J Nanopart Res (2008) 10:1009–1025 DOI 10.1007/s11051-007-9332-5
RESEARCH PAPER
Novel method for immobilization of enzymes to magnetic nanoparticles Andrew K. Johnson Æ Anna M. Zawadzka Æ Lee A. Deobald Æ Ronald L. Crawford Æ Andrzej J. Paszczynski
Received: 7 May 2007 / Accepted: 17 November 2007 / Published online: 7 December 2007 Ó Springer Science+Business Media B.V. 2007
Abstract The value of coupling biological molecules such as enzymes to solid materials has long been recognized. To date, protein immobilization onto such surfaces often involves covalent coupling, encapsulation, or non-specific adsorption techniques. Here we demonstrate the feasibility of specifically attaching a haloalkane dehalogenase enzyme to silica-coated or uncoated iron oxide superparamagnetic nanoparticles using affinity peptides. The enzyme was cloned from Xanthobacter autotrophicus strain GJ10 into Escherichia coli to produce fusion proteins containing dehalogenase sequences with C-terminal polypeptide repeats that have specific affinity for either silica or iron oxide. The fusion proteins serve dual functions, allowing for specific inorganic surface binding and for enzymatic activity. The degree of fusion protein adsorption to nanoparticle surfaces was found to exceed that of enzymes that had not been activated with affinity sequences, particularly for iron-oxide Andrew K. Johnson and Anna M. Zawadzka contributed equally to this work. A. K. Johnson A. M. Zawadzka L. A. Deobald R. L. Crawford A. J. Paszczynski (&) Environmental Biotechnology Institute, University of Idaho, Moscow, ID 83844-1052, USA e-mail:
[email protected] Present Address: A. M. Zawadzka Department of Chemistry, University of California, Berkeley, CA 94720, USA
nanoparticles. The ability to specifically adsorb cloned affinity-tagged dehalogenase was further demonstrated by selectively adsorbing dehalogenase fusion proteins containing an iron-oxide affinity tripeptide directly from cell lysate. The retention of enzymatic activity was found to be dependent upon the surface chemistry of the nanoparticles. An increase in activity was observed after adsorption of fusion proteins onto the surface of nanoparticles modified by treatment with hydrophilic polyethylene glycol or 3-glycidoxypropyltrimethoxysilane molecules. As a result of this work, it is possible to tag an active enzyme with specific peptides that bind to inorganic nanoparticle surfaces. Because the conjugates self assemble, the novel surface-specific conjugate formation procedure is highly efficient and easily scalable for use in large-scale applications. Keywords Magnetic nanoparticles Enzymes Affinity peptide Nanobiotechnology Nanomedicine
Introduction The unique physical properties of nanoparticles are allowing their application in many fields such as biomedicine (Gupta and Gupta 2005; Ito et al. 2005; Atanasijevic et al. 2006), sensor development (Katz and Willner 2004), water purification (Savage and Diallo 2005), and environmental remediation (Zhang
123
1010
2003b; Tratnyek and Johnson 2006; Liu 2006). Superparamagnetism of magnetic nanoparticles (MNPs) is a size-dependent property that is useful for applications requiring manipulation of MNPs by an external magnetic field. Such particles do not retain any residual magnetism once the magnetic field is removed (Gupta and Gupta 2005; Ito et al. 2005). By coupling the unique electrical, optical, and magnetic properties of nanoparticles with the specific recognition or catalytic properties of biomolecules, many novel biotechnological applications have emerged (Katz and Willner 2004). The large surface-area-to-volume ratio of a nanoparticle allows it to serve as an efficient carrier of biomolecules. This feature has resulted in the development of many biomolecule-nanoparticle (bio-NP) hybrids for biomedical applications in the diagnosis and localized treatment of disease (Gupta and Gupta 2005; Ito et al. 2005; Harris et al. 2006; Atanasijevic et al. 2006). Enzymes have long been used in industry as catalysts for catabolic processes or for the production of specific chemical enantiomers. MNP-enzyme conjugates (MNP-Es) represent a specific class of bio-NP conjugates that are of great interest for biotechnological applications where high catalytic specificity, prolonged reaction time, and in some cases the ability to recycle an expensive biocatalyst is required (Swanson 1999; Alcalde et al. 2006). In addition, magnetic field susceptibility provides a mechanism for efficient recovery of the enzyme complex from reaction products, which is especially important in the pharmaceutical industry where enzyme contamination of the final product can cause detrimental side effects. Xenobiotic chemical degrading enzymes attached to MNPs also hold potential for use in novel nano-remediation technologies that will allow precise delivery (using electromagnetic probes) of the MNP-E conjugate to the contaminant source in locations such as aquifers while enabling recovery and reuse of the MNP-Es. The fate of biomolecules in natural or human-controlled environments (e.g., sewage treatment plants, aquifers, or soils) could also be traced by tagging the biomolecules with MNPs. Researchers are improving current technologies and developing new applications that utilize enzymes immobilized on nanoparticles. Many enzymes currently used in biotechnology, including glucose oxidase and peroxidase, have been covalently
123
J Nanopart Res (2008) 10:1009–1025
immobilized to MNPs using several different ligands (Rossi et al. 2004; Kouassi et al. 2005a). Glucose oxidase, an enzyme used in sensors that measure blood glucose, was covalently immobilized to MNPs and found to be stable over a wide range of pH and temperature conditions and to retain activity for three months (Rossi et al. 2004). Another enzyme, cholesterol oxidase, was covalently immobilized for use in clinical applications and sensors (Kouassi et al. 2005b). Lipase, which is important for processing lipids in the food and pharmaceutical industries, was covalently immobilized to nanoparticles by a carbodiimide linkage and shown to maintain significant activity after one month of storage (Dyal et al. 2003). Trypsin and chymotrypsin have also been stabilized against denaturation and self-digestion at the air– water interface by immobilization on iron and gold nanoparticles (Hansen et al. 2006; Jordan et al. 2006). Streptokinase, which has been used as a therapeutic agent, has been covalently immobilized to MNPs by carbodiimide linkage for use in localized lysis of blood clots in vivo. The magnetic properties of the particle-streptokinase congener could allow for focusing of the treatment to the exact location where the clot was located, reducing the amount of enzyme required and in turn reducing the risk of eliciting an immune response (Koneracka´ et al. 2002; Fernandes et al. 2006). Improved techniques for immobilization of enzymes to NPs are needed to allow for greater enzyme loading on the high surface area available. Major challenges of many techniques previously described for enzyme immobilization on MNP inorganic surfaces are nonspecificity, loss of enzyme activity, or even complete protein denaturation. In addition, there often is considerable complexity in the chemical derivatization of the enzyme or MNPs prior to immobilization. Conversely, simple immobilization methods such as nonspecific adsorption can result in enzyme leaching, making this method inappropriate for applications where stability, both long-term and under sub-optimal conditions, is necessary. Covalent immobilization techniques that use crosslinking reagents can result in strong linkages that prevent enzyme leaching; however, the crosslinking reagents can potentially react with amino acids necessary for catalytic activity or substrate recognition and can cause nonspecific polymerization of protein molecules. The complexity
J Nanopart Res (2008) 10:1009–1025
Method Magnetic nanoparticles Supermagnetic nanoparticles (Ademtech, Pessac, France) composed of an iron core surrounded by a shell of ferric oxide were used for all work in this study. A hysteresis loop was provided by Ademtech for 300 nm MNPs (Fig. 1a, b). The magnetic susceptibility measurements were obtained with the use of a Quantum Design SQUID magnetometer MPMSXL. This magnetometer works between 1.8 and 400 K for DC-applied fields ranging from -7 to 7 T. The magnetic data were corrected for the sample holder and the diamagnetic contribution. The MNPs used in this study were 200 nm in diameter, and the magnetic susceptibility was 40 emu/g, similar to 300 nm MNPs. The reported surface area of the MNPs is 15 m2/g.
