 2007, 10, 569. Ivens, A.C.; Peacock, C.S.; Worthey, E.A.; Murphy, L.; Aggarwal, G.; Berriman, M.; Sisk, E.; Rajandream, M.A.; Adlem, E.; Aert, R.; Anupama, A.; Apostolou, Z.; Attipoe, P.; Bason, N.; Bauser, C.; Beck, A.; Beverley, S.M.; Bianchettin, G.; Borzym, K.; Bothe, G.; Bruschi, C.V.; Collins, M.; Cadag, E.; Ciarloni, L.; Clayton, C.; Coulson, R.M.; Cronin, A.; Cruz, A.K.; Davies, R.M.; De Gaudenzi, J.; Dobson, D.E.; Duesterhoeft, A.; Fazelina, G.; Fosker, N.; Frasch, A.C.; Fraser, A.; Fuchs, M.; Gabel, C.; Goble, A.; Goffeau, A.; Harris, D.; Hertz-Fowler, C.; Hilbert, H.; Horn, D.; Huang, Y.; Klages, S.; Knights, A.; Kube, M.; Larke, N.; Litvin, L.; Lord, A.; Louie, T.; Marra, M.; Masuy, D.; Matthews, K.; Michaeli, S.; Mottram, J.C.; M¸ller-Auer, S.; Munden, H.; Nelson, S.; Norbertczak, H.; Oliver, K.; O'Neil, S.; Pentony, M.; Pohl, T.M.; Price, C.; Purnelle, B.; Quail, M.A.; Rabbinowitsch, E.; Reinhardt, R.; Rieger, M.; Rinta, J.; Robben, J.; Robertson, L.; Ruiz, J.C.; Rutter, S.; Saunders, D.; Sch‰fer, M.; Schein, J.;




[149] [150] [151] [152] [153] [154] [155] [156] [157] [158] [159] [160] [161] [162] [163] [164] [165] [166] [167] [168] [169] [170] [171] [172] [173] [174] [175] [176] [177] [178]

261

Schwartz, D.C.; Seeger, K.; Seyler, A.; Sharp, S.; Shin, H.; Sivam, D.; Squares, R.; Squares, S.; Tosato, V.; Vogt, C.; Volckaert, G.; Wambutt, R.; Warren, T.; Wedler, H.; Woodward, J.; Zhou, S.; Zimmermann, W.; Smith, D.F.; Blackwell, J.M.; Stuart, K.D.; Barrell, B.; Myler, P.J. Science, 2005, 309, 436. Miller, J.S. Mol. Biochem. Parasitol., 1988, 30, 175. Bhaumik, M.; Das, S.; Adhya, S. Parasitology, 1991, 103 Pt 2, 197. Wallach, M.; Fong, D.; Chang, K.P. Nature, 1982, 299, 650. Landfear, S.M.; Wirth, D.F. Nature, 1984, 309, 716. Purdy, J.E.; Donelson, J.E.; Wilson, M.E. Exp. Parasitol., 2005, 110, 102. Boucher, N.; Wu, Y.; Dumas, C.; Dube, M.; Sereno, D.; Breton, M.; Papadopoulou, B. J. Biol. Chem., 2002, 277, 19511. McNicoll, F.; Muller, M.; Cloutier, S.; Boilard, N.; Rochette, A.; DubÈ, M.; Papadopoulou, B. J. Biol. Chem., 2005, 280, 35238. Horn, D. Int. J. Parasitol., 2001, 31, 1157. Folgueira, C.; Quijada, L.; Soto, M.; Abanades, D.R.; Alonso, C.; Requena, J.M. J. Biol. Chem., 2005, 280, 35172. Quijada, L.; Soto, M.; Alonso, C.; Requena, J.M. J. Biol. Chem., 1997, 272, 4493. Yoffe, Y.; Zuberek, J.; Lerer, A.; Lewdorowicz, M.; Stepinski, J.; Altmann, M.; Darzynkiewicz, E.; Shapira, M. Eukaryot. Cell, 2006, 5, 1969. Soto, M.; Iborra, S.; Quijada, L.; Folgueira, C.; Alonso, C.; Requena, J.M. Biochem. J., 2004, 379, 617. Soto, M.; Quijada, L.; Alonso, C.; Requena, J.M. Biochem. J., 2000, 346 Pt 1, 99. Aly, R.; Argaman, M.; Halman, S.; Shapira, M. Nucleic Acids Res., 1994, 22, 2922. Argaman, M.; Aly, R.; Shapira, M. Mol. Biochem. Parasitol., 1994, 64, 95. Larreta, R.; Soto, M.; Quijada, L.; Folgueira, C.; Abanades, D.R.; Alonso, C.; Requena, J.M. BMC Mol. Biol., 2004, 5, 3. Shapira, M.; Zilka, A.; Garlapati, S.; Dahan, E.; Dahan, I.; Yavesky, V. Med. Microbiol. Immunol., 2001, 190, 23. Zilka, A.; Garlapati, S.; Dahan, E.; Yaolsky, V.; Shapira, M. J. Biol. Chem., 2001, 276, 47922. Zeiner, G.M.; Sturm, N.R.; Campbell, D.A. J. Biol. Chem., 2003, 278, 38269. Brittingham, A.; Miller, M.A.; Donelson, J.E.; Wilson, M.E. Mol. Biochem. Parasitol., 2001, 112, 51. Haile, S.; DupÈ, A.; Papadopoulou, B. Nucleic Acids. Res., 2008. Gomez, M.A.; Li, S.; Tremblay, M.L.; Olivier, M. J. Biol. Chem., 2007, 282, 36190. Hawn, T.R.; Ozinsky, A.; Underhill, D.M.; Buckner, F.S.; Akira, S.; Aderem, A. Microbes Infect., 2002, 4, 763. Moore, K.J.; Turco, S.J.; Matlashewski, G. J. Leukoc. Biol., 1994, 55, 91. Lima, M.F.; Kierszenbaum, F. J. Protozool., 1982, 29, 566. Li, H.; Tschudi, C. Mol. Cell Biol., 2005, 25, 2216. Gao, H.; Ayub, M.J.; Levin, M.J.; Frank, J. Proc. Natl. Acad. Sci. USA, 2005, 102, 10206. Pays, E.; Vanhamme, L.; Berberof, M. Annu. Rev. Microbiol., 1994, 48, 25. Mair, G.R.; Braks, J.A.; Garver, L.S.; Wiegant, J.C.; Hall, N.; Dirks, R.W.; Khan, S.M.; Dimopoulos, G.; Janse, C.J.; Waters, A.P. Science, 2006, 313, 667. Zhang, K.; Rathod, P.K. Science, 2002, 296, 545.

262


RNA Interference-Based Therapeutics: New Strategies to Fight Infectious Disease M. López-Fraga*, N. Wright and A. Jiménez Sylentis S.A.U., Parque Tecnológico de Madrid, C/Santiago Grisolía nº 2, Tres Cantos 28760 (Madrid) - Spain Abstract: For many years, there has been an ongoing search for new compounds that can selectively alter gene expression as a new way to treat human disease by addressing targets that are otherwise “undruggable” with traditional pharmaceutical approaches involving small molecules or proteins. RNA interference (RNAi) strategies have raised a lot of attention and several compounds are currently being tested in clinical trials. Viruses are the obvious target for RNAitherapy, as most are difficult to treat with conventional drugs, they become rapidly resistant to drug treatment and their genes differ substantially from human genes, minimizing side effects. Antisense strategy offers very high target specificity, i.e., any viral sequence could potentially be targeted using the complementary oligonucleotide sequence. Consequently, new antisense-based therapeutics have the potential to lead a revolution in the anti-infective drug development field. Additionally, the relatively short turnaround for efficacy testing of potential RNAi molecules and that any pathogen is theoretically amenable to rapid targeting, make them invaluable tools for treating a wide range of diseases. This review will focus on some of the current efforts to treat infectious disease with RNAi-based therapies and some of the obstacles that have appeared on the road to successful clinical intervention.

Keywords: RNAi, infectious disease, siRNA, antiviral, therapy. DISCOVERY AND MECHANISM MEDIATED GENE SILENCING

OF

RNAi-

In order to design novel and effective antiviral RNAibased therapies, a proper understanding of its mechanism of action and function is required. RNAi was first described in 1998 by Andrew Fire and Craig Mello, who described the use of antisense RNA to silence gene expression in the nematode Caenorhabditis elegans [1]. When these worms were injected with long strands of dsRNA, a strong specific gene silencing was observed, and interestingly, this effect was more prominent when single-stranded RNAs were used. The effects of this interference were evident in both the injected animals and their progeny. The ability to use long dsRNAs to silence gene expression in a highly specific manner has also been shown in plants [2] and Drosophila [3]. Shortly after, RNAi was also shown to occur in mammalian cells, not directly through long dsRNA, but in response to double-stranded small interfering RNAs (siRNAs) of 21 nucleotides (nt) in length [4]. These siRNA were generated by an RNase class III riboendonuclease called Dicer from the cleavage of those long dsRNA into small active species [5]. The protein Dicer typically contains an N-terminal RNA helicase domain, an RNA-binding so-called Piwi/Argonaute/Zwille (PAZ) domain, two RNase III domains and a double-stranded RNA binding domain (dsRBD) [6] and its action leads to the formation of short 21-23 nt duplexes with a 2 nt overhang at the 3’-end and a 5’-phosphate and a 3’-hydroxy group. These siRNAs generated by the action of Dicer are incorporated into the RNA-induced silencing complex, RISC [7], which includes the endonuclease Argonaute 2 (AGO2). AGO2 is *Address correspondence to this author at the Sylentis S.A.U., Parque Tecnológico de Madrid, C/Santiago Grisolía nº 2, Tres Cantos 28760 (Madrid) - Spain; Tel: +34 91 804 38 17; Fax: +34 91 804 95 97; E-mail: [email protected]

