The FASEB Journal • Research Communication
Nitric oxide mediates increased susceptibility to dopaminergic damage in Nurr1 heterozygous mice Syed Z. Imam,* Joseph Jankovic,‡ Syed F. Ali,† John T. Skinner,† Wenjie Xie,‡ Orla M. Conneely,§ and Wei-Dong Le‡,1 *South Texas Veteran Health Care System and Department of Medicine of UT Health Science, San Antonio, Texas, USA; †Neurochemistry Laboratory, Division of Neurotoxicology, US FDA/NCTR, Jefferson, Arkansas, USA; ‡Department of Neurology and §Department of Cellular and Molecular Biology, Baylor College of Medicine, Houston, Texas, USA Knocking out of Nurr1 gene, a member of nuclear receptor superfamily, causes selective agenesis of dopaminergic neurons in midbrain. Reduced expression of Nurr1 increases the vulnerability of mesencephalic dopamine neurons to dopaminergic toxins. We evaluated the role of nitric oxide as a possible mechanism for this increased susceptibility. Increased expression of neuronal nitric oxide synthase and increased 3-nitrotyrosine were observed in striatum of Nurr1 heterozygous (Nurr1 ⴙ/ⴚ) mice as compared with wild-type. Increased cytochrome C activation and consecutive release of Smac/DIABLO were also observed in Nurr1 ⴙ/ⴚ mice. An induction of active Caspase-3 and p53, cleavage of poly-ADP (RNase) polymerase and reduced expression of bcl-2 were observed in Nurr1 ⴙ/ⴚ mice. Methamphetamine significantly increased these markers in Nurr1 ⴙ/ⴚ mice as compared with wild-type. The present data therefore suggest that nitric oxide plays a role as a modulating factor for the increased susceptibility, but not the potentiation, of the dopaminergic terminals in Nurr1 ⴙ/ⴚ mice. We also report that this increased neuronal nitric oxide synthase expression and increased nitration in Nurr1 ⴙ/ⴚ mice led to the activation of apoptotic cascade via the differential alterations in the DNA binding activity of transcription factors responsible for the propagation of growth arrest as well as apoptosis. FASEB J. 19, 1441–1450 (2005)
ABSTRACT
Key Words: nitric oxide 䡠 dopamine 䡠 3-NT 䡠 caspase 䡠 transcription 䡠 apoptosis The transcription factor nurr1 is an orphan nuclear receptor of the steroid/thyroid hormone receptor superfamily (1) that plays an important role in the proper development of dopamine neurons (2, 3). It has been suggested that Nurr1 regulates transcription of the gene encoding dopamine transporter (4) and it also plays a role in the maintenance of dopamine neuron phenotype within the mature nervous system (5, 6). Recent data suggest that decreased expression of Nurr1 was observed in dopamine neurons of human cocaine abusers (5). This complements the fact that Nurr1 may be an important factor for the deciphering 0892-6638/05/0019-1441 © FASEB
of dopaminergic damage. Nurr1 can also activate the transcription of tyrosine hydroxylase (7). Although highest levels of expression were found in cortex, medial septum, dentate gyrus, some hypothalamic nuclei, and substantia nigra, Nurr1 has also been reported to be expressed in striatum, septum, and superior colliculus (8). A rapid increase of Nurr1 expression has been reported in the substantia nigra after 6-hydroxydopamine lesion in the striatum of the rat (8). Knocking out of the Nurr1 gene results in dopamine neuron agenesis (2). Mice completely lacking Nurr1 failed to generate midbrain dopaminergic neurons, were hypoactive, and died soon after birth (2). However, heterozygous animals have been reported to be apparently healthy but contain reduced dopamine levels (2) and exhibit increased susceptibility to 1-methyl-4-phenyl1,2,3,6-tetrahydropyridine (MPTP) -induced neurotoxicity (9) as well as show elevated locomotor activity after acute exposure to methamphetamine (10). We and others have shown that both reactive oxygen (ROS) and nitrogen (RNS) species play a major role in dopaminergic terminal damage (11, 12). Recently we have shown that peroxynitrite (PO), a reaction product of superoxide (SO) and nitric oxide (NO), plays an important role in the induction of striatal dopaminergic damage as well as changes in the pro- and anti-death protein expression in striatum (13, 14). We have also shown that specific inhibitors of neuronal nitric oxide synthase (nNOS) such as 7-nitroindazole as well as various decomposition catalysts of PO provide significant protection against striatal dopaminergic damage (15). Furthermore, increased expression of nNOS has been reported in the striata of METH-treated mice (16). PO is also thought to play a prominent role in SOand NO-mediated neurotoxicity, which can result in cell death with both apoptotic and nonapoptotic morphologies (17, 18). NO has also been reported to mediate MPTP-induced dopaminergic damage via the activation of poly (ADP-ribose) polymerase (PARP) 1
Correspondence: NB 205, Baylor College of Medicine, 6501 Fannin St., Houston, TX 77030, USA. E-mail:
[email protected] or
[email protected] doi: 10.1096/fj.04-3362com 1441
(19). Inhibitors of PARP have been shown to reduce this damage (19). Caspase-3 has been reported to be an effector of apoptosis in experimental models of dopaminergic damage and toxicity. In neurons, several lines of evidence indicate that caspase-3 plays a major role in the executive phase of apoptosis (20). Neuronal death in experimental models of several acute and chronic neurodegenerative disorders has been associated with activation of caspase-3 (21, 22). To date, however, the role of NO as a possible mediator of the increased susceptibility to dopaminergic damage in the absence of Nurr1 has not been reported. Evidence of NO-mediated alterations in the expression of various genes and proteins responsible for the activation of apoptosome has not been reported in Nurr1 ⫹/⫺ animal models. In the present study, we evaluated the role of NO as a possible mediator of the increased susceptibility of the striatal dopaminergic terminals to dopaminergic toxins via the induction of apoptotic cascade.