A 40
M / cm3.g-1
20 300 K 280 K 240 K 200 K 150 K 100 K 50 K 20 K 10 K 5K 2K
0
-20
-40 -50000 -25000
0
25000
50000
H / Oe
B 40 30 20
M / cm3.g-1
of covalent immobilization also depends on the ligand being used and the number of reaction steps required for chemical modification of the enzyme, the support surface, or both. Therefore complex immobilization methods are unlikely to be useful in industrial settings where cost and simplicity are required. Alternative methods of immobilization are needed that take a biomimetic approach in which the protein has innate specificity to bind the inorganic support or is conferred that ability. Here we describe such a novel method for immobilization of a catabolic enzyme, haloalkane dehalogenase (DhlA) to MNPs. We used cloned fusion proteins consisting of DhlA and oligomeric peptide repeats that have affinity for either silica (Naik et al. 2002) or iron oxide surfaces (Brown 1992) and directly adsorbed the fusion proteins to the MNPs in a single step. We compared this procedure to a chemical coupling reaction. We demonstrated that cloned fusion proteins are adsorbed to silica or iron oxide MNPs at a higher rate than adsorbed control proteins and retain enzymatic activity when linked to surface derivatized MNPs. Finally, by expressing DhlA containing terminal fusion proteins that bind to a specific surface, purification and immobilization of the enzyme directly from a cell lysate onto the MNPs was possible, saving both time and cost.
1011
10
300 K 280 K 240 K 200 K 150 K 100 K 50 K 20 K 10 K 5K 2K
0 -10 -20 -30 -40
-1000
0
1000
H / Oe
Fig. 1 Hysteresis loops provided by Ademtech for 300 nm MNPs over a range of temperature states. Magnetization at saturation is 40 emu/g. (a) The full range of the applied magnetic field is shown. (b) Narrow applied magnetic field range selected to exaggerate changes in the magnetic field strength required to return magnetization to zero for each temperature state. The coercive field is less than 200 Oe for the entire range of temperature states and *0 Oe at room temperature (*300 K) indicative of superparamagnetism
Sol-gel and dense liquid coating of magnetic nanoparticles Prior to coating the Ademtech particles, they were washed twice in deionized water and twice in absolute ethanol to remove stabilizing detergents. Sol-gel and dense liquid coatings were applied to the particles as described by Liu et al. (1998). The solgel/dense-liquid-coated (SOL-DLC) particles were collected with a magnet or by centrifugation (10,0009 g); the particles were washed three times
123
1012
in deionized water and then resuspended in a small volume of water. The suspension was frozen and freeze-dried.
Scanning electron microscopy (SEM) Silica-coated and uncoated iron oxide MNPs were examined with a LEO Supra 35 VP FESEM equipped with a Thermo Electron System six EDS (Zeiss, Thornwood, NY). Energy-dispersive X-ray spectrometry (SEM-EDS) was used to confirm the presence of the silica coating on the MNPs (Zawadzka et al. 2006).
Evaluation of coated nanoparticle stability The completeness of the silica coating on the MNPs was determined by measuring the rate at which the iron core was solubilized from sol-gel-coated and SOL-DLC MNPs in a dilute hydrochloric acid solution. Iron nanoparticles that had been sol-gel coated with tetraethoxysilane (TEOS) and particles coated with TEOS and then dense-liquid-coated with sodium silicate were tested for their resistance to solubilization in hydrochloric acid. This procedure was performed as described by Liu et al. (1998) except that soluble iron was measured using a colorimetric method with sulfosalicylic acid as described by Marczenko (1976).
Alkoxysilane-coated MNPs In order to prepare the nanoparticles for covalent enzyme immobilization and/or to prevent denaturation of the adsorbed enzyme, iron oxide MNPs and SOL-DLC MNPs were silanated with either 3-aminopropyltriethoxy silane (APS) or 3-glycidoxypropyltrimethoxy silane (GPS) as described by Bruce et al. (2005). APSsilanated MNPs were either activated with 5% glutaraldehyde for covalent coupling of DhlA or were covalently modified using polyethylene glycol oligomers (APS-PEG) to provide an inert organic coating by incubating with a 10-fold molar excess of methylpoly(ethylene oxide)4-N-hydroxysuccinimidyl (NHS) ester (Pierce, Rockford, IL). GPS-MNPs were rendered inert by epoxide ring opening (GPS-OH) in 0.05-M hydrochloric acid for 1 h at 55 °C. The
123
J Nanopart Res (2008) 10:1009–1025
surface-modified MNPs were washed (three times) and stored in either deionized water or 50-mM Tris–H2SO4 buffer at pH 7.5. The density of amine groups on the surface of APS-silanated MNPs was determined colorimetrically with 4-nitrobenzaldehyde as described by Bruce et al. (2005).