1871-5265/08 $55.00+.00

responsible for the cleavage activity of RISC and is the only member of the Argonaute family with described catalytic activity in mammalian cells [8]. RISC needs to be activated and become RISC* by the action of AGO2, that depending on the directionality of the siRNA cleaves one of the RNA strands, the sense or passenger strand [9], and generates a single stranded antisense or guide strand that will guide RISC* to the complementary sequence in the target mRNA [10, 11]. Through Watson-Crick base pairing, the siRNA binds to the complementary portion of the mRNA and the endonuclease activity of RISC cleaves the mRNA between bases 10 and 11 relative to the 5’ end of the siRNA guide strand [3]. Due to the presence of unprotected RNA ends in these newly generated fragments, the cleaved mRNA is then degraded by intracellular nucleases and can no longer be translated into protein [12], while the RISC complex is recovered for further cleavage cycles [13]. Recent discoveries have revealed the existence of endogenous post-transcriptional regulatory mechanisms that have crucial roles in animal development. These mechanisms are mediated by microRNAs (miRNAs), which are small non-coding RNAs of 22 nt in length that bind their target mRNAs through their 3’ untranslated regions (3’ UTRs), with which they share partial sequence complementarity [14, 15]. This binding results in translational repression by a number of mechanisms [16, 17], which is often accompanied by mRNA degradation in cytoplasmic compartments known as processing bodies or P-bodies [18]. When miRNAs share complete sequence complementarity with their target mRNAs, they instead direct their cleavage by RISC activity [19]. These miRNAs differ from siRNAs in that they are produced as a distinct species from a specific precursor that is encoded in the genome and form imperfect stem-loop structures [20, 21]. The mature miRNA is most frequently derived from one arm of the precursor hairpin, and is released from the original transcripts in a stepwise process mediated by RNase III enzymes Drosha and Dicer [22, 23], © 2008 Bentham Science Publishers Ltd.

RNA Interference-Based Therapeutics

both of which generate 2 nt long 3’ overhangs at the cleavage site. The precursor miRNA transcripts, located in the nucleus, are known as pre-miRNA and form hairpin structures that are subsequently processed into 70 nt imperfect stem-loop structures (pre-miRNAs) by Drosha [22]. These pre-miRNAs are transported to the cytoplasm by Exportin 5 (Exp5) [24] and further processed by Dicer into 21-25 nt imperfect dsRNA duplexes that constitute the mature miRNAs [25], which are then loaded into RISC [26]. Imperfect sequence complementarity between both strands of miRNA might prevent AGO2 from cleaving the passenger strand [26], which is instead unwound and discarded. The remaining complex then binds to its target mRNA 3’ UTR, where RISC directs translational repression and subsequent mRNA degradation. The seed sequence of the mature miRNA, which includes the first 2-8 nt from its 5’ end [27], must have complete complementarity with the target, whereas mismatched nucleotides in the 3’ end are more tolerated. The goal of RNAi-based therapy is to mimic this naturally occurring process and target specific mRNA sequences to induce selective gene silencing. This can be done by two means: a transient transfection into the cytoplasm of synthetic siRNAs that mimic Dicer cleavage products and can be loaded directly into the RISC complex or a long term and stable expression using a viral vector of a short hairpin RNA (shRNA), that resembles miRNA precursors [28, 29]. While siRNAs only transiently silence gene expression because their intracellular concentrations are diluted over the successive cell divisions, shRNAs mediate long-term and stable silencing of their targets for as long as the transcription of the shRNAs takes place. Problems surrounding this latter approach are the same as those encountered in gene therapy and also those related to the expression of exogenous longer RNAs. On the other hand, siRNAs elicit very potent and predictable effects at relatively low doses and are less likely to interfere with naturally occurring miRNA processes, as they enter the endogenous processing pathway at a later stage [30]. Therefore, current therapeutic efforts seem to be more focused towards the use of synthetic siRNAs. HARMFUL siRNA EFFECTS Activation of Interferon Responses It is now known that, in mammalian cells, dsRNA longer than 30 bp can activate a potent innate immune response leading to non-specific effects. Detection of RNA molecules occurs during viral infection and represents a first line of defence against viral infection [31], leading to the production of type I interferons, downregulation of gene expression and induction of apoptosis. These effects can also be triggered in a sequence specific manner and also seem to be cell type specific [32, 33]. RNA-sensing detectors inside the cells include three members of the Toll-like receptor (TLR) family (TLR3, TLR7, TLR8) and cytosolic RNA-binding proteins like PKR and helicases RIG-I and Mda5 [34]. Therefore, long dsRNA should not be used as an experimental tool to trigger RNAi in mammalian cells. It was originally thought that short dsRNAs, like siRNAs, would not trigger interferon responses, however, this does not always hold true. Important advances have been made lately


263

to understand the mechanisms of interferon response to foreign pathogens and nucleic acids, providing important clues into the design of synthetic siRNAs so that these unwanted effects can be avoided. Several immunostimulatory motifs that can activate type I interferon responses in plasmacytoid dendritic cells via their endosomal TLRs have been identified [35-37], so these sequences should be avoided in the design of siRNAs (e.g., 5’-UGUGU-3’ and 5’-GUCCUUCAA-3’). In a similar manner, delivery methods that target siRNAs to the endosomal compartment are more likely to trigger interferon responses. In cell culture, cationic lipid transfection agents deliver nucleic acids to this compartment, while electroporation does not and is therefore less likely to induce these responses [38]. The same principle applies in vivo, where intravenous administration to mice of unmodified siRNAs complexed in lipid particles is more likely to induce IFN pathway activation [39] than intravenous administration of unmodified naked siRNAs [40]. Chemically synthesized siRNAs are also preferable to siRNAs transcribed by the bacteriophage T7 RNA polymerase, which leaves behind 5’ triphosphates that induce type I interferon production [41]. Blunt-ended siRNAs lacking the 3’ 2 nt overhangs characteristic of the Dicer processing are also immunostimulatory and are recognized by RIG-I helicase [42], which does not require siRNA transit though the endosomal pathway. The use of chemically modified RNAs may overcome many of the problems described for siRNAs. For example, the presence of 5’-methyl-dC, N6-methyl-A, 2’-O-methyl or pseudouridine bases prevents recognition of RNAs by TLRs [43]. For a full overview of modifications that can render siRNAs “invisible” to the innate immune system see the review by Hornung, et al. [44]. Off-target Effects Nucleic acid base pairing is highly specific. Nevertheless, siRNAs have been shown to cause widespread changes in expression levels in seemingly unrelated genes [45-47]. As explained before, RNAi is mediated by multiprotein complexes that repress gene expression in different ways. Exogenously supplied siRNAs can function as miRNAs, silencing gene expression with surprisingly limited sequence homology at the 3’ UTRs of the off-target genes. Target specificity for miRNAs depends to a great extent on a 7 nt region, called “seed region” or “seed sequence”, comprising nucleotides 2 to 8 from the 5’ end of the guide strand on the miRNA [48], thus, such a short stretch of nucleotides is enough to trigger the unwanted off-target effects (OTEs). Considering the size of the entire mammal transcriptosome, the possibility of finding 7 nt complementarity regions with any given siRNA is far greater than would have been desirable. It has been described that some ribose chemical modifications in the guide strand can suppress most OTEs, while maintaining specific mRNA silencing [49, 50]. Specifically, the introduction of a 2’-O-methyl modification within the seed region (at position 2) has been shown to inactivate the off-target activity of the siRNA without compromising silencing. Consequently, careful bioinformatic design and analysis must be used to reduce sequence-related OTEs and extensive


preclinical studies must be performed when developing any siRNA-based therapy. Saturation of the Endogenous Silencing Pathways Another potential harmful effect when using RNAi is the saturation of endogenous silencing pathways. Some reports have described that heavily expressed shRNAs can saturate Exp5, inhibiting endogenous pre-miRNA nuclear export and subsequently inducing mice lethality [30]. It has also been shown that strong promoter-driven shRNA expression induces cytotoxicity in primary lymphocytes, whereas the same shRNA expressed using a weaker promoter presents no toxic effects [51]. Altogether, it proves important to optimize the expression levels of the silencing constructs in order to avoid interfering with important endogenous pathways. NON-VIRAL DELIVERY STRATEGIES Duplex siRNAs are negatively charged molecules and cannot easily penetrate hydrophobic cellular membranes without the assistance of delivery carriers. These carriers also dramatically enhance their half life, even when chemical modifications are employed to stabilize the duplexes from degradation. A recent report from Morrissey et al. showed that the plasma half life of an unmodified siRNA in mice was 2 min, which could be improved to 49 min after the introduction of some chemical modifications in the duplex and up to 6.5 h when the modified duplex was encapsulated in lipids [39]. Another consideration when studying the delivery strategy is local versus systemic delivery. All these issues will be reviewed in this section. siRNA Stability Even though dsRNA is more resistant to nuclease activity than ssRNA, unmodified siRNAs are highly unstable and become rapidly degraded by serum nucleases when administered intravenously in mammals. Nevertheless, for siRNAs to be used as potential therapeutic drugs the issue of stability in different environments needs to be addressed. Stability against nuclease degradation has been achieved by introducing certain chemical modifications of the oligonucleotides, such as modifications at the 2’ position of the ribose, including 2’-O-methylpurines and 2’-fluoropyrimidines [52]. In addition, degradation can also be delayed by complexing the oligonucleotides with delivery carriers [39]. In this study, 2’-O-methyl modified siRNAs targeted to the hepatitis B virus RNA was incorporated into a specialized liposome, conferring significant protection against in vivo infection with HBV and specific reduction of HBV DNA in a dose-dependent manner that lasted for up to 7 days. The correct positioning of the modifications has been proved to be of great relevance, as modifications on the 5’ end of the guide strand could adversely affect silencing potency [53]. Additionally, 2’-methyl modified siRNAs might avoid interferon induction [39]. Overall, the improvements described above, including persistence of in vivo activity, use of lower doses and reduced dosing frequency are important steps in making siRNAs a clinically viable therapeutic approach. Local vs. Systemic Administration Some of the aspects to be considered when selecting the site of administration are the possible side effects derived