MATERIALS AND METHODS Animals and treatments Adult male heterozygous Nurr1 knockout mice and their littermate wild-type mice were used in this study (23). Genotyping was performed in all animals according to our previous description (23). Animal care and procedures were performed in accordance with the American Association for Accreditation of Laboratory Animal Care guidelines and approved by the Baylor College of Medicine Institutional Animal Care and Use Committee. Animals were maintained on a 12 h light/dark schedule at a room temperature of 21°C and housed in groups of two with free access to food and water. Control animals (3 groups, n⫽6/group) received four injections of saline every 2 h whereas methamphetamine (METH) groups (3 groups, n⫽6/group) received four injections of METH (10 mg/kg, i.p.) at 2 h intervals. Animals were killed 72 h after the last injection of METH. The brains were rapidly removed and striata were dissected and stored at -80°C until analysis. The samples were divided to perform a different set of experiments. Western blot analysis Western blot analysis for the expression activity of various proteins in the striata of wild-type and Nurr1 ⫹/⫺ mice were performed with minor modifications in the method of Imam et al. (13). Each striatum was homogenized in 10 volumes of extraction buffer containing 20 mM Tris pH 7.4, 50 mM NaCl, 10% SDS, 1 mM EDTA, 1 mM EGTA, 0.2 mM PMSF, 1 g/mL pepstatin, 0.5 g/mL leupeptin, and 5 mM mercaptoethanol. The homogenate was centrifuged at 16,000 ⫻ g for 80 min to pellet the insoluble membrane or organelle fraction. Proteins were analyzed for each sample. Samples were diluted 1:1 with sample buffer (125 mM Tris-HCl, 4% SDS, 20% glycerol, 10% 2-mercaptoethanol). Equal amounts of protein (30 g) were loaded onto a 7.5%, 12.5%, or 10-20% SDS-PAGE gel, and separated by the Laemmli method. Proteins were electrophoretically transferred to a nitrocellulose membrane and the nonspecific sites were blocked in 5% nonfat dry milk in Tris-buffered saline containing 0.3% Tween威-20 for 60 min. Membranes were then incubated in 1442
Vol. 19
September 2005
the presence of respective primary antibodies (nNOS, bcl-2, cytochrome C, Smac/DIABLO, activated caspase-3, PARP, cleaved-PARP, p53 or ␣-synuclein; 1:500), or antibody against -actin (1:5000). Antibody binding and chemiluminescence enhancement were performed using the corresponding secondary antibody (1:1000) and Pierce Western blot analysis system. Densitometric analysis was performed and calibrated to coblotted dilutional standards of control striatum using Scanalytics program (Scanalytics, Billerica, MA, USA). HPLC-CoulArray analysis of protein bound 3-nitrotyrosine (3-NT) Determination of 3-NT and tyrosine (TYR) in striatum was performed by high performance liquid chromatography (HPLC)-Coularray electrochemical detection method (11). In brief, the tissues were sonicated in 400 L of 10 mM sodium acetate (NaOAc), pH 6.5. A 5 L aliquot of the homogenate was used to determine protein concentration. Remaining homogenate was centrifuged at 14,000 ⫻ g for 10 min at 4°C. The supernatant was removed and treated with 100 L of 1 mg/mL pronase for 18 h at 50°C. Enzymatic digests were then treated with 0.5 mL of 10% TCA and centrifuged at 14,000 ⫻ g for 10 min at 4°C. The supernatants were passed through a 0.2 m PVDF filter before injection onto the HPLC instrument. All samples were analyzed on an ESA (Cambridge, MA, USA) HPLC-CoulArray equipped with 8 electrochemical channels using platinum electrodes arranged in line and set to increasing specified potentials [channel(potential): 1(180 mV); 2(240 mV); 3(350 mV); 4(500 mV); 5(550 mV); 6(690 mV); 7(875 mV); 8(900 mV)]. The analytical column was a TSK-GEL ODS 80-TM reversephase column with a column size of 4.6 mm ⫻ 25.0 cm (TOSOHAAS, Montgomeryville, PA, USA). The mobile phase was 50 mM NaOAc/5% (v/v) methanol, pH 4.8. HPLC was performed under isocratic conditions. 3-NT and TYR were quantified relative to known standards. 3-NT values were represented as 3-NT per 100 TYR. HPLC-ECD analysis of dopamine (DA) concentration The concentration of DA was quantified in striatal tissues by a modified HPLC method combined with electrochemical detection (11). Tissues were weighed in a measured volume (20% w/v) of 0.2 M perchloric acid containing internal standard 3,4-dihydroxybenzylamine, 100 ng/mL. The tissues were disrupted by ultrasonication and centrifuged at 4°C (15,000⫻g; 7 min), and 150 L of the supernatant was removed and filtered through a Nylon-66 microfilter (pore size, 0.2 m; MF-1 centrifugal filter; Bioanalytical Systems, West Lafayette, IN, USA). Aliquots of 25 L representing 2.5 mg of brain tissue were injected directly onto the HPLC/ electrochemical detection system for separation of analytes. The amount of DA was calculated using standard curves that were generated by determining in triplicate the ratio between three different known amounts of the amine and a constant amount of internal standard. Preparation of nuclear extracts Nuclear extracts were prepared using Panomics Nuclear Extraction Kit. In brief, the tissue was homogenized in 500 L buffer A (10 mM HEPES, 10 mM KCl, 10 mM EDTA, 100 mM DTT, 10% IGEPAL and protease inhibitor cocktail), followed by centrifugation at 15,000 ⫻ g for 3 min at 4°C. The pellet was resuspended in 150 L buffer B (20 mM HEPES, 0.5M NaCl, 1 mM EDTA, 50% glycerol, 100 mM DTT, and protease inhibitor cocktail), incubated for 2 h, and centrifuged for 5
The FASEB Journal
IMAM ET AL.