Cloning of dhlA and a dhlA-affinity peptide fusion construct The gene encoding the haloalkane dehalogenase dhlA was amplified by PCR from the total DNA of Xanthobacter autotrophicus GJ10 (ATCC 43050) using the primers designed by the OligoPerfect Designer online program (Invitrogen, Carlsbad, CA): F1 (50 -CACCATGATAAATGCAATTCGCACC-30 ) and R1 (50 -TTCTGTCTCGGCAAAGTGTTT-30 ). The primers were designed to enable directional cloning into a pENTR/SD/D-TOPO Gateway cloning vector (Invitrogen). PCR was performed as follows: 1 lL of X. autotrophicus GJ10 total DNA template (a single colony boiled in 50 lL of 1% Triton X in TE buffer at pH 8.0 for 15 min), 1X Pfx50 PCR Mix, a 0.3mM concentration of each dNTP, a 0.3-lM concentration of each primer, and five units of Pfx50 DNA polymerase (Invitrogen) were combined and the samples denatured for 2 min at 94 °C and then cycled 35 times using a cycle of 15 s at 94 °C, 30 s at 58 °C, and 60 s at 68 °C with final extension at 68 °C for 5 min. The PCR product was purified using a QIAquick PCR purification kit (Qiagen, Inc., Valencia, CA) and used for cloning and as a DNA template for fusion with the affinity peptide coding sequences (1 lL). Oligonucleotides containing three repeats of an iron oxide-affinity peptide (FeAP) sequence (RRTVKHHVN) or two repeats of a silica-affinity peptide (SiAP) sequence (MSPHPHPRHHHT) were incorporated in primer R1. The two sequences, FeR1 (50 -GTTAACGTGGTGTTTAACGGTACGACGGT TAACGTGGTGTTTAACGGTACGACGGTTAAC GTGGTGTTTAACGGTACGACGTTCTGTCTCGG CAAAGTGT-30 ) and SiR1 (50 -GGTGTGGTGGTGA CGCGGGTGCGGGTGCGGAGACATGGTGTGGT GGTGACGCGGGTGCGGGTGCGGAGACATTTC TGTCTCGGCAAAGTGTTT-30 ) were used. The peptide nucleotide sequences were derived from their amino acid sequences using E. coli codon usage tables and verified using E. coli Codon Usage Analysis 2.0
J Nanopart Res (2008) 10:1009–1025
(http://www.faculty.ucr.edu/*mmaduro/codonusage/ usage.htm). The oligonucleotides were synthesized by Invitrogen. The PCR reactions were performed as described above with the use of F1 and FeR1 or F1 and SiR1 primer pairs and annealing temperatures of 58 °C and 65 °C, respectively, to produce dhlA, dhlA-(FeAP)3, and dhlA-(SiAP)2 gene products. The PCR products were cloned into a pENTR/SD/DTOPO vector using a pENTR Directional TOPO cloning kit (Invitrogen), which was used to transform One Shot1 TOP10 (Invitrogen) chemically competent E. coli cells. Clones with plasmids containing the expected insert sizes, as confirmed by PCR with M13 primers and Taq polymerase (Invitrogen), were selected and the correct orientation of the inserts and the exact insert sequences were confirmed by sequencing using an ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA) and a Model 377 Automated DNA Sequencer (Applied Biosystems). The plasmid DNA from the selected clones was purified using a Wizard Plus SV Minipreps DNA Purification System (Promega, Madison, WI) and used for the LR recombination reaction (site directed recombination between the attL and attR sites on the receiving plasmid) to transfer the cloned genes into the pEXP2-DEST Gateway vector, which introduced a C-terminal 69 histidine tag using the Gateway LR Clonase II enzyme mix (Invitrogen). The LR reaction product (1 lL) was transformed into One Shot1 TOP10 chemically competent E. coli. The transformants were analyzed for the expected size of insert by PCR using T7 Promoter forward and V5 (C-term) reverse, and the inserts were then sequenced. To express the recombinant fusion proteins [dhlA-(His)6, dhlA-(FeAP)3-(His)6, and dhlA-(SiAP)2-(His)6], chemically competent BL21(DE3)pLysS E. coli cells (Invitrogen) were transformed with the purified plasmid DNA of the pEXP-DEST expression constructs containing the correct inserts.
Recombinant dehalogenase expression An overnight culture of E. coli BL21(DE3)pLysS was inoculated (10% v/v) into 250 mL LB medium containing ampicillin (100 lg/mL) and chloramphenicol (34 lg/mL), and bacteria were grown at 30 °C with shaking at 150 rpm for 2 h. Expression of the
1013
recombinant protein was induced with 0.5 mM of isopropyl-b-D-1-thiogalactopyranoside (IPTG) when the cultures reached an OD600 of 0.6–0.8. After induction, cultures were incubated an additional 4 h at 30 °C. To confirm enzyme expression, 1-mL aliquots of uninduced cultures grown for 2 h and induced cultures grown for an additional 4 h were removed and bacteria were harvested by centrifugation (18,0009 g for 10 min). The cell pellets were resuspended in 100 lL of 19 sample buffer, vortexed, boiled for 5 min, and centrifuged briefly. Ten lL of each sample were loaded onto an SDS-PAGE gel to examine protein expression. Cells were harvested by centrifugation at 10,0009 g for 25 min and the pellets frozen at -20 °C.
Purification and characterization of recombinant dehalogenases Harvested frozen cells were suspended in BugBuster Protein Extraction Reagent Master Mix (5 mL/g of wet cells) (Novagen, EMD Biosciences, Madison, WI). The protease inhibitor cocktail for purification of His-tagged proteins (Sigma-Aldrich, Saint Louis, MO) was added (50 lL/g of cells) together with phenylmethylsulfonyl fluoride (78 lg/mL). After a 10-min incubation at room temperature, 50% glycerol was added to a final concentration of 5% together with NaCl (300-mM final concentration) and imidazole (5 mM; Sigma-Aldrich), and the mixture was then incubated for an additional 10 min. The cell lysate was centrifuged for 20 min at 16,0009 g at 4 °C. Recombinant dehalogenases were purified from the clarified cell extract using HIS-Select nickel affinity agarose gel (Sigma-Aldrich) using native conditions and a batch purification method according to the manufacturer’s instructions with the following modifications. The equilibration and wash buffer consisted of 50-mM sodium phosphate, pH 8.0, 0.5 M NaCl, 10% glycerol, and 10-mM imidazole. The elution buffer contained 50-mM sodium phosphate, 0.5-M NaCl, 10% glycerol, and 250-mM imidazole at pH 8.0. Cell lysate from 1 g of wet cell pellet was mixed with 0.5 mL of equilibrated agarose gel and purified according to the batch protocol, but centrifugation was substituted with gravity-flow purification in 5-mL disposable columns. Without mixing the gel, the target protein was eluted from the
123
1014
J Nanopart Res (2008) 10:1009–1025
gel twice using 1 mL of elution buffer. The concentration of eluted proteins was measured using the bicinchoninic acid (BCA) protein assay (Pierce, Rockford, IL). For analysis by SDS-PAGE, 20-lL samples reserved following each purification step were mixed with 5 lL of 59 sample buffer (60-mM Tris–HCl, pH 6.8, 25% glycerol, 2% SDS, 14.4-mM 2-mercaptoethanol, 0.1% bromophenol blue) and boiled 5 min. SDS-PAGE analysis was performed in 12.5% polyacrylamide gels, and the gels were stained with Coomasie Brilliant Blue R250. The purified dehalogenases were stored at 4 °C in the elution buffer. Molecular masses of the expressed fusion proteins were examined using electrospray ionization tandem mass-spectrometry (ESI-MS/MS; see below). Enzymatic activity of dehalogenase with 1,2-dichloroethane (DCA) as a substrate was assayed using the spectrophotometric chloride release assay (Bergmann and Sanik 1957) and a colorimetric assay based on pH decrease in a weakly buffered medium (Holloway et al. 1998; Marvanova et al. 2001). DCA degradation was verified via headspace gas chromatography/mass-spectrometry (GC/MS; see below).