López-Fraga et al.

from the presence of siRNA in sites different from the target tissue, and the amount of siRNA required to achieve acceptable levels at the target tissue after systemic administration. The issue of side effects at non-targeted tissues is only a problem when the molecular target is expressed in nontargeted tissues because of the high sequence specificity of siRNAs. In this case, local delivery might be preferable over systemic delivery. Nevertheless, when aiming molecular targets belonging to infectious agents, the chances of finding the same targets in host tissues are very slim. As for the accessibility of the target tissue, some organs, such as the liver, are very easily reached by systemic delivery, but in general, the doses of siRNA required for efficacy are considerably lower when the therapeutic compound can be administered directly at or near the target site rather than when administered systemically. Systemic delivery with selective targeting to specific cell surface receptors can also be an interesting alternative in order to reduce dosage and reduce potential OTEs in nontarget tissues. Following this line, heavy chain antibody fragments (Fabs) [54], aptamers [55, 56], nanoparticles coated with specific ligands [57] and small peptides [58, 59] have been used. Delivery Vehicles Many different methods have been evaluated in order to facilitate siRNA delivery. Nucleic acids have negative charges, therefore, cationic polymers and lipid formulations have been widely used to facilitate their transport across biological membranes, achieving greater efficacy with substantially lower and/or less frequent doses. However, there are reports describing success with RNAi in vivo using “naked” siRNA duplexes to tissues such as the eye [60, 61], lung [62-64] and central nervous systems [65-68]. Liposomes are vesicles that consist of a hydrophilic compartment, typically containing the drug, enclosed in a phospholipid bilayer, which makes them suitable as drug delivery vehicles. Specialized lipid bilayers known as stablenucleic acid-lipid particles (SNALPs) have also been used. They typically comprise a lipid component, cholesterol and polyethylene glycol (PEG). These types of lipid particles have been successfully used to deliver antisense oligonucleotides and siRNAs [39, 69-71]. Lipoplexes are complexes of cationic lipids and nucleic acids that form spontaneously and usually form rather heterogeneous and unstable structures, usually requiring their preparation immediately before use. They are very frequently used for in vitro transfections but are less desirable as drug delivery agents in terms of reproducibility and manufacturing. Polyethylenimine (PEI) polymers are synthetic linear or branched structures with protonable amino groups and high cationic charge densities that, after complexing with oligonucleotides, interact with the cell surface through electrostatic charges and are endocytosed, leading to endosomal destabilization and osmotic release of the complexes into the cytoplasm [72]. Though widely used to mediate nucleic acid delivery, they are less accepted for siRNA delivery in vivo due to variable performance and high toxicity. Nevertheless, modified versions of PEI or PEI used in more complex


compositions has yielded interesting results in vivo [39, 6971]. Another delivery strategy that uses charge interactions to complex siRNA with targeting “partners” involves the use of receptor-specific chimeric peptides [59] and the use of recombinant antibody protamine fusion technology. In a study by Song et al., protamine is used for its nucleic acidbinding properties and the HIV envelope glycoprotein (gp160)-specific Fab fragment to mediate receptor-specific binding to gp160-expressing melanoma cells or HIVinfected CD4 + T cells [54]. Other methods that have been tested to deliver siRNAs to certain tissues include the chemical conjugation of the siRNA sense strand to a cholesterol molecule. Specific silencing of ApoB in mice has been demonstrated after intravenous administration of cholesterol-conjugated siRNA duplex [73]. Finally, atelocollagen is a highly purified type-1 collagen of calf dermis digested by pepsin that has been shown to be an effective vehicle for local delivery of oligonucleotides to metastasized tumors following intravenous delivery [74]. Uptake of siRNAs was not exclusive to tumor cells but did not cause other unspecific proinflammatory responses. In spite of all the studies showing successful nucleic acid delivery in vivo using lipids or polymers, there are still a number of issues related to their cytotoxic effects that need to be considered [71]. Much of the toxicity of cationic lipids is related to electrostatic effects. Negatively charged serum proteins alter the interaction between the negatively charged nucleic acids and the cationic lipids and disrupt the complexes [75]. Additionally, particle aggregation in the capillary beds can result in serious damage and interaction with complement proteins can lead to inflammation. Higher doses of lipids have also been described to induce lymphopenia, thrombocytopenia and hepatic necrosis [76]. However, further research will reveal new formulations for which toxicity is minimal and the risk of pathology is reduced. VIRAL DELIVERY STRATEGIES For some chronic diseases, where prolonged treatments might be needed, viral-mediated expression of RNAi might be the most convenient alternative, providing a sustained and even theoretically permanent down modulation of gene expression depending on the vector employed. This approach involves the integration of shRNA-coding transgenes into the genome or episomal expression. Adeno and adeno-associated viruses (AAVs) can be used to induce a transient expression of shRNAs in pathologies where long term expression of the RNAi might not be necessary, such as cancers and acute infections. These are non-integrating vectors that can transduce both dividing and non-dividing cells. The main drawback of adenoviral vectors remains that possible repeated applications induce strong innate and adaptive immune responses that may lead to toxicity and would compromise the effectiveness of the treatment [77], but they can be modified to exclude all viral sequences except for the packaging elements and the terminal repeats [78]. These vectors are more difficult to propagate but have an improved safety profile and are able to maintain gene transfer in vivo


265

for long periods (>2 years). To reduce immune responses to adenoviruses, recent studies have also used PEG, which reduces protein-protein interactions and inhibits immunostimulation, while it allows the vectors to remain capable of efficient gene delivery in vivo [79]. Furthermore, AAVs have no demonstrated pathogenicity associated with their infection and can be propagated in a relatively easy manner [80]. Alternatively, lentiviral vectors induce stable expression of the desired shRNA, as they promote transgene integration into the host genome and they can transduce both dividing and non-dividing cells. This can be a useful approach for the treatment of chronic diseases and infections [81]. Nevertheless, as with any form of gene therapy, there is a serious safety concern associated with viral forms of delivery. We also need to take into account the issue of a possible endogenous pathway diversion due to high expression levels , which results in toxicity in mice [30]. As for any drug, it is critical to control the amount and timing of drug exposure, which is not always possible to fully predict when using viral-mediated means of expression. Therefore, the decision on whether to use viral delivery must be made based on the required duration of the treatment and the cells or tissues that need to be treated. The balance between the advantages and potential risks must be seriously considered. RNAi AS APPROACH

AN

ANTIVIRAL

THERAPEUTIC

Since the first report on RNAi-mediated inhibition of respiratory syncytial virus (RSV) in 2001 [82], several in vivo proof-of-concept studies have shown that this technology will likely be a viable therapeutic alternative in the future. The limitations of current therapies for many viral infections have drawn more and more attention to the antisense field. Human immunodeficiency virus (HIV) is the perfect example of a virus where immediate intervention is needed. Although significant success has been achieved with current antiviral therapies, their toxicity, complexity, cost and mostly the appearance of drug resistances call for novel ways of intervention. Another example of a viral disease where more could be achieved is Influenza A infection. In this case, new therapies are required every year to fight seasonal strains, as these viruses change their viral determinants and new virulent strains continuously emerge [83]. Most hepatitis B and C virus (HBV and HCV, respectively) infections progress to chronic liver disease, and patients eventually end up developing cirrhosis and requiring liver transplants [84] or developing liver cancer as they show a poor response to current therapies [85]. There is also the remarkable example of the flaviviruses, including dengue virus (DENV), Japanese encephalitis virus (JEV), yellow fever virus (YFV) and West Nile virus (WNV). They are pathogens responsible for important human disease and mortality. Severe manifestations of their infection include hemorrhaging fever, encephalitis and neurological sequelae. Currently, there is no specific therapy available for any flavivirus infection and there are only commercial vaccines for 3 flaviviruses. Altogether, a potential role for RNAibased intervention is becoming increasingly clear.


López-Fraga et al.

for virus replication could also be targeted, reducing the risk of viral escape, although the chances of affecting vital cell processes by this approach are considerable. However, this approach has been employed effectively in several studies [101]. One example of a possible host protein that could be targeted is the chemokine receptor CCR5, that acts as a coreceptor for HIV-1, but whose mutation is compatible with normal life [102].

The issue of whether RNAi plays a role in antiviral defense mechanisms in mammalian cells remains controversial [86-88], but recent reports have shown that primate foamy virus type 1 (PFV-1) and vesicular stomatitis virus (VSV) are inhibited by cellular miRNAs miR-32 and miR24/miR-93, respectively [89, 90]. Knock-down of miR-32 expression by antisense oligonucleotides or deletion of the miRNA target sequence from the viral genome significantly enhanced PVF-1 replication [89]. Similarly, when the expression of miR-24 and miR-93 is reduced in Dicerdeficient mice, there is a strong increase in VSV replication [90]. In addition, cellular miRNA expression patterns can be significantly altered upon HIV-1 infection [91]. More specifically, HIV-1 actively suppresses expression of miR17-5p and miR-20a [92], both of them involved in the Dicer and Drosha-mediated silencing of HIV-1. Recently, Pedersen et al. have reported that the type I interferon IFN rapidly modulates the expression of numerous cellular miRNAs, and that some of those miRNAs have sequence-predicted targets within the HCV genomic RNA [93]. All this evidence supports the idea that RNAi can be successfully used to combat infectious disease, provided that efficient siRNAs are designed, and many groups have already obtained proof-ofprinciple in in vivo animal models, as shown in Table (1). In general, most studies use prophylactic RNAi treatments to prevent virus replication. However, some antiviral effects were also observed when RNAi treatments were given after viral challenge [62, 94, 95]. In summary, the evidence supports the idea that novel RNAi-based prophylactic and therapeutic strategies against viral infections will have a great impact in the years to come. Targets for Antiviral RNAi Strategies In order to obtain durable and effective antiviral therapies, we need to identify viral proteins, or parts of proteins, that can be disabled. Ideally, these targets should be essential viral factors and share conserved sequences across many different strains, or even among different species of virus from the same family, so a single target will have broad effectiveness. Nevertheless, viruses often mutate their target sequences in order to escape RNAi attack [96-100]. Additionally, target sequences should be as different as possible from any human protein (or part of the protein), to reduce the likelihood of side effects. Alternatively, host factors essential