min at 15,000 ⫻ g. Supernatant was then used for proteinDNA array analysis, with an aliquot removed for protein determination. Protein-DNA interaction array analysis Protein-DNA interactions were analyzed using Panomics TranSignal Protein/DNA Arrays. In brief, nuclear extract samples (15-20 g) were incubated with TranSignal Probe Mix and run on a 2% agarose gel for 15 min at 120 V. The portion of the gel containing the protein-DNA complex was excised and the gel was dissolved by heating at 55°C in 1 mL extraction buffer A. Gel extraction beads (6 L) were then added to each sample and incubated at room temperature for 10 min with periodic vortexing, followed by centrifugation for 30 s at 10,000 rpm. The pellet was resuspended in 150 L extraction buffer B and again centrifuged for 30 s at 10,000 rpm. The pellet was then air dried and resuspended in 50 L deionized water with cyclic incubation and vortexing for 10 min. After centrifugation for 1 min at 10,000 rpm, the supernatant containing the eluted probe was ready for hybridization. The eluted probe was then added to the hybridization bottle containing the prehybridized array membrane (incubated with 3-5 mL of hybridization buffer for 2 h at 42°C) and incubated overnight at 42°C. After hybridization, the membranes were washed with a series of hybridization wash solutions containing dH2O, SSC, and SDS at 42°C. The arrays were incubated for 15 min at room temperature with 20 mL Blocking Buffer, followed by 15 min incubation with 20 L Streptavidin-HRP conjugate added directly to the blocking buffer. Each membrane was washed three times for 8 min with 20 mL Wash Buffer. The arrays were incubated for 5 min with 20 mL Detection Buffer, followed by 5 min with an equal mixture of Luminol Enhancer and Peroxide Solution. The membranes were exposed to Kodak X-Ray Film for varying exposure times and analyzed using a Kodak Imaging System. The quantification of the data was done by spotdensitometry using ImageQuant Software. An increase of 3.5 folds or more was considered significant. Co-immunoprecipitation analysis Striatal homogenates were precleared with protein G-Sepharose (Pharmacia) (1 h at 4°C) to reduce the nonspecific protein precipitation. The mixture was centrifuged for 1 min at 10,000 rpm. Five microliters of anti-␣-synuclein or antityrosine hydroxylase monoclonal antibodies (1 mg/mL) were incubated for 12 h at 4°C with 500 L of appropriately diluted samples in the lysis buffer (described in Western blot section). The immune complexes were precipitated with 25 L of 25% wt/vol protein G-Sepharose by rotating the suspension for 2 h at 4°C. The beads were then collected by centrifugation and washed twice with lysis buffer. The beads were finally suspended in 50 L sample buffer (described in Western blot section) and heated at 100°C for 5 min. The protein G-Sepharose was pelleted by centrifugation for 1 min. The supernatant was subjected to electrophoresis on 12% SDS-PAGE running gels. Proteins were electrophoretically transferred to a nitrocellulose membrane and the nonspecific sites were blocked in 5% nonfat dry milk in Tris-buffered saline containing 0.3% Tween威-20 for 60 min. Membranes were then incubated in the presence of 1.0 g/mL affinity purified anti-nitrotyrosine antibodies that were preconjugated overnight at 4°C with 1:2500 dilution of HRP-labeled secondary antibody. Chemiluminescence enhancement was performed using Pierce Western blot analysis system and membranes were exposed to X-ray film. Nurr1 IN NO-MEDIATED DOPAMINERGIC INJURY
Nitric oxide synthase activity To determine neuronal NOS activity, the NOS assay medium of 400 L contained 100 mM HEPES, pH 7.2; 2 mM NADPH; 0.45 mM calcium chloride; 6 M L-2; [3-3H]-arginine (0.2 Ci/mL), and 400 g striatal cytosolic protein. The reaction mixture was incubated for 45 min at 37°C and stopped by the addition of stop buffer containing 20 mM HEPES and 10 mM EGTA at pH 5.5. The entire reaction mixture was passed through a column packed with Na⫹ form of Dowex AG 50 Wx-8 resin. The flow-through fraction containing [3H]-citrulline was counted for radioactivity using a Beckman 600 liquid scintillation counter. The NOS activity was expressed as pmol citrulline/mg protein/min. Statistical analysis Analysis of significance between different treatment groups consisted of ANOVA followed by post hoc comparison (Bonferroni t test all pairwise multiple comparison procedure). Significant differences were defined at P ⬍ 0.05.
RESULTS Increased expression of nNOS in the striatum of Nurr1 ⫹/⫺ mice was observed as compared with the wild-type controls. As illustrated in Fig. 1A, a significant induction was observed in the nNOS expression after administration of METH, and this induction was further potentiated in METH-treated Nurr1 ⫹/⫺ mice. The increased expression of nNOS in Nurr1 ⫹/⫺ mice suggested a possibility of NO-mediated mechanisms implicated in the increased susceptibility of dopaminergic damage. Furthermore, a significantly increased nNOS enzyme activity was also observed in the striata of METH-treated Nurr1 ⫹/⫺ animals. Figure 1B represents the nNOS enzyme activity whereby METH treatment significantly increased the striatal nNOS activity in the Nurr1 ⫹/⫺ mice as compared with the METHinduced increase of this activity in their wild-type correspondents. To validate the role of increased nNOS expression and activity, the formation of 3-NT, a stable in vivo marker for nitration, was studied in the striatum. 3-NT formation was significantly enhanced in the control Nurr1 ⫹/⫺ mice as compared with their wild-type correspondents, which validates the pathology of increased nNOS activity. METH administration resulted in a significantly increased rate of nitration in Nurr1 ⫹/⫺ group as compared with the wild-types. Figure 1C depicts the changes in the striatal 3-NT formation as a hallmark of increased nNOS expression in these models of dopaminergic damage. To further correlate the increased rate of nitration in Nurr1 ⫹/⫺ mice with the dopamine function, analysis of dopamine depletion from the striata of wild-type and Nurr1 ⫹/⫺ mice was observed. There was an approximate 18% reduction in the striatal dopamine content in the control Nurr1 ⫹/⫺ mice as compared with the wild-type controls. However, METH administration resulted in a significant potentiation of the decrease in dopamine content 1443
in Nurr1 ⫹/⫺ mice. Figure 1D illustrates the dopaminergic depletion after METH administration which suggests a correlation between nNOS activation and dopaminergic function. To further understand the role of NO in the mediation of neuronal damage caused by dopaminergic toxins, we evaluated the possible pathway by which NO can mediate the onset of neuronal cell death in the Nurr1 ⫹/⫺ mice models. To further explore the mechanism, we studied the striatal expression activity of p53 protein. As Fig. 2A illustrates, there was a significant increase in the striatal expression of p53 in the Nurr1 ⫹/⫺ mice as compared with the wild-type. However, the highest expression of p53 was observed in the Nurr1 ⫹/⫺ group treated with METH. We also studied the striatal expression activity of bcl-2 in the Nurr1 ⫹/⫺ and wild-type mice treated with METH. As illustrated in Fig. 2B, bcl-2 expression was significantly decreased in the control Nurr1 ⫹/⫺ mice as compared with wild-type. METH administration significantly repressed the striatal bcl-2 expression in the wild-type and nearly diminished this expression in Nurr1 ⫹/⫺ mice. The cytosolic expression of cytochrome C (cyt C) was studied to understand the effect of repressed bcl-2 expression on mitochondrial consequences. Figure 3A represents the expression of cyt C. A highly significant cytosolic expression of cyt C was observed in the striata of Nurr1 ⫹/⫺ mice. METH administration further enhanced this expression correlating with the changes observed in the bcl-2 expression. To understand the role of increased cyt C expression and its effect on the onset of apoptotic cascade, we studied the cytosolic expression of Smac/DIABLO and activated caspase-3. Increased activation of Smac/DIABLO was observed in the striatal cytosol of Nurr1 ⫹/⫺ and METH administration significantly potentiated this activation. A multifold increase in the expression of Smac/DIABLO was observed in Nurr1 ⫹/⫺ mice Fig. 3A. In case of
Figure 1. Increased expression and activity of striatal nNOS in METH-treated Nurr1 ⫹/⫺ mice and comparative formation of 3-NT and dopamine depletion in the striatum of METHtreated wild-type and Nurr1 ⫹/⫺ mice. Both wild-type and Nurr1 ⫹/⫺ mice were treated with METH (4⫻10 mg/kg, i.p.) and killed 72 h after the last injection of METH. A) Striatal nNOS expression was analyzed by SDS-PAGE and transferred to nitrocellulose membrane. Immunoblots were performed in triplicate using nNOS antibodies and visualized by ECL. B) Striatal nNOS activity was measured by the radiometric determination pmol of [3H]-citrulline formed per mg protein per minute from the [3H]-arginine. C) Significant increase in the 3-NT formation was observed in the Nurr1 ⫹/⫺ control as compared with the wild-type controls. METH administration further enhanced the rate of nitration. D) Significant depletion of dopamine content was observed in Nurr1 ⫹/⫺ mice as compared with wild-type control and METH administration resulted in further significant depletion. Lane 1: wild-type control, lane 2: wild-type METH, lane 3: Nurr1 ⫹/⫺ control, lane 4: Nurr1 ⫹/⫺ METH. *P ⬍ 0.05 Significantly different from wild-type control; aP ⬍ 0.05 Significantly different from Nurr1 ⫹/⫺ control or wild-type METH. 1444
Vol. 19
September 2005
The FASEB Journal
IMAM ET AL.