Electrospray ionization tandem mass spectrometry (ESI-MS/MS) Cloned and purified dehalogenase fusion proteins, DhlA-(His)6, DhlA-(FeAP)3-(His)6, and DhlA-(SiAP)2(His)6, were analyzed using electrospray ionization tandem mass spectrometry (ESI-MS/MS) (Quattro II, Waters Micromass Ltd., U.K.) to determine homogeneity and molecular weight. The purified and desalted protein solution in water (100 lL) was Fig. 2 MNP activation using recombinant DhlA fusion proteins. DhlAaffinity peptide fusion constructs produced using recombinant DNA techniques were expressed and purified by immobilized metal ion affinity chromatography by use of a histidine tag. Repeats of the affinity peptide moiety conferred strong affinity of the DhlA fusion protein for the MNP surface
123
mixed with 100 lL acetonitrile, and formic acid was added (0.2% v/v). Samples were delivered into the source at a flow of 5 lL/min using a syringe pump (Harvard Apparatus, South Natick, MA). A potential of 2.9 kV was applied to the electrospray needle, and the sample cone voltage was maintained at 10 V. Quadrupole detector resolution was set at 15,000, and the source temperature was maintained at 150 °C. The spectra were deconvoluted using MassLynx 4.0 software to calculate the molecular mass of the fusion proteins.
Dehalogenase adsorption to the MNPs The recombinant dehalogenase proteins were adsorbed to MNPs as depicted in Fig. 2. Prior to enzyme immobilization, the purified dehalogenase fusion proteins were desalted using Sephadex G-25 PD-10 columns (Amersham Biosciences, Buckinghamshire, U.K.) and either water or 1% glycerol was used as a solvent. Aliquots of each enzyme were mixed with 0.5-M Tris–H2SO4 buffer to give a 50-mM final buffer concentration containing 0.5–1.0 mg/mL protein. Tween 20 was added to a final concentration of 0.1%. To determine an optimum pH for recombinant dehalogenase adsorption, 50-mM Tris–H2SO4 buffers of pH 6.5, 7.0, and 7.5 were used in preliminary experiments. Peroxidase (Worthington Biochemical Corporation, Lakewood, NJ) was employed as a control to assess nonspecific adsorption onto the MNPs; 200-lL aliquots of enzyme solutions were incubated for 1 h with 1 mg of MNPs at room temperature with inversion. The supernatant containing free enzyme was removed following recovery of
E
SiO2 MNP
+
DhlA-(SiAP)2-(His)6
E DhlA-(FeAP)3-(His)6
+
Fe2O3 MNP
J Nanopart Res (2008) 10:1009–1025
1015
deprotected under acidic conditions. DhlA was desalted using a Sephadex G-25 PD-10 column (Amersham Biosciences) with modification buffer (100-mM phosphate and 150-mM NaCl at pH 7.2) as the solvent. A 10-fold molar excess of SANH crosslinker in DMF was added to DhlA suspended in modification buffer. The reaction was incubated for 3 h at room temperature with gentle inversion. The hydrazine-modified DhlA was desalted as before using conjugation buffer (100-mM 2-(N-morpholino)ethanesulfonic acid (MES) and 150-mM NaCl at pH 4.7) as the solvent, which functions to deprotect the hydrazine functional group. A terminal aldehyde functional group was introduced onto APS-silanated MNPs by incubation in 5% glutaraldehyde for 1 h (Fig. 3). Hydrazine-activated DhlA in conjugation buffer (1 mL) was added to aldehyde-activated APSMNPs that had been washed (three times) with conjugation buffer. Conjugation proceeded through a hydrozone coupling reaction by incubation for 1 h at room temperature with gentle inversion (Fig. 3). The MNP-DhlA conjugates were washed (three times) with 50-mM Tris–H2SO4 buffer at pH 7.5. Following each wash, the DhlA-MNP conjugates were recovered using a magnet. Conjugates were stored in 50-mM Tris–H2SO4 buffer at pH 7.5 and 4 °C.
the enzymes immobilized to MNPs using a magnet. The concentration of protein free in solution both before and after immobilization was measured using the BCA protein assay. MNPs with adsorbed protein were washed three times with the respective buffers and resuspended in 1 mL of 50-mM Tris–H2SO4 buffer at pH 7.5. The activity of immobilized DhlA was assayed after incubation (2 h at 30 °C on a rotary shaker) of the samples with 1,2-dichloroethane (5 mM) added from a stock solution in methanol using the colorimetric chloride activity assay and GC-MS. Subsequent immobilization experiments employed 1 mL of enzyme solution and 5 mg of MNPs (Fig. 2).
Covalent coupling of DhlA Histidine-tagged DhlA was covalently coupled to APS-silanated MNPs as summarized in Fig. 3. DhlA was modified with a heterobifunctional crosslinker, succinimidyl 4-hydrazinonicotinate acetone hydrazone (SANH) (Pierce), which contained an NHS moiety that is reactive towards primary amines containing amino acids of DhlA as well as a terminal hydrazide/hydrazine functional group that becomes
Fig. 3 Reaction scheme used for obtaining MNP-Es from aminosilane-coated MNPs. SANH converts primary amines to hydrazinopyridine moieties, and glutaraldehyde converts primary amines to aliphatic aldehyde moieties. These two moieties cross-link producing the final MNP-E congener
E
H2N
MNP
O N O
+ O
SANH
O
Silane coating
N
MNP
O O Si O
NH2
N H
N
1. Amidation 2. Deprotonation O
Glutaraldehyde activation
N H
E
O
MNP
O O Si O
N
H
H2O
N
H2N N H
1. Hydrazone Coupling O
MNP
O O Si O
N H
E
N N
N H
N
123
1016
Immobilization from cell lysate Recombinant DhlA-(SiAP)2-(His)6, (DhlA-(FeAP)3(His)6, and DhlA-(His)6 were immobilized directly from a clarified cell lysate (prepared using lysis buffer alone) onto GPS-modified SOL-DLC MNPs and iron oxide MNPs (see the recombinant dehalogenase expression section). The organic coating of GPS was made biocompatible (GPS-OH) by epoxide ring opening (see the alkoxysilane-coated MNPs section).