Finally, UTRs of RNA viruses contain complex RNA structures that are often indispensable for viral replication. Targeting these regions might prevent viral escape, as they might not be permissive to even single point mutations. However, as we will note later, these UTRs are often shielded by cellular proteins, which make them inaccessible to RNAi attack. Treatment with a combination of different siRNAs might also be a feasible approach to prevent viral escape [103, 104], similar to the current use of multiple antiviral drugs that prevent the emergence of resistant strains and effectively block virus replication. Nevertheless, by increasing the amount of exogenous siRNAs or shRNA administered, we are also increasing the possibility of generating the already mentioned unwanted side effects. As we learn more about the biology and life cycle of the different pathogens, new targets for therapeutic silencing may become evident and provide alternative RNAi inhibition strategies. Viral Defense Mechanisms To obtain optimal antiviral effects, it would be desirable to target virus at the early stages of replication. Due to its mechanism of action, RNAi can only take place once the virus has entered the cell. There have been contradictory reports on whether incoming viruses can be targeted by RNAi but some authors suggest that incoming viral RNA is protected by nucleocapside particles [105, 106]. It seems possible that prophylactic viral vaccines that would prevent infection are not achievable and it would consequently be reasonable to target all therapeutic efforts to newly synthesized viral transcripts. Some virus avoid RNAi attack by hiding their replication intermediates in protected compartments, such as the reovirus viral inclusions that form in the cytoplasm of infected cells [107, 108]. Flaviviruses hide their RNA genome from RNAi action by reorganizing the endoplasmic reticulum membrane [109]. Similarly, we can also find examples of alternative RNA structures that shield target sequences [110] as a means to evade natural antiviral RNAi responses [111]. Circular genomic and antigenomic RNA of hepatitis delta virus (HDV), which requires HBV for replication, is RNAi resistant due to its nuclear localization [112]. But even when it enters the cytoplasm, it remains inaccessible to RNAi action due to its rod-shaped structure (74% base pairing) or by binding to a host RNA-binding protein. Finally, some virus, such as RSV, rabies virus and VSV, protect their cytoplasmic genome by protein oligomerization along viral RNA, which confers protection from RISC attack [82, 113, 114].


Table 1.


267

RNAi-Based Studies in In Vivo Animal Models of Infection

Family

Target(s)

Route/delivery

Modified siRNAs

Main Outcome

Ref.

Hapadnaviridae

Hepatitis B

IV-hydrodynamic

shRNA

Reduced virus replication and viral antigen

[139]

Hepatitis B

IV-hydrodynamic

No


[140]

Hepatitis B

IV–hydrodynamic

No


[141]

Hepatitis B

IV–hydrodynamic

No

Study of endogenous regulation of RNAi in cell lines and mice

[142]

Hepatitis B

IV–hydrodynamic

Yes

Reduced viral DNA and antigen

[143]

Hepatitis B

IV–SNALP

Yes


[39]

Hepatitis B

IV-adenovirus

shRNA

Reduced virus replication and viral antigen, clearance of viral RNA

[144]

Hepatitis B

adenovirus

shRNA


[145]

Hepatitis B

IV–hydrodynamic

shRNA

Reduced viral antigens

[146]

Hepatitis B

intrasplenic– adenovirus

shRNA

Reduced viral load and viral antigen

[147]

Hepatitis C

IV-adenovirus

shRNA

Suppression of viral protein synthesis

[148]

Hepatitis C

IV-lactosylated cationic liposomes

siRNA

Suppression of intrahepatic HCV expression in transgenic mice

[149]

Hepatitis C(2)

IV-cationic liposome

siRNA

Reduced virus replication

[150]

No

Reduced lung titers

[94]

No

Reduced lung titers

[151]

No

Reduced lung titers and protection from lethal injection

[152]

Orthomyxoviridae

Influenza

IV–PEI IV or IN-shRNA

Influenza Influenza

IV–deacyl-PEI IV–hydrodynamic IN–cationic lipid

Enteroviridae

Influenza

IV-PEI-complexed vector

shRNA

Reduced lung titers and partial protection from lethal injection

[153]

CVB3

IV–hydrodynamic

No

Reduced viral tissue titers, attenuated tissue damage, and prolonged survival

[154]

Myocarditis amelioration

[155]

CVB3

Flaviviridae

Herpesviridae

Paramyxoviridae

CVB3

i.p.-lentivirus

shRNA

Decreased viral replication, and pancreatic tissue damage

[156]

CVB3

i.p.–lentivirus

shRNA

Reduced viral titers, myocarditis, and proinflammatory cytokines after challenge. Improved survival

[157]

West Nile virus

i.p.–hydrodynamic

No

Reduced viral load, partial protection from lethal infection

[158]

West Nile virus

Intracranial– lentivirus or lipidcomplexed

shRNA or mod. siRNA

Protection against lethal encephalitis

[159]

JEV

Intracranial– lentivirus or lipidcomplexed

shRNA or siRNA

Protection against lethal encephalitis

[159]

HSV2

intravaginal– cationic lipid

No

Protection from lethal infection

[160]

RSV, PIV

IN–naked or with lipofection agent

No

Reduced lung titers and pulmonary pathology

[62]


López-Fraga et al. (Table 1) Contd…..

Target(s)

Route/delivery

Modified siRNAs

Main Outcome

Ref.

RSV

IN-nanoparticles

No

Decreased virus titers in the lung. Decreased inflammation and airway reactivity

[95]

Parainfluenza

IN-lipofection agent

No

Reduced lung titers

[62]

Coronaviridae

SARS(1)

IT–naked

No

Reduced viral RNA and lung pathology

[63]

Picornaviridae

Foot-andmouth disease virus

SC injection in the neck

shRNA

Protection from lethal infection

[161]

P. berguei (malaria)

IV–naked

No

Reduced Berghepain 1 and 2 mRNA expression in the parasites

[124]

Family

Plasmodiidae

Except where indicated, all studies were performed in mouse models. 1 This study was performed in Rhesus macaques (Macaca mulatta). 2 This study was performed in marmosets (Callithrix jacchus). IV, intravenous; CVB3; Coxsackievirus B3; JEV, Japanese Encephalitis Virus; HSV2, Herpes Simplex Virus 1 ; RSV, Respiratory Syncytial Virus; SARS, Severe Acute Respiratory Syndrome

RNAi IN PARASITIC PROTOZOANS, HELMINTHS AND INSECT VECTORS Protozoan parasites are the cause of diseases of considerable medical and veterinary importance throughout Africa, Asia and the Americas. The first report of RNAi in protozoan parasites were made in Elisabetta Ullu´s laboratory in 1998 [115], where they described that dsRNA could induce sequence-specific mRNA degradation in Trypanosoma brucei. Since then, RNAi has not only provided an invaluable tool in the study of T. brucei biology, but also been tested as a therapeutic tool against T. brucei infection in vivo [116]. In a similar manner, T. congolense, which is the causative agent of nagana disease in cattle, has also been shown to posses RNAi machinery [117]. Conversely, T. cruzi [118], Leishmania donovani and L. major [119, 120] lack RNAi machinery, although they belong to the same family as T. brucei. Therefore, RNAi-based therapies might not be of use to fight these parasites. The widespread resistance of common anti-malarial drugs is showing the need of efficacious and innovative new drugs and vaccines to fight Plasmodium parasites [121]. While RNAi-like silencing has been reported in Plasmodium parasites [122-124], it remains controversial whether this phenomenon really takes place in these organisms. Unlike T. brucei, P. falciparum has no relevant homolog to Dicer, Piwi, PAZ or other genes involved in the RNAi pathways [125, 126]. As for Toxoplasma gondii, database mining has shown the presence of classical RNAi genes [126], but there is only one controversial report showing that RNAi might be operational in these parasites [127]. RNAi could potentially be used to contribute to the control of parasitic worms. Interestingly, while RNAi was first described in C. elegans, gene silencing by RNAi has been either impossible or inconsistent in other helminths [128]. This variability among studies might be due to the different delivery methods used, as suggested by one study

using Haemonchus contortus, where different delivery methods were compared in the silencing of a battery of genes [129]. Alternatively, study variations might also be due to different expressions in some parasitic helminths of the proteins SID-1, SID-2 and RSD-4, involved in cellular uptake and spread of dsRNA in C. elegans [130]. In recent years, the use of RNAi has become extremely appealing in the gene therapy field, and many biopharmaceutical companies have approached the treatment of human diseases, such as cancer, inflammation, neurodegenerative diseases and chronic infections using this technology. Nevertheless, the treatment of parasitic diseases remains less attractive at this point, given their acute nature that requires fast intervention. A more attractive approach might be transmission control, placing the vector species, such as mosquitoes, flies, ticks, etc., directly under RNAi attack [131]. This approach would be more permissive to the possibility of stable integration of shRNAs into the insect genome, as the safety concerns would not be such an issue, and would involve replacing natural insect populations with genetically modified ones that would be resistant to the infection or incapable of transmitting it to the human population. OTHER INFECTIONS Mycobacterial infections are incredibly difficult to treat due to the characteristic mycobacterial cell wall, extremely hard and naturally resistant to all antibiotics that work by destroying cell walls, and to the fact that they can elude sterilizing immunity by residing in the intracellular compartment in host cells, where they are protected from microbicidal attacks. This makes mycobacterial infections, such as tuberculosis (TB), perfect candidates to be treated by RNAibased therapeutics targeting host genes involved in mycobacteria invasion and growth inside the cells. The feasibility of using antisense therapy to treat Mycobacterium tuberculosis infection was probed in a study where phosphorothioate-modified antisense oligodeoxyribonucleotides



against the mRNA of glutamine synthetase were used [132]. This enzyme is associated with Mycobacterium pathogenicity and with the formation of a poly-L-glutamate/ glutamine cell wall structure. Therefore, reducing its activity and expression has a great impact on bacterial replication. One recent study has also shown inhibition of mycobacterial growth by inhibition of the lysosomal enzyme beta-hexosaminidase, which is a peptidoglycan hydrolase that facilitates mycobacteria-induced secretion of lysosomes at the macrophage plasma membrane [133]. FROM BENCH TO BEDSIDE RNA interference has advanced to clinical trials very rapidly. The most advanced programs concern the treatment of wet age-related macular degeneration. Ocular indications have been of great interest due to the fact that the interior of the eye is a relatively nuclease-free environment, and may be accessed directly by injection thereby avoiding delivery issues. Regarding infectious diseases, ongoing clinical trials in the field are shown in Table (2). The most advanced program concerns the treatment of infection by RSV using siRNA ALN-RSV01 developed by Alnylam Pharmaceuticals. According to a recent press release, this study has just completed a second phase II trial in adult lung transplant patients naturally infected with the virus, having previously obtained positive results from experimentally infected adults. In this case, the product is administered to the patient in a Table 2.