Figure 2. Striatal p53 expression is increased in METHtreated Nurr1 ⫹/⫺ mice, whereas, bcl-2 expression is nearly diminished in the striatum of METH-treated Nurr1 ⫹/⫺ mice. Both wild-type and Nurr1 ⫹/⫺ mice were treated with METH (4⫻10 mg/kg, i.p.) and killed 72 h after the last injection of METH. Striatal p53 (A) or bcl-2 (B) expression was analyzed by SDS-PAGE and transferred to nitrocellulose membrane. Immunoblots were performed in triplicate using p53 antibodies and visualized by ECL. Lane 1: wild-type control, lane 2: wild-type METH, lane 3: Nurr1 ⫹/⫺ control, lane 4: Nurr1 ⫹/⫺ METH. *P ⬍ 0.05 Significantly different from wild-type control; a P ⬍ 0.05 Significantly different from Nurr1 ⫹/⫺ control or wild-type METH.
activated caspase-3, there was no activation in the striata of wild-type animals. METH administration resulted in slight but significant increase in the activation of caspase-3. However, in Nurr1 ⫹/⫺ mice, a very high and significant activation of caspase-3 was observed in the controls as well as METH-treated animals Fig. 3A. Nurr1 IN NO-MEDIATED DOPAMINERGIC INJURY
Figure 3. Cytosolic cyt C and Smac/DIABLO expression is up-regulated in METH-treated Nurr1 ⫹/⫺ mice. High expression of activated Caspase-3, PARP and cleaved PARP is observed in the striatum of METH-treated Nurr1 ⫹/⫺ mice. Both wild-type and Nurr1 ⫹/⫺ mice were treated with METH (4⫻10 mg/kg, i.p.) and killed 72 h after the last injection of METH. Striatal protein expression activity was analyzed by SDS-PAGE and transferred to nitrocellulose membrane. Immunoblots were performed in triplicate using antibodies for respective proteins and visualized by ECL. Lane 1: wild-type control, lane 2: wild-type METH, lane 3: Nurr1 ⫹/⫺ control, lane 4: Nurr1 ⫹/⫺ METH. *P ⬍ 0.05 Significantly different from wild-type control; aP ⬍ 0.05 Significantly different from Nurr1 ⫹/⫺ control or wild-type METH. bP ⬍ 0.05 Significantly different from all groups.
1445
Figure 4. Photomicrograph of representative protein-DNA interaction array. The proteinDNA array analysis indicated that various transcription factors were significantly activated or deactivated 72 h after the last injection of METH. For the list of the transcription factors and the respective primers used on the membrane array, refer to Tables 1 and 2.
To further correlate the activation of apoptosome to the increased NO, we first studied the activation of poly (ADP-ribose) polymerase (PARP) in the striatum. An increased activation of PARP was observed in Nurr1 ⫹/⫺ mice and METH administration significantly enhanced that activation Fig. 3A. In fact, METH resulted in a very high activation of PARP in the Nurr1 ⫹/⫺ mice. As we have seen previously, there was a high expression of activated caspase-3, we studied the cleavage of activated PARP as an intermediate to correlate the NO mediated DNA damage and the activation of apoptosome. There was a significant increase in the striatal expression of cleaved PARP (C-PARP) in the Nurr1 ⫹/⫺ mice as compared with the wild-type but the highest expression of C-PARP was observed in the Nurr1 ⫹/⫺ group treated with METH Fig. 3A. To confirm the role of increased NO production via high expression of nNOS as a susceptibility factor for potentiated dopaminergic damage, we studied the interaction of various transcription factors with the DNA in the striatal nuclear extracts of control and METHtreated wild-type and Nurr1 ⫹/⫺ mice. Transcription factors modulate the frequency of transcriptional regulation by interacting with specific DNA binding elements present in the promoter of certain genes. Figure TABLE 1. Differential activity of transcription factors in striatum after methamphetamine administration to wild-type and Nurr1 ⫹/⫺ mice as shown by protein-DNA interaction array Nurr1 ⫹/⫺
Wild-type
Activated: 1. E2F-1 2. PPAR 3. EGR-1 Deactivated: 1. c-Myb 2. STAT-5
1446
Vol. 19
TABLE 2. Primer sequence used for TFs array
Stat5 Brn-3
GATCGAACTGACCGCCCGCGGCCCGT TACAGGCATAACGGTTCCGTAGTGA ATTTAAGTTTCGCGCCCTTTCTCAA CAAAACTAGGTCAAAGGTCA GGATCCAGCGGGGGCGAGCGGGGGCCA TCGAGAGCCAGACAAAAAGCCAGACA TTTAGCCAGACAC AGATTTCTAGGAATTCAATCC CACAGCTCATTAACGCGC
The FASEB Journal
IMAM ET AL.