Protein quantification Immobilized protein was quantified using two different methods. A BCA assay was used to indirectly quantify immobilized protein by measuring the concentration of protein in solution before immobilization and in the supernatant following conjugation reactions. Using the method of Luo et al. (2006), protein was directly quantified in SDS-PAGE gels based on the principle that Coomassie blue fluoresces in the near-infrared region when bound to protein. Aliquots of 20 lL (100 lg of MNPs) were taken from samples of immobilized DhlA with 5 lL of 59 sample buffer and were prepared for SDS-PAGE as before. The entire sample was loaded onto a 12% Tris–HCl PAGE gel (BioRad, Hercules, CA). Bovine serum albumin (BSA) standards were also loaded onto the gel. Gels were stained and analyzed using the procedure of Luo et al. (2006). The gels were scanned using the ‘‘700’’ channel of an Odyssey infrared scanner (LI-COR, Lincoln, NE). The concentration of DhlA was determined relative to the loaded BSA standards.
Theoretical approximation of DhlA immobilization The number of protein molecules that could be immobilized onto the MNPs was estimated by calculating the sum of the total surface area of the MNPs added to the immobilization reaction using the manufacturer’s reported surface area of 15 m2/g MNPs and dividing by the cross-sectional area of one DhlA molecule, which was determined by
123
J Nanopart Res (2008) 10:1009–1025
measuring the diameter of the globular DhlA protein using the modeling program Insight II (Accelrys, San Diego, CA). 18
XgMNPs 1510g
nm2
p 2:402 nm2 ¼ Theoretical number of DhlA molecules bound
DhlA enzymatic activity assay The free enzyme activity assay, based upon the release of protons during the dehalogenation reaction, was performed using the method of Holloway and Trevors (1998) as modified by Marvanova et al. (2001) followed by use of the colorimetric phenol red pH indicator. Free enzyme was diluted 10 times in 50-mM Tris–H2SO4 at pH 7.5; 170 lL of assay mixture containing 10-mM DCA was added to 40 lL of enzyme solution in a microplate. Activity was followed at 550 nm with a Powerwave X Select microplate reader (Bio-Tek Instruments, Inc., Winooski, VT). The amount of protons produced was determined from a calibration curve prepared using hydrochloric acid standard solutions.
MNP-Dhla enzymatic activity assay DhlA-MNP conjugate samples were aliquoted into HPLC vials in Tris–H2SO4 at pH 7.5 and at a final concentration of *1 mg MNP/mL. DCA was added to a concentration of 10 mM. Samples were incubated with gentle inversion on a rocker at room temperature. Suspended MNP-DhlA conjugates were separated from solution using an external magnet and aliquots of 120 lL were taken at 0, 30, 60 and 120min time points for a colorimetric chloride assay (Bergmann and Sanik 1957) modified for use with a microplate reader. Aliquots of 40 lL of both 0.25-M ferric ammonium sulfate in 9-N nitric acid and mercurythiocyanate-saturated ethanol were added to 120 lL of sample and incubated 10 min. Chloride release was measured at 460 nm with a Powerwave X select microplate reader (Bio-Tek Instruments, Inc.). Free enzyme was heat inactivated in a boiling water bath for 2 min.
J Nanopart Res (2008) 10:1009–1025
Monitoring DCA reduction with GC/MS The degradation of DCA by DhlA was verified by measuring the DCA remaining in the samples after incubation with 10-mM DCA in HPLC vials. A 100lL aliquot of sample was removed by gas-tight syringe and added to 1 mL of Tris–H2SO4 at pH 7.5 in a 10-mL headspace vial. The samples were analyzed by static headspace GC/MS (HP 7694 Headspace Sampler, Agilent 6980 GC/MS, Santa Clara, CA). Vials were equilibrated for 10 min in a 70 °C oven and then injected into a ZB-624 column (30-m with a 5-m leading Guardian column, ID 0.25 mm, 1.4 lm) (Zebron, Newport Beach, CA). The GC cycle was comprised of a 6-min sample focusing at 50 °C, then a temperature gradient of 25 °C/min, and finally a hold at 230 °C for 4 min. A standard curve for a DCA dilution series was employed for quantification.