269

nasal formulation, again avoiding systemic delivery setbacks. Combinations of various shRNAs in a single vector have been designed and are in Phase I trials for both HIV and HBV. Also using a vector encoding four shRNAs specific for different sequences within the HCV genome, Nucleonics Inc. is planning to start clinical trials sometime this year. As may also be seen in Table (2), one of the main candidates still in the preclinical phase for the development of therapeutic alternatives is the treatment of HCV. An important effort was made to develop products for the treatment of pandemic flu by companies such as Alnylam Pharmaceuticals, Nastech, Protiva and Nucleonics, but have encountered different technical difficulties. Last August, representatives from Alnylam announced that the in vivo results did not achieve enough efficacy to move into the clinic, previously scheduled to happen some time during 2006. Another therapeutic program which seems to have encountered problems is the treatment of severe acute respiratory syndrome (SARS) caused by coronavirus and developed by Intradigm. In 2005 evidence of prophylactic and therapeutic effects of siRNA on Rhesus macaque delivered intranasally were published, however no further developments have been made public. Given the growth rate in this field, one can expect the number of clinical trials to grow significantly over the next few years, as increased knowledge of the mechanisms behind

RNAi-Based Therapeutics Currently Under Development Company

Target gene

Indication

Clinical phase

Alnylam Pharmaceuticals

RSV nucleocapsid protein (ALN-RSV01)

RSV

Phase II complete

Benitec

Tat/rev, CCR5, TAR (3 shRNAs in a lentivirus)

HIV (AIDS lymphoma)

Phase I

Nucleonics

Pre-gen./pre-C, Pre-S1, Pre-S2/S, X (NucB100 -plasmid with 4 shRNA)

HBV

Phase I

Merck & Co Inc

Sirna-034

HCV

Preclinical

CombiMatrix

Parallel chip-based target site optimization

HCV; HIV

Preclinical

Nucleonics

HCV (4shRNA in a vector)

HCV

Preclinical

Tacere therapeutics

3 regions of HCV genome (TT-033)

HCV

Preclinical

Alnylam Pharmaceuticals

siRNA directed against viral genes

Pandemic flu

Preclinical

Ebola virus Viral haemorrhagic fever PML by JCV Nastech Protiva

siRNAs directed against influenza virus genome

Pandemic flu

Preclinical Preclinical

Pro-EBOV

Ebola virus

Pro-MARV

Marburg virus

siRNAs directed against viral genome

HBV HCV

Intradigm

2 siRNAs targeting Coronavirus genome (siSC2, siSC5)

SARS

Preclinical

RSV, Respiratory Syncytial Virus; HIV, Human Immunodeficiency Virus; HBV, Hepatitis B Virus; HCV, hepatitis C Virus; PML, Progressive Multifocal Leukoencephalopathy; JCV, John Cunnigham Virus (Poliomaviridae); SARS, Severe Acute Respiratory Syndrome


this technology will allow us to increasingly curb OTEs and perfect efficient delivery methods. PROS AND CONS OF RNAi-BASED DRUGS COMPARED TO TRADITIONAL PHARMACEUTICAL DRUGS As a therapeutic tool, RNAi offers many possibilities and advantages compared with traditional drugs. These new drugs exploit a well characterized endogenous mechanism and offer the possibility of silencing virtually any pathological target or infectious organism, including those traditionally considered as “undruggable”. These targets include both intracellular and extracellular targets, the former not being susceptible to the action of drugs based on proteins and antibodies. These new drugs are also highly potent and specific and show persistent duration of their pharmacological action, which make it possible to reduce the dosing and frequency of administration. This has an impact on the amount and severity of the side effects and the overall cost of the treatment. Pharmaceutical development of RNAi-based leads is greatly reduced compared to that of traditional pharmaceutical drugs based on small molecules, proteins and antibodies (2 to 3 years compared to 4 to 6 years, Box 2). Additionally, once the leads have been identified and optimized, the production, which is based on a chemical synthesis, is quite simple and inexpensive. The main drawback of the technology was always thought to be inherent to the nature of its mechanism of action, i.e., they can only be used to silence molecular targets, and unlike small molecules, proteins and antibodies, they are not able to activate and/or enhance the action of a molecular target. Interestingly, a recent report by David Corey and colleagues showed that dsRNAs complementary to promoters within chromosomal DNA can also activate

López-Fraga et al.

gene expression [134], so this exciting possibility will need to be further addressed. Another challenge of RNAi technology at the present time is the development of suitable delivery systems that will allow, not only targeting to the right compartments, but also adequate levels of transfection into the target cells. Nevertheless, once these delivery methods have been identified, the potential of this technology is almost unlimited and all development efforts in the generation of new drugs will have to be focused on target identification and validation. CONCLUDING REMARKS Vaccines and drugs have traditionally been the method of choice to fight infectious agents. Nevertheless, infectious diseases remain a major challenge for modern medicine. In the case of viruses, their replication makes them very susceptible to suffer mutations, increasing the chance of obtaining new strains that can escape immune surveillance and acquire drug resistance, which greatly limits treatment options [135]. This is where RNAi has the potential to revolutionize the treatment of viral infections. RNAi therapy offers the great advantage of exclusive specificity, limiting pathogenic gene expression and replication, without suffering adverse side effects, as the targeted genes can be exclusive of the viral particles. Yet, viruses and host cells have undergone a parallel evolution and viruses have in some cases developed escape mechanisms, so a better understanding of their mutual relationship will enable us to choose appropriate targets for RNAi therapeutic intervention. For other non-viral infectious organisms, such as parasites and insect vectors, the success of RNAi application relies on the development of optimal methods to deliver specific RNAi systems into the desired organisms. For mammalian cells, new carrier systems and delivery methods



are continuously being developed and will continue to generate solutions to guarantee successful gene silencing. Electroporation and soaking have been effectively used to deliver siRNAs into parasites, but suitable ways of reaching these organisms once they have infected their hosts must be found in order to find viable anti-infective treatments. In the case of vector insects, direct microinjection into the body cavity of newly emerged mosquitoes [136] or stable expression of a transgene [137] are approaches that have already been successfully used.

HIV

=

Human immunodeficiency virus

HCV

=

Hepatitis C virus

DENV

=

Dengue virus

JEV

=

Japanese encephalitis virus

YFV

=

Yellow fever virus

WNV

=

West Nile virus

PFV-1

=

Foamy virus type 1

In the therapeutic application of RNAi to humans, general safety is the most important problem. A number of clinical trials with new drugs based on RNAi technology are currently being tested. A recent paper by Ambati and collaborators has raised a lot of questions regarding the specificity of RNAi-based therapies [138]. In this paper, the authors claim that any dsRNA at least 21 nucleotides in length, including two that are currently in clinical development as treatments for wet age-related macular degeneration, suppress neovascularization in the eye, skin and a variety of other organs regardless of their sequences or targets due to activation of TLR3 signalling. These results need to be confirmed, but they reveal that careful detailed screens of unwanted side effects, including unspecific silencing of unrelated genes or activation of interferon responses, will need to be performed with any new RNAi-based therapeutic.

VSV

=

Vesicular stomatitis virus

HDV

=

Hepatitis delta virus

TB

=

Tuberculosis

SARS

=

Severe acute respiratory syndrome

Overall, even though more detailed studies are needed in the field before RNAi therapeutics can become a reality, this technology shines through as an extremely promising tool in the development of modern drugs of the new millennium. ABBREVIATIONS

271

REFERENCES [1] [2] [3] [4] [5] [6] [7] [8]

[9] [10]

RNAi

=

RNA interference

dsRNA

=

Double strand RNA

siRNA

=

Small interfering RNAs

nt

=

Nucleotides

PAZ

=

Piwi/Argonaute/Zwille

dsRBD

=

Double-stranded RNA binding domain

RISC

=

RNA-induced silencing complex

AGO2

=

Argonaute 2

miRNAs

=

MicroRNAs

UTR

=

Untranslated regions

[23]

Exp5

=

Exportin 5

[24]

shRNA

=

Short hairpin RNA

TLR

=

Toll-like receptor

OTE

=

Off-target effect

HBV

=

Hepatitis B virus

SNALPs

=

Stable-nucleic acid-lipid particles

PEG

=

Polyethylene glycol

PEI

=

Polyethylenimine

AAV

=

Adeno-associated viruses

RSV

=

Respiratory syncytial virus

[11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21] [22]

[25] [26] [27] [28] [29] [30]

[31] [32]