1. EGR-2 2. SMAD 1. Brn-3 2. AP-2
September 2005
4 represents the protein-DNA array that we used to study 54 transcription factors simultaneously. Both wild-type and Nurr1 ⫹/⫺ mice presented a pattern of activation and deactivation of transcription factors. All the transcription factors that were either activated or deactivated in wild-type animals were also found to be activated and deactivated in Nurr1 ⫹/⫺ mice after METH-treatment. Table 1 represents the list of various activated and deactivated transcription factors in the striata of both wild-type and Nurr1 ⫹/⫺ mice and an additional set of activated and deactivated transcription factors in Nurr1 ⫹/⫺ mice after METH administration. Table 2 provides the list of the primer sequence used on the array for those TFs that showed significant changes in our studies. Finally, we also studied the striatal expression of ␣-synuclein as a functional marker of possible dopaminergic damage induced by reduced Nurr1 expression. Figure 5 represents the expression levels of ␣-synuclein in the wild-type and Nurr1 ⫹/⫺ mice. A significantly increased expression of ␣-synuclein was observed in the striatum of Nurr1 ⫹/⫺ mice as compared with their wild-type counterparts. Furthermore, METH administration enhanced this expression or aggregation of ␣-synuclein in the striatum. To better understand the role of increased nitration as a hallmark of striatal dopmainergic damage, we also studied the possible
AP-2 c-Myb E2F-1 PPAR EGR Smad3/4
Figure 5. Increased expression as well as nitration of ␣-synuclein is observed in the striata of METH-treated Nurr1 ⫹/⫺ mice. Both wild-type and Nurr1 ⫹/⫺ mice were treated with METH (4⫻10 mg/kg, i.p.) and killed 72 h after the last injection of METH. Striatal ␣-synuclein activity was analyzed by SDS-PAGE and transferred to nitrocellulose membrane. Immunoblots were performed in triplicate using ␣-synuclein antibodies and visualized by ECL. Striatal protein samples immunoprecipitated with either ␣-synuclein or tyrosine hydroxylase were immunoblotted with affinity purified antinitrotyrosine antibodies and visualized by ECL. Lane 1: wild-type control; lane 2: wild-type METH; lane 3: Nurr1 ⫹/⫺ control; lane 4: Nurr1 ⫹/⫺ METH. *P ⬍ 0.05 Significantly different from wild-type control; aP ⬍ 0.05 Significantly different from Nurr1 ⫹/⫺ control or wild-type METH.
nitration of ␣-synuclein resulting from the increased generation of PO in the METH-treated wild-type as well as Nurr1 ⫹/⫺ mice. Immunoprecipitation studies revealed a slight but significant nitration of ␣-synuclein in wild-type animals treated with METH. However, the rate of nitration of ␣-synuclein increased by many folds in METH-treated Nurr1 ⫹/⫺ mice (Fig. 5). To further correlate this increased nitration in Nurr1 ⫹/⫺ mice with increased dopaminergic damage, we studied the rate of nitration of tyrosine hydroxylase, a rate-limiting enzyme in dopamine synthesis, in METH-treated animals. Figure 5 also illustrates a significant increase in the nitration of tyrosine hydroxylase in the striata of METH-treated wild-type animals. This nitration of striatal tyrosine hydroxylase induced by METH was observed to be further potentiated in Nurr1 ⫹/⫺ mice.
DISCUSSION The present study investigated the potential role of NO in the mediation of increase dopaminergic damage via the activation of apoptosome during the reduced expression of Nurr1 gene. This study showed that increased striatal nNOS expression as well as enzyme activity in Nurr1 ⫹/⫺ mice resulted in increased nitrative damage as well as the dopaminergic depletion in the striatum after repeated administration of methamphetamine (METH), which is a known dopaminergic toxin that acts specifically on nerve terminals (24). The increased production of 3-NT, an in vivo marker of peroxynitrite production, has been reported in the striatum of METH-treated mice (11). The decomposition catalysts of peroxynitrite (PO) or nNOS inhibitors as well as mice lacking nNOS gene or overexpressing superoxide dismutase gene have been shown to be Nurr1 IN NO-MEDIATED DOPAMINERGIC INJURY
protected against PO-induced nitrative as well as dopaminergic damage induced by METH (15). We have also shown that reduced Nurr1 expression increases the susceptibility to MPTP-induced dopaminergic damage (9). In our studies, we observed an extensive decrease in the dopamine content of striatum of Nurr1 ⫹/⫺ mice treated with METH. We have also reported that METH caused an increased expression of p53 and decreased expression of bcl-2 in the striatum of wild-type mice treated with METH and this alteration in protein expression was reversed in the animals lacking nNOS gene (11), suggesting a role of NO and PO in the induction of pro-apoptotic pathway. In the present study, we found that METH induced activation of p53 and the consecutive suppression of bcl-2 was highly increased in the striata of Nurr1 ⫹/⫺ mice. This led us to believe that Nurr1 deficiency might be playing a role in the induction of apoptosome via NO. The suppression of bcl-2 in the Nurr1 ⫹/⫺ mice could result in the leaking out of cyt C from the mitochondria. Cyt C is known to have a well defined physiological function and that is the mediation of apoptosis (25). Once cyt C is released from the intramembrane of the mitochondria to the cytoplasm, it can trigger the activation of caspase-3, hence activating the downstream of apoptotic cell death pathway. In our studies, we observed a very high cytosolic expression activity of cyt C in the striata of Nurr1 ⫹/⫺ mice treated with METH. However, the release of cyt C alone is not enough to cause cell death (26). The release of cyt C from mitochondria in response to a death signal also follows a release of second mitochondria-derived activator of caspases (Smac)/ DIABLO protein into the cytosol during the execution of the intrinsic pathway of apoptosis (27). Here, we also observed an increased expression of Smac/DIABLO protein in the striatal cytosol of Nurr1 ⫹/⫺ mice treated with METH suggesting a consecutive release of this protein along with cyt C in response to the NOmediated dopaminergic alterations induced by METH. Smac/DIABLO promotes apoptosis by neutralizing the inhibitory effect of X-linked inhibitor of apoptosis (X-IAP) proteins on the processing and activities of effector caspase-3 (28). The crystal structure of Smac/ DIABLO has shown that it is a homodimeric 3-helix bundle, and the N terminus of Smac/DIABLO as short as 7 (Smac-7) or even 4 amino acids (Smac-4) can promote caspase-3 activation (29). We also observed an increased expression of activated caspase-3 in the striatal cytosol of Nurr1 ⫹/⫺ mice. These findings suggest that NO-mediated release of cyt C and Smac/DIABLO promotes the activation of caspase-3 in the absence of Nurr1 and thereby increases the susceptibility of the dopaminergic neurons to undergo the apoptotic pathway. Although the activation of caspase-3 is sufficient to induce the onset of apoptosis, execution of the apoptosis can further be progressed by the targeting of specific enzymes responsible for maintenance and repair of DNA damage. DNA damage is the prime activator of 1447