Results The MNPs were coated with silica using a two-step process involving a sol-gel and dense liquid coating, which was found by Liu et al. (1998) to be complete in its coverage of the surface while also being thin enough to prevent significant loss of magnetic susceptibility. In order to determine the completeness of the silica coverage, the SOL-DLC MNPs were incubated in dilute hydrochloric acid, and the amount of iron in solution was measured (data not shown). Scanning electron micrographs of SOL-DLC MNPs and iron oxide MNPs show that the size of the MNPs was not increased significantly after the coating process and resulted in a uniform shell (Fig. 4b). The SEM-EDS results confirmed the presence of the silica coating as seen by the large silicon peak appearing on the spectra (Fig. 4d) compared with the absence of a silicon peak in the EDS spectra for uncoated iron oxide beads onto which DhlA had been absorbed (Fig. 4c). Three different recombinant dehalogenases were expressed and purified by metal affinity chromatography. ESI-MS was used to verify the molecular masses of the purified recombinant dehalogenases. The measured molecular mass of DhlA-(His)6 was 39890.04 ± 4.62 Da (theoretical mass is 39876.30 Da). The molecular mass of the DhlA fusion protein with 39 affinity polypeptide for hematite [(DhlA-(FeAP)3-
1017
(His)6] was 43272.98 ± 5.96 Da (theoretical mass is 43261.43 Da). The measured mass of the DhlA fusion protein with 29 silica affinity polypeptides [DhlA(SiAP)2-(His)6] was 42788.36 ± 6.52 Da (theoretical mass is 42781.71 Da). Having determined that the correct fusion protein was being expressed, the activity of the recombinant dehalogenases was measured in order to determine whether the addition of the surface affinity polypeptide fusions affected the activity compared to histidine-tagged DhlA alone. The activity of the free recombinant DhlA samples was measured using the pH-dependent colorimetric assay. We determined that activity was not adversely affected by the additional surface affinity polypeptides (Table 1). The conditions for immobilization of DhlA by affinity adsorption were optimized for dehalogenases containing iron oxide and silica affinity peptides. Immobilization reactions were carried out at pH 6.5, 7.0, and 7.5 with the addition of Tween 20 and glycerol. Dehalogenase with histidine tag only and peroxidase were used as controls to compare nonspecific protein adsorption. Using this method we found that optimal conditions for adsorption of fusion proteins to MNPs entailed a 1-h incubation in 50-mM Tris–H2SO4 with 0.1% Tween 20 and 1% glycerol at pH 7.5 (data not shown). Recombinant DhlA was immobilized to the MNPs by nonspecific and affinity adsorption as well as by covalent linkage. The amount of protein bound and the activity of the immobilized protein were compared for each method (Tables 2 and 3). Less than 10% of the estimated theoretical maximum of horseradish peroxidase (HRP) and DhlA was nonspecifically bound to the uncoated iron oxide MNPs compared with *100% immobilization of DhlA(FeAP)3-(His)6 specifically adsorbed to iron oxide MNPs. The nonspecific binding of SOL-DLC MNPs was greater, with 62% of DhlA being bound and 37% immobilization of HRP; however, this level of binding was still less than DhlA-(SiAP)2-(His)6, which had approximately 100% binding when compared to the calculated theoretical value. The amount of DhlA that was covalently linked to the SOL-DLC MNPs was approximately 95% of the estimated theoretical amount as well. Even though the amount of protein bound by affinity adsorption and covalent linkage were comparable, the activity of the affinity-adsorbed protein was
123
1018
J Nanopart Res (2008) 10:1009–1025
A
C
B
D
Full scale counts: 1157 Au
Full scale counts: 1459 O
1400 1000
1200
1000
800
800
Au
600
Fe
600 400
Fe 400 C
O C 200
Fe
Au
Fe
Au
Si
200
Fe
Fe
N
0
0 0 1 2 Klm - 1 - H
3
4
5 6 keV
7
8
9
10
0 1 2 klm - 1 - H
3
4
5 6 keV
7
8
9
10
Fig. 4 SEM images and SEM-EDS results for both iron oxide and SOL-DLC MNPs. (a) Iron oxide MNPs; scale bar is 200 nm. (b) SOL-DLC MNPs; scale bar is 200 nm. (c) SEM-
EDS spectra of iron oxide MNPs. (d) SEM-EDS spectra of SOL-DLC MNPs
Table 1 Effect of affinity peptides and His-tag on free dehalogenase activity
significantly less than the covalently linked DhlAMNP congeners. The activity of the covalently linked DhlA-(His)6 was *118% of free DhlA-(His)6, while both DhlA-(FeAP)3-(His)6 and DhlA-(SiAP)2-(His)6 affinity-adsorbed proteins exhibited \3% activity when compared to the free enzyme in solution. To prevent DhlA denaturation during adsorption, an organic coating was introduced onto the inorganic MNP surfaces. The coating consisted of GPS, APS, or BSA. Finally, to make GPS and APS less reactive, the terminal epoxide ring of GPS was opened forming
Recombinant enzyme
Activitya,b (nmole min-1 mg-1) Day 1
Day 30
dhlA-(His)6
708 ± 25
319 ± 29
dhlA-(SiAP)2-(His)6
825 ± 28
637 ± 39
dhlA-(FeAP)3-(His)6
831 ± 24
519 ± 25
a
Colorimetric assay based upon proton production
b
Numbers represent average of three samples ± standard deviations
123
Numbers represent average measurements from 3–4 samples ± standard deviations
Activity based upon chloride ion product formation after 30-min incubation
51 ± 5
Activity was not measured for these samples because little or no protein was adsorbed as observed on SDS-PAGE gels c
b
a
\1
118 613 ± 52
1675 ± 44 10 ± 16
724 ± 122 94
133
1019
54 Sol-DLC DhlA-(His)6 Covalent linkage
79 ± 8 Fe2O3 DhlA-(FeAP)3-(His)6
59
NA
3 1424 ± 120 37 ± 9 Affinity adsorption
59 ± 16
58 Sol-DLC DhlA-(SiAP)2-(His)6
101
NA
NAc 60 \1 ± 4 Fe2O3 HRP
1
NAc
NA
NAc 54 5 ± 12 Fe2O3 DhlA-(His)6
9
NAc
NA
NAc 22 ± 6 Sol-DLC HRP
60
37
NA
NAc
c
Non-specific adsorption
54 34 ± 7 Sol-DLC DhlA-(His)6
Theoretical
62
NAc
% Free DhlA Freea,b Immobilizeda,b BCA
% Theoretical
DhlA activitya,b (nmole mg-1 min-1) DhlA immobilized (lg protein mg-1 MNPs) MNPs Protein Immobilization method
Table 2 Concentration and activity of recombinant DhlA immobilized onto MNPs
J Nanopart Res (2008) 10:1009–1025
a secondary alcohol (GPS-OH), and the APS amine group was inactivated by covalent linkage to a fourmonomer polyethylene glycol molecule (APS-PEG). The DhlA activity and protein adsorbed to treated MNP surfaces was compared (Table 3). The activity of affinity-adsorbed DhlA in the presence of BSA was less than 20% of free enzyme in solution; however, we did find that greater activity was retained when DhlA was adsorbed to the MNPs that had been treated with either GPS or APS. When DhlA tagged with affinity polypeptides was adsorbed onto MNPs whose surfaces had been modified with either inert GPS-OH or APS-PEG, the amount of protein immobilized by affinity adsorption was 60–100%, while nonspecific adsorption increased to 30–40%. The activity recovered was less than 50% of free enzyme activity. However, affinity-adsorbed DhlA immobilized in the presence of a GPS or APS organic coating retained 83–99% of free enzyme activity (Table 3). The quantity of protein immobilized in the presence of an organic coating was lower than amounts immobilized directly to the inorganic MNP surface by affinity adsorption. We also performed experiments to determine the feasibility of direct adsorption of DhlA fusion proteins from the E. coli cell lysate supernatant onto the MNPs and also to examine the cross-reactivity of the inorganic binding peptides for materials to which they should not exhibit affinity. The lysates from the cells expressing DhlA-(His)6, DhlA-(SiAP)2-(His)6 and DhlA-(FeAP)3(His)6 were incubated with both ferric oxide and SOL-DLC MNPs modified with an organic coating of GPS-OH (Fig. 5a). From these results it is clear that DhlA-(FeAP)3-(His)6 fusion was highly selective for binding both iron oxide and silica inorganic surfaces modified with GPS-OH (see the ESI-MS/MS results for molecular weight determination).