Fire, A.; Xu, S.; Montgomery, M.K.; Kostas, S.A.; Driver, S.E.; Mello, C.C. Nature, 1998, 391, 806. English, J.J.; Mueller, E.; Baulcombe, D.C. Plant Cell, 1996, 8, 179. Elbashir, S.M.; Lendeckel, W.; Tuschl, T. Genes Dev., 2001, 15, 188. Elbashir, S.M.; Harborth, J.; Lendeckel, W.; Yalcin, A.; Weber, K.; Tuschl, T. Nature, 2001, 411, 494. Bernstein, E.; Caudy, A.A.; Hammond, S.M.; Hannon, G.J. Nature, 2001, 409, 363. Collins, R.E.; Cheng, X. FEBS Lett., 2005, 579, 5841. Hammond, S.M.; Bernstein, E.; Beach, D.; Hannon, G.J. Nature, 2000, 404, 293. Liu, J.; Carmell, M.A.; Rivas, F.V.; Marsden, C.G.; Thomson, J.M.; Song, J.J.; Hammond, S.M.; Joshua-Tor, L.; Hannon, G.J. Science, 2004, 305, 1437. Nykanen, A.; Haley, B.; Zamore, P.D. Cell, 2001, 107, 309. Matranga, C.; Tomari, Y.; Shin, C.; Bartel, D.P.; Zamore, P.D. Cell, 2005, 123, 607. Rand, T.A.; Petersen, S.; Du, F.; Wang, X. Cell, 2005, 123, 621. Orban, T.I.; Izaurralde, E. RNA, 2005, 11, 459. Hutvagner, G.; Zamore, P.D. Science, 2002, 297, 2056. Lee, R.C.; Feinbaum, R.L.; Ambros, V. Cell, 1993, 75, 843. Wightman, B.; Ha, I.; Ruvkun, G. Cell, 1993, 75, 855. Pillai, R.S.; Bhattacharyya, S.N.; Filipowicz, W. Trends Cell Biol., 2007, 17, 118. Jackson, R.J.; Standart, N. Sci. STKE, 2007, 367, re1. Liu, J.; Valencia-Sanchez, M.A.; Hannon, G.J.; Parker, R. Nat. Cell Biol., 2005, 7, 719. Yekta, S.; Shih, I.H.; Bartel, D.P. Science, 2004, 304, 594. Bartel, D.P. Cell, 2004, 116, 281. Lai, E.C. Curr. Biol., 2003, 13, R925. Lee, Y.; Ahn, C.; Han, J.; Choi, H.; Kim, J.; Yim, J.; Lee, J.; Provost, P.; Radmark, O.; Kim, S.; Kim, V.N. Nature, 2003, 425, 415. Lee, Y.; Jeon, K.; Lee, J.T.; Kim, S.; Kim, V.N. EMBO J., 2002, 21, 4663. Lund, E.; Guttinger, S.; Calado, A.; Dahlberg, J.E.; Kutay, U. Science, 2004, 303, 95. Hutvagner, G.; McLachlan, J.; Pasquinelli, A.E.; Balint, E.; Tuschl, T.; Zamore, P.D. Science, 2001, 293, 834. Preall, J.B.; Sontheimer, E.J. Cell, 2005, 123, 543. Lewis, B.P.; Burge, C.B.; Bartel, D.P. Cell, 2005, 120, 15. Brummelkamp, T.R.; Bernards, R.; Agami, R. Science, 2002, 296, 550. Paddison, P.J.; Caudy, A.A.; Bernstein, E.; Hannon, G.J.; Conklin, D.S. Genes Dev., 2002, 16, 948. Grimm, D.; Streetz, K.L.; Jopling, C.L.; Storm, T.A.; Pandey, K.; Davis, C.R.; Marion, P.; Salazar, F.; Kay, M.A. Nature, 2006, 441, 537. Stark, G.R.; Kerr, I.M.; Williams, B.R.; Silverman, R.H.; Schreiber, R.D. Annu. Rev. Biochem., 1998, 67, 227. Sledz, C.A.; Holko, M.; de Veer, M.J.; Silverman, R.H.; Williams, B.R. Nat. Cell Biol., 2003, 5, 834.

272 Infectious Disorders - Drug Targets 2008, Vol. 8, No. 4 [33] [34] [35] [36]

[37] [38] [39]

[40] [41] [42]

[43] [44] [45] [46] [47]

[48] [49]

[50] [51] [52]

[53] [54]

[55] [56]

[57] [58] [59] [60] [61]

[62]

Kim, D.H.; Behlke, M.A.; Rose, S.D.; Chang, M.S.; Choi, S.; Rossi, J.J. Nat. Biotechnol., 2005, 23, 222. Schlee, M.; Hornung, V.; Hartmann, G. Mol. Ther., 2006, 14, 463. Heil, F.; Hemmi, H.; Hochrein, H.; Ampenberger, F.; Kirschning, C.; Akira, S.; Lipford, G.; Wagner, H.; Bauer, S. Science, 2004, 303, 1526. Hornung, V.; Guenthner-Biller, M.; Bourquin, C.; Ablasser, A.; Schlee, M.; Uematsu, S.; Noronha, A.; Manoharan, M.; Akira, S.; de Fougerolles, A.; Endres, S.; Hartmann, G. Nat. Med., 2005, 11, 263. Judge, A.D.; Sood, V.; Shaw, J.R.; Fang, D.; McClintock, K.; MacLachlan, I. Nat. Biotechnol., 2005, 23, 457. Sioud, M. J. Mol. Biol., 2005, 348, 1079. Morrissey, D.V.; Lockridge, J.A.; Shaw, L.; Blanchard, K.; Jensen, K.; Breen, W.; Hartsough, K.; Machemer, L.; Radka, S.; Jadhav, V.; Vaish, N.; Zinnen, S.; Vargeese, C.; Bowman, K.; Shaffer, C.S.; Jeffs, L.B.; Judge, A.; MacLachlan, I.; Polisky, B. Nat. Biotechnol., 2005, 23, 1002. Heidel, J.D.; Hu, S.; Liu, X.F.; Triche, T.J.; Davis, M.E. Nat. Biotechnol., 2004, 22, 1579. Kim, D.H.; Longo, M.; Han, Y.; Lundberg, P.; Cantin, E.; Rossi, J.J. Nat. Biotechnol., 2004, 22, 321. Marques, J.T.; Devosse, T.; Wang, D.; Zamanian-Daryoush, M.; Serbinowski, P.; Hartmann, R.; Fujita, T.; Behlke, M.A.; Williams, B.R. Nat. Biotechnol., 2006, 24, 559. Kariko, K.; Buckstein, M.; Ni, H.; Weissman, D. Immunity, 2005, 23, 165. Hornung, V.; Barchet, W.; Schlee, M.; Hartmann, G. Handb. Exp. Pharmacol., 2008, 183, 71. Jackson, A.L.; Bartz, S.R.; Schelter, J.; Kobayashi, S.V.; Burchard, J.; Mao, M.; Li, B.; Cavet, G.; Linsley, P.S. Nat. Biotechnol., 2003, 21, 635. Persengiev, S.P.; Zhu, X.; Green, M.R. RNA, 2004, 10, 12. Scacheri, P.C.; Rozenblatt-Rosen, O.; Caplen, N.J.; Wolfsberg, T.G.; Umayam, L.; Lee, J.C.; Hughes, C.M.; Shanmugam, K.S.; Bhattacharjee, A.; Meyerson, M.; Collins, F.S. Proc. Natl. Acad. Sci. USA, 2004, 101, 1892. Doench, J.G.; Sharp, P.A. Genes Dev., 2004, 18, 504. Jackson, A.L.; Burchard, J.; Leake, D.; Reynolds, A.; Schelter, J.; Guo, J.; Johnson, J.M.; Lim, L.; Karpilow, J.; Nichols, K.; Marshall, W.; Khvorova, A.; Linsley, P.S. RNA, 2006, 12, 1197. Fedorov, Y.; Anderson, E.M.; Birmingham, A.; Reynolds, A.; Karpilow, J.; Robinson, K.; Leake, D.; Marshall, W.S.; Khvorova, A. RNA, 2006, 12, 1188. An, D.S.; Qin, F.X.; Auyeung, V.C.; Mao, S.H.; Kung, S.K.; Baltimore, D.; Chen, I.S. Mol. Ther., 2006, 14, 494. Czauderna, F.; Fechtner, M.; Dames, S.; Aygun, H.; Klippel, A.; Pronk, G.J.; Giese, K.; Kaufmann, J. Nucleic Acids Res., 2003, 31, 2705. Chiu, Y.L.; Rana, T.M. RNA, 2003, 9, 1034. Song, E.; Zhu, P.; Lee, S.K.; Chowdhury, D.; Kussman, S.; Dykxhoorn, D.M.; Feng, Y.; Palliser, D.; Weiner, D.B.; Shankar, P.; Marasco, W.A.; Lieberman, J. Nat. Biotechnol., 2005, 23, 709. McNamara, J.O., 2nd; Andrechek, E.R.; Wang, Y.; Viles, K.D.; Rempel, R.E.; Gilboa, E.; Sullenger, B.A.; Giangrande, P.H. Nat. Biotechnol., 2006, 24, 1005. Chu, T.C.; Marks, J.W., 3rd; Lavery, L.A.; Faulkner, S.; Rosenblum, M.G.; Ellington, A.D.; Levy, M. Cancer Res., 2006, 66, 5989. Hu-Lieskovan, S.; Heidel, J.D.; Bartlett, D.W.; Davis, M.E.; Triche, T.J. Cancer Res., 2005, 65, 8984. Dubey, P.K.; Mishra, V.; Jain, S.; Mahor, S.; Vyas, S.P. J. Drug Target, 2004, 12, 257. Kumar, P.; Wu, H.; McBride, J.L.; Jung, K.E.; Kim, M.H.; Davidson, B.L.; Lee, S.K.; Shankar, P.; Manjunath, N. Nature, 2007, 448, 39. Reich, S.J.; Fosnot, J.; Kuroki, A.; Tang, W.; Yang, X.; Maguire, A.M.; Bennett, J.; Tolentino, M.J. Mol. Vis., 2003, 9, 210. Shen, J.; Samul, R.; Silva, R.L.; Akiyama, H.; Liu, H.; Saishin, Y.; Hackett, S.F.; Zinnen, S.; Kossen, K.; Fosnaugh, K.; Vargeese, C.; Gomez, A.; Bouhana, K.; Aitchison, R.; Pavco, P.; Campochiaro, P.A. Gene Ther., 2006, 13, 225. Bitko, V.; Musiyenko, A.; Shulyayeva, O.; Barik, S. Nat. Med., 2005, 11, 50.