PARP which is an enzyme responsible for the repair of DNA damage. PARP is activated primarily by the singlestrand nicks of DNA that typically occur after free radical damage (30). Increased expression of nNOS as well as increased formation of 3-NT in Nurr1 ⫹/⫺ mice treated with METH supports the hypothesis of increased free radical production in the striata of these animals. Therefore, it is possible that increased PO in these animal models can lead to the induction of DNA damage and that can lead to the activation of PARP. Failure to detect PARP activation or expression in nNOS knockout mice after MPTP administration appeared to be concurrent with our hypothesis (19). In our studies, we found a significant increase in the expression of PARP in the METH-treated Nurr1 ⫹/⫺ mice suggesting a NO mediated induction of DNA damage and consecutive PARP activation. Furthermore, activated PARP is a prominent target for caspase mediated cleavage during apoptosis (31). Our observation of the increased expression of cleaved PARP further confirms this hypothesis and supports our observation of increased activated caspase-3 in the striata of Nurr1 ⫹/⫺ mice treated with METH. To further understand the mechanism by which NO mediates the increased susceptibility to dopaminergic damage, we studied the differential interaction of various transcription factors with the DNA. Increased activation of EGR-1, E2F-1, and PPAR-1 and deactivation of c-Myb, Pax-5 as well as STAT-5 suggests an apoptosis inducing effect of METH administration. An enhanced expression of EGR-1 has been shown to be associated with increased neuronal apoptosis (32). The NO-induced neuronal cell death has been reported to be accompanied by increased synthesis and activation EGR-1 (33). Furthermore, EGR-1 has been reported to induce apoptosis by the transactivation of p53 gene (34). These findings complement our observations in the present study where we observed an activation of EGR-1 as well as an increased expression of p53. Both E2F-1 and PPAR-1 have directly been implicated in the induction of apoptosis (35, 36) whereas STAT 5 plays a major role in cell survival (37). c-Myb activation is associated with decreased apoptosis (38) and in our studies we found a deactivation of c-Myb in METHtreated animals. Our finding thus provides the information that METH treatment can induce the regulation of various transcription factors responsible for the induction of apoptosis. In addition, our findings of the differential activity of additional transcription factors, other than the ones that were also affected in wild-type, in the striata of Nurr1 ⫹/⫺ mice treated with METH revealed a distinct pattern of correlation with NOmediated induction of apoptosome in partial absence of Nurr1 gene. Activation of EGR-2 and transcription factors of SMAD family suggested a prominent role of these transcription factors in the activation of apoptosome. Activation of EGR-2 participates in activationinduced Fas-ligand up-regulation which leads to apoptosis (39). Recently, an up-regulation of Fas-ligand death pathway has been reported to induce apoptosis 1448
Vol. 19
September 2005
after METH-administration, suggesting a role for this pathway in an increased susceptibility to METH in Nurr1 ⫹/⫺ mice (40). The transcription factors of SMAD family have also been reported to mediate TGF- induced apoptosis (41). We also observed a significant deactivation of AP-2, Brn-3, and c-Myb in METH-treated Nurr1 ⫹/⫺ mice. AP-2 deficient mice have been reported to lose their transcriptional regulatory function and undergo apoptosis (42). In our studies, we observed a significant deactivation of AP-2 in the Nurr1 ⫹/⫺ mice. The Brn-3 transcription factors have been reported to stimulate the expression of anti-apoptotic bcl-2 and bcl-x proteins (43). Here, we observed a significant deactivation of Brn-3 in the striata of Nurr1 ⫹/⫺ mice treated with METH. p53 has been reported to block Brn-3 mediated activation of Bcl-2 and Bcl-x promoter, thus inhibiting the expression of bcl-2 and bcl-x (43). p53 therefore appears to specifically target the activation of Brn-3. This complements our observation of highly significant increase in the expression of p53 in the striata of Nurr1 ⫹/⫺ mice treated with METH and a corresponding decrease in the expression of bcl-2. Concurrent with our observation in METH-treated wild-type animals, we observed a significant deactivation of c-Myb in METH-treated Nurr1 ⫹/⫺ mice as well, suggesting a possible involvement of these transcription factors in the induction of apoptotic pathway. We also observed a very high expression of ␣-synuclein in the striata of Nurr1 ⫹/⫺ mice treated with METH. Overexpression of human ␣-synuclein has been reported to cause dopamine neuron death in primary human mesencephalic culture (44). Human ␣-synuclein overexpression has also been reported to increase intracellular free radicals and susceptibility to dopamine (45). It is possible that the increased expression of ␣-synuclein observed in our studies might have resulted from its aggregation because of the loss of dopaminergic neurons and METH-induced depletion of dopamine in Nurr1 ⫹/⫺ mice. ␣-Synuclein has been reported to aggregate in dopaminergic system as a hallmark of dopaminergic damage (45). Induction of ␣-synuclein aggregation has been reported by intracellular exposure to NO (46). In our studies the high expression of this protein in the striata of METHtreated Nurr1 ⫹/⫺ mice is concurrent with these findings. Furthermore, ␣-synuclein has also been reported as prominent target for nitration induced by PO and therefore serves as a potential pathological marker for nitration-mediated dopaminergic damage (47, 48). In our studies, we observed a very high and significant rate of nitration of ␣-synuclein in the striatum of METH-treated Nurr1 ⫹/⫺ mice that suggests that increased nNOS expression and activity as well as PO generation in these models resulted in the increased susceptibility to dopaminergic damage. Our observation of significantly high rate of tyrosine hydroxylase nitration in Nurr1 ⫹/⫺ mice as compared with their wild-type correspondents strengthen the notion that
The FASEB Journal
IMAM ET AL.
NO plays a major role as a mediator of dopaminergic damage in Nurr1 ⫹/⫺ mice. In conclusion, our studies demonstrate that reduced Nurr1 expression leads to the increased dopaminergic depletion and an increased susceptibility of the dopaminergic terminals to dopaminergic toxins. This enhanced dopaminergic depletion and increased susceptibility to dopaminergic toxins is mediated by the increased generation of NO or peroxynitrite from the increased expression and activity of nNOS. The increased activation of transcription factors responsible for the induction of apoptosis resulting from reduced Nurr1 expression and consecutive increased production of NO can regulate the activation of pro-apoptotic and deactivation of anti-apoptotic proteins in the striatum. Furthermore, the activation of p53 and deactivation of bcl-2 can induce a cascade resulting in the formation of mitochondria-mediated apoptosome. Further investigation of the combined and precise role of Nurr1 and nitric oxide in the manifestation of dopaminergic toxicity and damage may clarify the fundamental mechanisms for the understanding of various neurodegenerative disorders and psychopathological conditions.
11.
12.
13.
14. 15.
16. 17. 18. 19.
This project was supported by grants (NS40370 and NS043567) from NINDS.
REFERENCES 1.
2. 3. 4.
5.
6. 7.
8.
9.
10.