Discussion DhlA was selected for our studies because it is a wellcharacterized, globular, catabolic enzyme involved in the degradation of 1,2-dichloroethane (DCA), a U.S. Environmental Protection Agency priority pollutant and a suspected carcinogen. The crystal structure of DhlA has been determined along with its mechanism of action: DhlA does not require any cofactors and primarily catalyzes the dehalogenation of DCA to 2-
123
123 50% BSA None APS-PEG GPS-OH GPS APS
DhlA-(FeAP)3-(His)6 DhlA-(SiAP)2-(His)6
DhlA-(SiAP)2-(His)6
DhlA-(SiAP)2-(His)6
DhlA-(SiAP)2-(His)6
DhlA-(SiAP)2-(His)6
c
b
a
APS-PEG GPS-OH
DhlA-(His)6
DhlA-(His)6
Colorimetric activity assay based on chloride ion production
Colorimetric activity assay based upon proton production
Activity based upon product formation after 30-min incubation
Sol-DLC coated MNPs
Fe2O3 coated MNPs GPS-OH
10% BSA
DhlA-(FeAP)3-(His)6
APS-PEG
GPS-OH
DhlA-(FeAP)3-(His)6
DhlA-(His)6
APS-PEG
DhlA-(FeAP)3-(His)6
DhlA-(His)6
None
DhlA-(FeAP)3-(His)6
Fe2O3 coated MNPs
Sol-DLC coated MNPs
Coating
Coupling reactants
27
19
17
23
22
26
44
36
11 59
49
30
58
54
54
54
54
58
58
58
58
59 58
59
59
59
49
34
32
42
38
45
75
61
19 101
91
51
97
133
958c 320c 1424 ± 120c 2900b
73c 60c 37 ± 9c 1060b
2410b 2410b 2410b
391b 580b
2410 223b
425
b
635c
537c b
635c
631c
817
b
2900b
1980b
944b
876
1980b
1675 ± 44c
59 b
10 ± 16c
79
Freea
Immobilizeda
% Theoretical
BCA
Theoretical
DhlA activity (nmole mg-1 min-1)
Concentration of immobilized DhlA (lg protein mg-1 MNP)
Table 3 Concentration and activity of DhlA adsorbed onto differently treated MNP surfaces
24
16
9
18
83
99
34
37
18 3
8
33
44
\1
% Free enzyme
1020 J Nanopart Res (2008) 10:1009–1025
J Nanopart Res (2008) 10:1009–1025
A
1021 1
2
3
4
5
6
2
3
4
5
6
7
8
50 Kb 40 Kb 30 Kb 20 Kb
B
1
7
8
75 Kb 50 Kb 35 Kb 30 Kb 25 Kb
Fig. 5 Recombinant protein adsorbed onto GPS-OH modified iron oxide and SOL-DLC-coated MNPs. (a) Recombinant protein adsorbed directly from clarified lysate prepared in lysis buffer alone. Lanes 1 and 5: free DhlA-(FeAP)3-(His)6 lysate and DhlA-(His)6 lysate. Lanes 2–4: DhlA-(His)6, DhlA(FeAP)3-(His)6, and DhlA-(SiAP)2-(His)6 immobilized onto GPS-OH modified iron oxide MNPs. Lanes 6–8: DhlA-(His)6, DhlA-(FeAP)3-(His)6, and DhlA-(SiAP)2-(His)6 immobilized onto GPS-OH modified SOL-DLC MNPs as described in the
Method section. (b) Purified recombinant protein adsorbed onto GPS-OH modified iron oxide and SOL-DLC-coated MNPs. Lanes 1 and 5: free DhlA-(FeAP)3-(His)6 and DhlA(His)6 purified protein. Lanes 2–4: DhlA-(His)6, DhlA(FeAP)3-(His)6, and DhlA-(SiAP)2-(His)6 immobilized onto GPS-OH modified iron oxide MNPs. Lanes 6–8: DhlA-(His)6, DhlA-(FeAP)3-(His)6, and DhlA-(SiAP)2-(His)6 immobilized onto GPS-OH modified SOL-DLC MNPs. See ESI/MS-MS results for recombinant dehalogenase molecular weights
chloroethanol (Keuning et al. 1985; Janssen et al. 1989; Schanstra et al. 1993; Janssen 2004). New and improved technologies to eliminate this anthropogenic chemical from the environment are needed and are being actively sought. The application of DhlA bound to MNPs should provide for the precise delivery and recovery of the enzyme from deep non-aqueous phase liquid (DNAPL) contaminated zones in aquifers. In addition to our proposed application for remediation of DNAPL contamination in aquifers, DhlA has also been used as an industrial biocatalyst (Swanson 1999). Studies are also in process to expand the substrate range and enhance the catalytic properties of DhlA (Janssen 2004). Our results confirm that we have conferred DhlA with the ability to specifically bind to the surface of both iron oxide MNPs and SOL-DLC MNPs by
fusing the enzyme with the surface-specific peptide affinity tags. The immobilization results (Table 2) indicate that DhlA tagged with either silica or iron oxide affinity peptides is adsorbed onto MNP surfaces at a higher rate than DhlA with a His-tag alone (particularly for adsorption onto iron oxide particles). The degree of immobilization is 100% or more of our calculated expected amount of 59 lg DhlA-(FeAP)3-(His)6/mg MNP and 58 lg DhlA(SiAP)2-(His)6/mg MNP. Non-specific binding of HRP and (to an even greater extent) DhlA-(His)6 to the SOL-DLC MNPs was higher than non-specific binding to iron oxide MNPs. This trend was also observed for our experiments where either DhlA(FeAP)3-(His)6 or DhlA-(SiAP)2-(His)6 were immobilized directly from the clarified cell lysate (Fig. 5a). The ability to immobilize DhlA fusions directly from
123
1022
the cell lysate demonstrates that expressed DhlA with highly charged MNP affinity fusion tags could outcompete other endogenous proteins in solution for binding onto MNPs, particularly iron oxide MNPs. DhlA-(FeAP)3-(His)6 adsorbed selectively onto GPS-OH modified and unmodified iron oxide MNPs resulting in two bands on the SDS-PAGE gel (Fig. 5a, lane 3). Recombinant protein adsorption onto GPS-OH modified SOL-DLC MNPs resulted in multiple bands, indicating lower specificity towards this surface (Fig. 5b, lanes 6–8). The SDS-PAGE gel of purified recombinant protein adsorbed to GPS-OH modified iron oxide and SOL-DLC MNPs suggests that under the immobilization conditions used, binding of DhlA-(SiAP)2-(His)6 and DhlA-(His)6 to GPSOH modified iron oxide MNPs is blocked indicating that these two proteins do not have specific binding capability for this surface (Fig. 5b, lanes 2–4). Comparing results from immobilization directly from the lysate and adsorption of purified recombinant protein, it is clear that the method for immobilization directly from the lysate could be further optimized using conditions that are more stringent as well as controlled protein concentrations to promote the selective binding of a single protein (Fig. 5a and b, lanes 2–4). The results also indicate that the silica coating and buffer system we used reduced the specificity or binding strength of the silica-affinitypeptide-containing dehalogenase, allowing adsorption of several other proteins from the cell lysate. Endogenous proteins adsorbed from the clarified cell lysate may be rich in hydroxyl groups and imidazolecontaining amino acids and have high cationic charge, the characteristics known to be required for affinity towards silica (Naik et al. 2002; Sarikaya et al. 2003). The observation that DhlA-(His)6 alone had higher affinity towards silica-coated MNPs than to iron oxide MNPs points towards the importance of histidine residues for protein affinity towards the silica surface; the silica affinity peptide sequence contains only one fewer His residue per repeat (Fig. 5a and b, lane 6). Also, the silica affinity tag fused to the dehalogenase contained only two repeats of the peptide sequence, while the iron affinity tag contained three repeats. This might have caused lower binding affinity of the silica affinity peptide as it was found for a gold-binding peptide, which required at least three repeats for high affinity binding (Brown 1997). Finally, we now know that