López-Fraga et al. [63]

[64]

[65] [66] [67]

[68] [69] [70] [71]

[72] [73]

[74]

[75] [76]

[77] [78] [79] [80] [81] [82] [83] [84] [85] [86] [87] [88] [89] [90]

[91] [92]

[93] [94] [95]

Li, B.J.; Tang, Q.; Cheng, D.; Qin, C.; Xie, F.Y.; Wei, Q.; Xu, J.; Liu, Y.; Zheng, B.J.; Woodle, M.C.; Zhong, N.; Lu, P.Y. Nat. Med., 2005, 11, 944. Bhandari, V.; Choo-Wing, R.; Lee, C.G.; Zhu, Z.; Nedrelow, J.H.; Chupp, G.L.; Zhang, X.; Matthay, M.A.; Ware, L.B.; Homer, R.J.; Lee, P.J.; Geick, A.; de Fougerolles, A.R.; Elias, J.A. Nat. Med., 2006, 12, 1286. Makimura, H.; Mizuno, T.M.; Mastaitis, J.W.; Agami, R.; Mobbs, C.V. BMC Neurosci., 2002, 3, 18. Dorn, G.; Patel, S.; Wotherspoon, G.; Hemmings-Mieszczak, M.; Barclay, J.; Natt, F.J.; Martin, P.; Bevan, S.; Fox, A.; Ganju, P.; Wishart, W.; Hall, J. Nucleic Acids Res., 2004, 32, e49. Thakker, D.R.; Natt, F.; Husken, D.; Maier, R.; Muller, M.; van der Putten, H.; Hoyer, D.; Cryan, J.F. Proc. Natl. Acad. Sci. USA, 2004, 101, 17270. Thakker, D.R.; Hoyer, D.; Cryan, J.F. Pharmacol. Ther., 2006, 109, 413. Gao, G.; Raikar, S.; Davenport, B.; Mutapcic, L.; Montgomery, R.; Kuzmin, E.; Bennett, K.L. Mol. Biochem. Parasitol., 2006, 146, 124. Pal, A.; Ahmad, A.; Khan, S.; Sakabe, I.; Zhang, C.; Kasid, U.N.; Ahmad, I. Int J. Oncol., 2005, 26, 1087. Chien, P.Y.; Wang, J.; Carbonaro, D.; Lei, S.; Miller, B.; Sheikh, S.; Ali, S.M.; Ahmad, M.U.; Ahmad, I. Cancer Gene Ther., 2005, 12, 321. Boussif, O.; Lezoualc'h, F.; Zanta, M.A.; Mergny, M.D.; Scherman, D.; Demeneix, B.; Behr, J.P. Proc. Natl. Acad. Sci. USA, 1995, 92, 7297. Soutschek, J.; Akinc, A.; Bramlage, B.; Charisse, K.; Constien, R.; Donoghue, M.; Elbashir, S.; Geick, A.; Hadwiger, P.; Harborth, J.; John, M.; Kesavan, V.; Lavine, G.; Pandey, R.K.; Racie, T.; Rajeev, K.G.; Rohl, I.; Toudjarska, I.; Wang, G.; Wuschko, S.; Bumcrot, D.; Koteliansky, V.; Limmer, S.; Manoharan, M.; Vornlocher, H.P. Nature, 2004, 432, 173. Hanai, K.; Takeshita, F.; Honma, K.; Nagahara, S.; Maeda, M.; Minakuchi, Y.; Sano, A.; Ochiya, T. Ann. N .Y. Acad. Sci., 2006, 1082, 9. Yang, J.P.; Huang, L. Gene Ther., 1997, 4, 950. Tousignant, J.D.; Gates, A.L.; Ingram, L.A.; Johnson, C.L.; Nietupski, J.B.; Cheng, S.H.; Eastman, S.J.; Scheule, R.K. Hum. Gene. Ther., 2000, 11, 2493. Alba, R.; Bosch, A.; Chillon, M. Gene. Ther., 2005, 12 Suppl 1, S18. Oka, K.; Chan, L. Methods Mol. Med., 2005, 108, 329. Mok, H.; Palmer, D.J.; Ng, P.; Barry, M.A. Mol. Ther., 2005, 11, 66. Grimm, D. Methods, 2002, 28, 146. Morris, K.V.; Rossi, J.J. Gene. Ther., 2006, 13, 553. Bitko, V.; Barik, S. BMC Microbiol., 2001, 1, 34. Webster, R.G.; Bean, W.J.; Gorman, O.T.; Chambers, T.M.; Kawaoka, Y. Microbiol. Rev., 1992, 56, 152. Kim, W.R. Hepatology, 2002, 36, S30. Hoofnagle, J.H.; di Bisceglie, A.M. N. Engl. J. Med., 1997, 336, 347. Bennasser, Y.; Le, S.Y.; Benkirane, M.; Jeang, K.T. Immunity, 2005, 22, 607. Cullen, B.R. Nat. Immunol., 2006, 7, 563. Berkhout, B.; Jeang, K.T. J. Biol. Chem., 2007, 282, 26641. Lecellier, C.H.; Dunoyer, P.; Arar, K.; Lehmann-Che, J.; Eyquem, S.; Himber, C.; Saib, A.; Voinnet, O. Science, 2005, 308, 557. Otsuka, M.; Jing, Q.; Georgel, P.; New, L.; Chen, J.; Mols, J.; Kang, Y.J.; Jiang, Z.; Du, X.; Cook, R.; Das, S.C.; Pattnaik, A.K.; Beutler, B.; Han, J. Immunity, 2007, 27, 123. Yeung, M.L.; Bennasser, Y.; Myers, T.G.; Jiang, G.; Benkirane, M.; Jeang, K.T. Retrovirology, 2005, 2, 81. Triboulet, R.; Mari, B.; Lin, Y.L.; Chable-Bessia, C.; Bennasser, Y.; Lebrigand, K.; Cardinaud, B.; Maurin, T.; Barbry, P.; Baillat, V.; Reynes, J.; Corbeau, P.; Jeang, K.T.; Benkirane, M. Science, 2007, 315, 1579. Pedersen, I.M.; Cheng, G.; Wieland, S.; Volinia, S.; Croce, C.M.; Chisari, F.V.; David, M. Nature, 2007, 449, 919. Ge, Q.; Filip, L.; Bai, A.; Nguyen, T.; Eisen, H.N.; Chen, J. Proc. Natl. Acad. Sci. USA, 2004, 101, 8676. Zhang, W.; Yang, H.; Kong, X.; Mohapatra, S.; San Juan-Vergara, H.; Hellermann, G.; Behera, S.; Singam, R.; Lockey, R.F.; Mohapatra, S.S. Nat. Med., 2005, 11, 56.

RNA Interference-Based Therapeutics [96] [97] [98] [99] [100] [101] [102]

[103] [104] [105] [106] [107] [108] [109] [110] [111]

[112] [113] [114] [115] [116]

[117] [118] [119] [120] [121] [122]

[123] [124] [125] [126] [127] [128] [129] [130] [131] [132]