Mages, H. W., Rilke, O., Bravo, R., Senger, G., and Kroczek, R. A. (1994) NOT, a human immediate-early response gene closely related to the steroid/thyroid hormone receptor NAK1/ TR3. Mol. Endocrinol. 8, 1583–1591 Zetterstrom, R. H., Solomin, L., Jansson, L., Hoffer, B. J., Olson, L., and Perlmann, T. (1997) Dopamine neuron agenesis in Nurr1-deficient mice. Science 276, 248 –250 Perlmann, T., and Wallen-Mackenzie, A. (2004) Nurr1, an orphan nuclear receptor with essential functions in developing dopamine cells. Cell Tissue Res. 318, 45–52 Giros, B., Jaber, M., Jones, S. R., Wightman, R. M., and Caron, M. G. (1996) Hyperlocomotion and indifference to cocaine and amphetamine in mice lacking the dopamine transporter. Nature (London) 379, 606 – 612 Bannon, M. J., Pruetz, B., Manning-Bog, A. B., Whitty, C. J., Michelhaugh, S. K., Sacchetti, P., Granneman, J. G., Mash, D. C., and Schmidt, C. J. (2002) Decreased expression of the transcription factor NURR1 in dopamine neurons of cocaine abusers. Proc. Natl. Acad. Sci. USA 99, 6382– 6385 Jiang, C., Wan, X., He, Y., Pan, T., Jankovic, J., and Le, W. (2005) Age-dependent dopaminergic dysfunction in Nurr1 knockout mice. Exp. Neurol. 191, 154 –162 Sakurada, K., Ohshima-Sakurada, M., Palmer, T. D., and Gage, F. H. (1999) Nurr1, an orphan nuclear receptor, is a transcriptional activator of endogenous tyrosine hydroxylase in neural progenitor cells derived from the adult brain. Development 126, 4017– 4026 Ojeda, V., Fuentealba, J. A., Galleguillos, D., and Andres, M. E. (2003) Rapid increase of Nurr1 expression in the substantia nigra after 6-hydroxydopamine lesion in the striatum of the rat. J. Neurosci. Res. 73, 686 – 697 Le, W., Conneely, O. M., He, Y., Jankovic, J., and Appel, S. H. (1999) Reduced Nurr1 expression increases the vulnerability of mesencephalic dopamine neurons to MPTP-induced injury. J. Neurochem. 73, 2218 –2221 Backman, C., You, Z. B., Perlmann, T., and Hoffer, B. J. (2003) Elevated locomotor activity without altered striatal dopamine contents in Nurr1 heterozygous mice after acute exposure to methamphetamine. Behav. Brain Res. 143, 95–100
Nurr1 IN NO-MEDIATED DOPAMINERGIC INJURY
20.
21. 22. 23.
24.
25. 26. 27.
28.
29. 30.
Imam, S. Z., Newport, G. D., Itzhak, Y., Cadet, J. L., Islam, F., Slikker, W., Jr., and Ali, S. F. (2001) Peroxynitrite plays a role in methamphetamine-induced dopaminergic neurotoxicity: evidence from mice lacking neuronal nitric oxide synthase gene or overexpressing copper-zinc superoxide dismutase. J. Neurochem. 76, 745–749 Itzhak, Y., Gandia, C., Huang, P. L., and Ali, S. F. (1998) Resistance of neuronal nitric oxide synthase-deficient mice to methamphetamine-induced dopaminergic neurotoxicity. J. Pharmacol. Exp. Ther. 284, 1040 –1047 Imam, S. Z., Itzhak, Y., Cadet, J. L., Islam, F., Slikker, W., Jr., and Ali, S. F. (2001) Methamphetamine-induced alteration in striatal p53 and bcl-2 expressions in mice. Brain Res. Mol. Brain Res. 91, 174 –178 Hirata, H., and Cadet, J. L. (1997) p53-knockout mice are protected against the long-term effects of methamphetamine on dopaminergic terminals and cell bodies. J. Neurochem. 69, 780 –790 Imam, S. Z., el-Yazal, J., Newport, G. D., Itzhak, Y., Cadet, J. L., Slikker, W., Jr., and Ali, S. F. (2001) Methamphetamine-induced dopaminergic neurotoxicity: role of peroxynitrite and neuroprotective role of antioxidants and peroxynitrite decomposition catalysts. Ann. N.Y. Acad. Sci. 939, 366 –380 Deng, X., and Cadet, J. L. (1999) Methamphetamine administration causes overexpression of nNOS in the mouse striatum. Brain Res. 851, 254 –257 Iadecola, C. (1997) Bright and dark sides of nitric oxide in ischemic brain injury. Trends Neurosci. 20, 132–139 Samdani, A. F., Dawson, T. M., and Dawson, V. L. (1997) Nitric oxide synthase in models of focal ischemia. Stroke 28, 1283–1288 Mandir, A. S., Przedborski, S., Jackson-Lewis, V., Wang, Z. Q., Simbulan-Rosenthal, C. M., Smulson, M. E., Hoffman, B. E., Guastella, D. B., Dawson, V. L., and Dawson, T. M. (1999) Poly(ADP-ribose) polymerase activation mediates 1-methyl-4phenyl-1, 2,3,6-tetrahydropyridine (MPTP)-induced parkinsonism. Proc. Natl. Acad. Sci. USA 96, 5774 –5779 Tewari, M., Quan, L. T., O'Rourke, K., Desnoyers, S., Zeng, Z., Beidler, D. R., Poirier, G. G., Salvesen, G. S., and Dixit, V. M. (1995) Yama/CPP32 beta, a mammalian homolog of CED-3, is a CrmA-inhibitable protease that cleaves the death substrate poly(ADP-ribose) polymerase. Cell 81, 801– 809 Pettmann, B., and Henderson, C. E. (1998) Neuronal cell death. Neuron 20, 633– 647 Schulz, J. B., Weller, M., and Moskowitz, M. A. (1999) Caspases as treatment targets in stroke and neurodegenerative diseases. Ann. Neurol. 45, 421– 429 Saucedo-Cardenas, O., Quintana-Hau, J. D., Le, W. D., Smidt, M. P., Cox, J. J., De, M. F., Burbach, J. P., and Conneely, O. M. (1998) Nurr1 is essential for the induction of the dopaminergic phenotype and the survival of ventral mesencephalic late dopaminergic precursor neurons. Proc. Natl. Acad. Sci. USA 95, 4013– 4018 Imam, S. Z., Newport, G. D., Duhart, H. M., Islam, F., Slikker, W., Jr., and Ali, S. F. (2002) Methamphetamine-induced dopaminergic neurotoxicity and production of peroxynitrite are potentiated in nerve growth factor differentiated pheochromocytoma 12 cells. Ann. N.Y. Acad. Sci. 965, 204 –213 Cai, J., Yang, J., and Jones, D. P. (1998) Mitochondrial control of apoptosis: the role of cytochrome c. Biochim. Biophys. Acta 1366, 139 –149 Deshmukh, M. (1998) Caspases in ischaemic brain injury and neurodegenerative disease. Apoptosis 3, 387–394 Guo, F., Nimmanapalli, R., Paranawithana, S., Wittman, S., Griffin, D., Bali, P., O'Bryan, E., Fumero, C., Wang, H. G., and Bhalla, K. (2002) Ectopic overexpression of second mitochondria-derived activator of caspases (Smac/DIABLO) or cotreatment with N-terminus of Smac/DIABLO peptide potentiates epothilone B derivative-(BMS 247550) and Apo-2L/TRAILinduced apoptosis. Blood 99, 3419 –3426 Liu, Z., Sun, C., Olejniczak, E. T., Meadows, R. P., Betz, S. F., Oost, T., Herrmann, J., Wu, J. C., and Fesik, S. W. (2000) Structural basis for binding of Smac/DIABLO to the XIAP BIR3 domain. Nature (London) 408, 1004 –1008 Chai, J., Du, C., Wu, J. W., Kyin, S., Wang, X., and Shi, Y. (2000) Structural and biochemical basis of apoptotic activation by Smac/DIABLO. Nature (London) 406, 855– 862 Shall, S. (1994) The function of poly (ADP-ribosylation) in DNA breakage and rejoining. Mol. Cell. Biochem. 138, 71–75
1449
31.
32.
33.
34. 35.
36.
37. 38.
39.
40.
1450
Wang, Z. Q., Stingl, L., Morrison, C., Jantsch, M., Los, M., Schulze-Osthoff, K., and Wagner, E. F. (1997) PARP is important for genomic stability but dispensable in apoptosis. Genes Dev. 11, 2347–2358 Catania, M. V., Copani, A., Calogero, A., Ragonese, G. I., Condorelli, D. F., and Nicoletti, F. (1999) An enhanced expression of the immediate early gene, Egr-1, is associated with neuronal apoptosis in culture. Neuroscience 91, 1529 –1538 Cibelli, G., Policastro, V., Rossler, O. G., and Thiel, G. (2002) Nitric oxide-induced programmed cell death in human neuroblastoma cells is accompanied by the synthesis of Egr-1, a zinc finger transcription factor. J. Neurosci. Res. 67, 450 – 460 Liu, C., Rangnekar, V. M., Adamson, E., and Mercola, D. (1998) Suppression of growth and transformation and induction of apoptosis by EGR-1. Cancer Gene Ther. 5, 3–28 Elliott, M. J., Farmer, M. R., Atienza, C., Jr., Stilwell, A., Dong, Y. B., Yang, H. L., Wong, S. L., and McMasters, K. M. (2002) E2F-1 gene therapy induces apoptosis and increases chemosensitivity in human pancreatic carcinoma cells. Tumour Biol. 23, 76 – 86 Okano, H., Shiraki, K., Inoue, H., Yamanaka, T., Deguchi, M., Sugimoto, K., Sakai, T., Ohmori, S., Fujikawa, K., Murata, K., et al. (2002) Peroxisome proliferator-activated receptor gamma augments tumor necrosis factor family-induced apoptosis in hepatocellular carcinoma. Anticancer Drugs 13, 59 – 65 Battle, T. E., and Frank, D. A. (2002) The role of STATs in apoptosis. Curr. Mol. Med. 2, 381–392 Greco, C., Alvino, S., Buglioni, S., Assisi, D., Lapenta, R., Grassi, A., Stigliano, V., Mottolese, M., and Casale, V. (2001) Activation of c-MYC and c-MYB proto-oncogenes is associated with decreased apoptosis in tumor colon progression. Anticancer Res. 21, 3185–3192 Yang, Y., Dong, B., Mittelstadt, P. R., Xiao, H., and Ashwell, J. D. (2002) HIV Tat binds Egr proteins and enhances Egr-dependent transactivation of the Fas ligand promoter. J. Biol. Chem. 277, 19482–19487 Jayanthi, S., Deng, X., Ladenheim, B., McCoy, M. T., Cluster, A., Cai, N. S., and Cadet, J. L. (2005) Calcineurin/NFAT-induced
Vol. 19
September 2005
41. 42. 43. 44.
45. 46.
47.
48.
up-regulation of the Fas ligand/Fas death pathway is involved in methamphetamine-induced neuronal apoptosis. Proc. Natl. Acad. Sci. USA 102, 868 – 873 Chen, W., Fu, X., and Sheng, Z. (2002) Review of current progress in the structure and function of Smad proteins. Chin. Med. J. (England) 115, 446 – 450 Hilger-Eversheim, K., Moser, M., Schorle, H., and Buettner, R. (2000) Regulatory roles of AP-2 transcription factors in vertebrate development, apoptosis and cell-cycle control. Gene 260, 1–12 Sugars, K. L., Budhram-Mahadeo, V., Packham, G., and Latchman, D. S. (2001) A minimal Bcl-x promoter is activated by Brn-3a and repressed by p53. Nucleic Acids Res. 29, 4530 – 4540 Zhou, W., Schaack, J., Zawada, W. M., and Freed, C. R. (2002) Overexpression of human alpha-synuclein causes dopamine neuron death in primary human mesencephalic culture. Brain Res. 926, 42–50 Junn, E., and Mouradian, M. M. (2002) Human alpha-synuclein over-expression increases intracellular reactive oxygen species levels and susceptibility to dopamine. Neurosci. Lett. 320, 146 –150 Paxinou, E., Chen, Q., Weisse, M., Giasson, B. I., Norris, E. H., Rueter, S. M., Trojanowski, J. Q., Lee, V. M., and Ischiropoulos, H. (2001) Induction of alpha-synuclein aggregation by intracellular nitrative insult. J. Neurosci. 21, 8053– 8061 Przedborski, S., Chen, Q., Vila, M., Giasson, B. I., Djaldatti, R., Vukosavic, S., Souza, J. M., Jackson-Lewis, V., Lee, V. M., and Ischiropoulos, H. (2001) Oxidative post-translational modifications of alpha-synuclein in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model of Parkinson's disease. J. Neurochem. 76, 637– 640 Giasson, B. I., Duda, J. E., Murray, I. V., Chen, Q., Souza, J. M., Hurtig, H. I., Ischiropoulos, H., Trojanowski, J. Q., and Lee, V. M. (2000) Oxidative damage linked to neurodegeneration by selective alpha-synuclein nitration in synucleinopathy lesions. Science 290, 985–989
The FASEB Journal
Received for publication December 14, 2004. Accepted for publication April 27, 2005.
IMAM ET AL.