Boden, D.; Pusch, O.; Lee, F.; Tucker, L.; Ramratnam, B. J. Virol., 2003, 77, 11531. Wilson, J.A.; Richardson, C.D. J. Virol., 2005, 79, 7050. Wu, H.L.; Huang, L.R.; Huang, C.C.; Lai, H.L.; Liu, C.J.; Huang, Y.T.; Hsu, Y.W.; Lu, C.Y.; Chen, D.S.; Chen, P.J. Gastroenterology, 2005, 128, 708. Gitlin, L.; Stone, J.K.; Andino, R. J. Virol., 2005, 79, 1027. Das, A.T.; Brummelkamp, T.R.; Westerhout, E.M.; Vink, M.; Madiredjo, M.; Bernards, R.; Berkhout, B. J. Virol., 2004, 78, 2601. Stevenson, M. Nat. Rev. Immunol., 2003, 3, 851. Samson, M.; Libert, F.; Doranz, B.J.; Rucker, J.; Liesnard, C.; Farber, C.M.; Saragosti, S.; Lapoumeroulie, C.; Cognaux, J.; Forceille, C.; Muyldermans, G.; Verhofstede, C.; Burtonboy, G.; Georges, M.; Imai, T.; Rana, S.; Yi, Y.; Smyth, R.J.; Collman, R.G.; Doms, R.W.; Vassart, G.; Parmentier, M. Nature, 1996, 382, 722. ter Brake, O.; Konstantinova, P.; Ceylan, M.; Berkhout, B. Mol. Ther., 2006, 14, 883. Grimm, D.; Kay, M.A. Mol. Ther., 2007, 15, 878. Hu, W.Y.; Myers, C.P.; Kilzer, J.M.; Pfaff, S.L.; Bushman, F.D. Curr. Biol., 2002, 12, 1301. Westerhout, E.M.; ter Brake, O.; Berkhout, B. Retrovirology, 2006, 3, 57. Fields, B.N.; Raine, C.S.; Baum, S.G. Virology, 1971, 43, 569. Kobayashi, T.; Chappell, J.D.; Danthi, P.; Dermody, T.S. J. Virol., 2006, 80, 9053. Geiss, B.J.; Pierson, T.C.; Diamond, M.S. Virol. J., 2005, 2, 53. Westerhout, E.M.; Ooms, M.; Vink, M.; Das, A.T.; Berkhout, B. Nucleic Acids Res., 2005, 33, 796. Wang, M.B.; Bian, X.Y.; Wu, L.M.; Liu, L.X.; Smith, N.A.; Isenegger, D.; Wu, R.M.; Masuta, C.; Vance, V.B.; Watson, J.M.; Rezaian, A.; Dennis, E.S.; Waterhouse, P.M. Proc. Natl. Acad. Sci. USA, 2004, 101, 3275. Chang, J.; Taylor, J.M. J. Virol., 2003, 77, 9728. Albertini, A.A.; Wernimont, A.K.; Muziol, T.; Ravelli, R.B.; Clapier, C.R.; Schoehn, G.; Weissenhorn, W.; Ruigrok, R.W. Science, 2006, 313, 360. Green, T.J.; Zhang, X.; Wertz, G.W.; Luo, M. Science, 2006, 313, 357. Ngo, H.; Tschudi, C.; Gull, K.; Ullu, E. Proc. Natl. Acad. Sci. USA., 1998, 95, 14687. Montalvetti, A.; Fernandez, A.; Sanders, J.M.; Ghosh, S.; Van Brussel, E.; Oldfield, E.; Docampo, R. J. Biol. Chem., 2003, 278, 17075. Inoue, N.; Otsu, K.; Ferraro, D.M.; Donelson, J.E. Mol. Biochem. Parasitol., 2002, 120, 309. DaRocha, W.D.; Otsu, K.; Teixeira, S.M.; Donelson, J.E. Mol. Biochem. Parasitol., 2004, 133, 175. Zhang, W.W.; Matlashewski, G. Mol. Biochem. Parasitol., 2000, 107, 315. Robinson, K.A.; Beverley, S.M. Mol. Biochem. Parasitol., 2003, 128, 217. Ridley, R.G. Nature, 2002, 415, 686. Malhotra, P.; Dasaradhi, P.V.; Kumar, A.; Mohmmed, A.; Agrawal, N.; Bhatnagar, R.K.; Chauhan, V.S. Mol. Microbiol., 2002, 45, 1245. McRobert, L.; McConkey, G.A. Mol. Biochem. Parasitol., 2002, 119, 273. Mohmmed, A.; Dasaradhi, P.V.; Bhatnagar, R.K.; Chauhan, V.S.; Malhotra, P. Biochem. Biophys. Res. Commun., 2003, 309, 506. Aravind, L.; Iyer, L.M.; Wellems, T.E.; Miller, L.H. Cell, 2003, 115, 771. Ullu, E.; Tschudi, C.; Chakraborty, T. Cell Microbiol., 2004, 6, 509. Al-Anouti, F.; Ananvoranich, S. Antisense Nucleic Acid Drug Dev., 2002, 12, 275. Geldhof, P.; Visser, A.; Clark, D.; Saunders, G.; Britton, C.; Gilleard, J.; Berriman, M.; Knox, D. Parasitology, 2007, 134, 609. Geldhof, P.; Murray, L.; Couthier, A.; Gilleard, J.S.; McLauchlan, G.; Knox, D.P.; Britton, C. Int. J. Parasitol., 2006, 36, 801. Viney, M.E.; Thompson, F.J. Int. J. Parasitol., 2008, 38, 43. Kang, S.; Hong, Y.S. Korean J. Parasitol., 2008, 46, 1. Harth, G.; Zamecnik, P.C.; Tang, J.Y.; Tabatadze, D.; Horwitz, M.A. Proc. Natl. Acad. Sci. USA, 2000, 97, 418.

Infectious Disorders - Drug Targets 2008, Vol. 8, No. 4 [133] [134] [135] [136] [137] [138]

[139]

[140] [141] [142] [143]

[144] [145]

[146] [147] [148]

[149] [150]

[151] [152] [153] [154] [155] [156] [157]

[158] [159] [160] [161]

273

Koo, I.C.; Ohol, Y.M.; Wu, P.; Morisaki, J.H.; Cox, J.S.; Brown, E.J. Proc. Natl. Acad Sci. USA, 2008, 105, 710. Janowski, B.A.; Younger, S.T.; Hardy, D.B.; Ram, R.; Huffman, K.E.; Corey, D.R. Nat. Chem. Biol., 2007, 3, 166. Montaner, J.S.; Mellors, J.W. Antivir. Ther., 1999, 4, 59. Blandin, S.; Moita, L.F.; Kocher, T.; Wilm, M.; Kafatos, F.C.; Levashina, E.A. EMBO Rep., 2002, 3, 852. Brown, A.E.; Bugeon, L.; Crisanti, A.; Catteruccia, F. Nucleic Acids Res., 2003, 31, e85. Kleinman, M.E.; Yamada, K.; Takeda, A.; Chandrasekaran, V.; Nozaki, M.; Baffi, J.Z.; Albuquerque, R.J.; Yamasaki, S.; Itaya, M.; Pan, Y.; Appukuttan, B.; Gibbs, D.; Yang, Z.; Kariko, K.; Ambati, B.K.; Wilgus, T.A.; DiPietro, L.A.; Sakurai, E.; Zhang, K.; Smith, J.R.; Taylor, E.W.; Ambati, J. Nature, 2008, 452, 591. McCaffrey, A.P.; Nakai, H.; Pandey, K.; Huang, Z.; Salazar, F.H.; Xu, H.; Wieland, S.F.; Marion, P.L.; Kay, M.A. Nat. Biotechnol., 2003, 21, 639. Giladi, H.; Ketzinel-Gilad, M.; Rivkin, L.; Felig, Y.; Nussbaum, O.; Galun, E. Mol. Ther., 2003, 8, 769. Klein, C.; Bock, C.T.; Wedemeyer, H.; Wustefeld, T.; Locarnini, S.; Dienes, H.P.; Kubicka, S.; Manns, M.P.; Trautwein, C. Gastroenterology, 2003, 125, 9. Hong, J.; Qian, Z.; Shen, S.; Min, T.; Tan, C.; Xu, J.; Zhao, Y.; Huang, W. Biochem . J., 2005, 390, 675. Morrissey, D.V.; Blanchard, K.; Shaw, L.; Jensen, K.; Lockridge, J.A.; Dickinson, B.; McSwiggen, J.A.; Vargeese, C.; Bowman, K.; Shaffer, C.S.; Polisky, B.A.; Zinnen, S. Hepatology, 2005, 41, 1349. Uprichard, S.L.; Boyd, B.; Althage, A.; Chisari, F.V. Proc. Natl. Acad. Sci. USA, 2005, 102, 773. Carmona, S.; Ely, A.; Crowther, C.; Moolla, N.; Salazar, F.H.; Marion, P.L.; Ferry, N.; Weinberg, M.S.; Arbuthnot, P. Mol. Ther., 2006, 13, 411. Ying, R.S.; Zhu, C.; Fan, X.G.; Li, N.; Tian, X.F.; Liu, H.B.; Zhang, B.X. Antiviral Res., 2007, 73, 24. Chen, C.C.; Ko, T.M.; Ma, H.I.; Wu, H.L.; Xiao, X.; Li, J.; Chang, C.M.; Wu, P.Y.; Chen, C.H.; Han, J.M.; Yu, C.P.; Jeng, K.S.; Hu, C.P.; Tao, M.H. Gene Ther., 2007, 14, 11. Sakamoto, N.; Tanabe, Y.; Yokota, T.; Satoh, K.; Sekine-Osajima, Y.; Nakagawa, M.; Itsui, Y.; Tasaka, M.; Sakurai, Y.; Cheng-Hsin, C.; Yano, M.; Ohkoshi, S.; Aoyagi, Y.; Maekawa, S.; Enomoto, N.; Kohara, M.; Watanabe, M. J. Gastroenterol. Hepatol., 2007, (Epub ahead of print). Watanabe, T.; Umehara, T.; Yasui, F.; Nakagawa, S.; Yano, J.; Ohgi, T.; Sonoke, S.; Satoh, K.; Inoue, K.; Yoshiba, M.; Kohara, M. J. Hepatol., 2007, 47, 744. Yokota, T.; Iijima, S.; Kubodera, T.; Ishii, K.; Katakai, Y.; Ageyama, N.; Chen, Y.; Lee, Y.J.; Unno, T.; Nishina, K.; Iwasaki, Y.; Maki, N.; Mizusawa, H.; Akari, H. Biochem. Biophys. Res. Commun., 2007, 361, 294. Thomas, M.; Lu, J.J.; Ge, Q.; Zhang, C.; Chen, J.; Klibanov, A.M. Proc. Natl. Acad .Sci. USA, 2005, 102, 5679. Tompkins, S.M.; Lo, C.Y.; Tumpey, T.M.; Epstein, S.L. Proc. Natl. Acad. Sci. USA, 2004, 101, 8682. Zhou, H.; Jin, M.; Yu, Z.; Xu, X.; Peng, Y.; Wu, H.; Liu, J.; Liu, H.; Cao, S.; Chen, H. Antiviral Res., 2007, 76, 186. Merl, S.; Michaelis, C.; Jaschke, B.; Vorpahl, M.; Seidl, S.; Wessely, R. Circulation, 2005, 111, 1583. Crocker, S.J.; Frausto, R.F.; Whitmire, J.K.; Benning, N.; Milner, R.; Whitton, J.L. Am. J. Pathol., 2007, 171, 1762. Kim, J.Y.; Chung, S.K.; Hwang, H.Y.; Kim, H.; Kim, J.H.; Nam, J.H.; Park, S.I. Virus Res., 2007, 125, 9. Kim, Y.J.; Ahn, J.; Jeung, S.Y.; Kim, D.S.; Na, H.N.; Cho, Y.J.; Yun, S.H.; Jee, Y.; Jeon, E.S.; Lee, H.; Nam, J.H. Virus Genes, 2008, 36, 141. Bai, F.; Wang, T.; Pal, U.; Bao, F.; Gould, L.H.; Fikrig, E. J. Infect. Dis., 2005, 191, 1148. Kumar, P.; Lee, S.K.; Shankar, P.; Manjunath, N. PLoS Med., 2006, 3, e96. Palliser, D.; Chowdhury, D.; Wang, Q.Y.; Lee, S.J.; Bronson, R.T.; Knipe, D.M.; Lieberman, J. Nature, 2006, 439, 89. Chen, W.; Yan, W.; Du, Q.; Fei, L.; Liu, M.; Ni, Z.; Sheng, Z.; Zheng, Z. J. Virol., 2004, 78, 6900.

Received: May 14, 2008

Accepted: June 15, 2008