123
J Nanopart Res (2008) 10:1009–1025
several factors, including the number of affinity tag oligopeptide repeats, MNP surface properties (charge, etc.), and specificity of affinity peptide for surfaces other than the one used for selection of the particular affinity peptide, can impact affinity and binding of affinity tags to surfaces. This knowledge can be applied to further optimize the conditions to achieve the desired selectivity. Other research has shown that the strength of binding of some affinity peptides is dependent on surface charge of the inorganic material. For example, the mechanism of adsorption of a titaniumbinding peptide was found to be due to double electrostatic bonding between the titanium surface and charged amino acid residues (Hayashi et al. 2006). By immobilizing ferritin with the titanium affinity peptide to the probe of an atomic force microscope (AFM), Hayashi et al. (2006) were able to determine the strength of binding to various surfaces. The binding strength to a silica surface was determined to be half the strength of the binding to titanium due to the fact that the surface of silica is negatively charged with deprotonated hydroxyl groups whereas the surface of titanium has both positively and negatively charged residues due to the presence of both protonated and deprotonated hydroxyl groups. Also, the surface charge properties can be manipulated by using different buffer systems as an effective means to enhance protein adsorption; for example, phosphates were found to suppress maghemite surface charge variation due to adsorption, while formate-based buffers kept maghemite nanoparticle surfaces positively charged (Li et al. 2006). Furthermore, because the peptides isolated for inorganic binding capability should have specific affinity for the material for which they were selected, it can be expected that the affinity peptides will display decreased binding strength and selectivity for materials of the same chemical composition but differing physical properties (i.e., size, morphology, crystal structure). It is also likely that the affinity peptides may exhibit decreased binding affinity for materials of different chemical composition. Therefore, these inorganic binding peptide sequences would need to be optimized for binding to the specific material used as suggested by Sarikaya et al. (2003). The addition of the silica or iron oxide affinity peptide tags to DhlA did not negatively impact the activity of free DhlA affinity peptide fusion proteins
J Nanopart Res (2008) 10:1009–1025
in solution (Table 1). The slight increase in activity of expressed DhlA-(FeAP)3-(His)6 and DhlA(SiAP)2-(His)6 could be due to conformational changes caused by different folding characteristics of tagged DhlA. In addition, changes in protein shape could have changed substrate diffusion and its binding characteristics and thus enzymatic activity. However, the reduced activity of adsorbed recombinant DhlA as compared with covalently linked DhlA (Table 2) demonstrates the need to prevent strong electrostatic or hydrophobic interactions with solid inorganic surfaces to preserve the protein’s native conformation (Gray 2004). The recovery of activity of DhlA adsorbed onto the surfaces of MNPs treated with organic silanes, APS, or GPS (Table 3) could be due to the ability of the organic coating to act as a barrier between the protein molecule and MNP surface. Incubating iron oxide-coated MNPs with BSA as a chaperone protein prior to DhlA adsorption and at a concentration that could provide 50% surface coverage resulted in a moderate activity increase from 5 to 18% (compared to the free enzyme). A possible explanation for why BSA does not increase DhlA activity is that it only transiently associates with the iron oxide MNPs. Affinity-peptide-tagged DhlA (DhlA-AP) adsorbed to MNPs organically coated with APS or GPS, which contain terminal primary amine or epoxide groups, appeared to exhibit significantly higher activity that was comparable to the free enzyme in solution. The DhlA-AP adsorbed to MNPs with APS-PEG and GPS-OH coatings exhibited \50% of the activity of free dehalogenase in solution. The reason for the elevated activity of DhlA-AP adsorbed to the MNPs covered with the reactive APS and GPS coatings may be the potential formation of Schiff’s bases between the protein and the coating functional groups. It is important to note that while these coatings can prevent nonspecific protein interactions, we also observed an increase in binding of our control protein DhlA-(His)6 and a subsequent increase in activity of the control as well. Furthermore, the amount of DhlA affinity-adsorbed to the coated MNPs was reduced, especially for DhlA(SiAP)2-(His)6 and DhlA-(FeAP)3-(His)6 on inactivated GPS-OH-coated iron oxide MNPs. Even though organic coating of the MNPs preserved enzyme activity, the coatings may have interfered with the specificity and binding strength of the affinity peptides (Fig. 5a, lanes 6–8).
1023
While our results show that the addition of an organic coating to the MNP surface can help to preserve DhlA activity, other research has focused more closely on examining the factors that affect the structure and function of proteins adsorbed onto nanoparticles (Asuri et al. 2006a). Looking at nanoparticle surface chemistry and topology, Roach et al. (2006) found that the globular protein BSA was more structurally stable on hydrophilic nanoparticles that were small and therefore had high surface curvature, whereas BSA lost secondary structure on particles that were either hydrophobic or were large, simulating a ‘‘pseudo-flat’’ surface. In addition, Asuri et al. (2006b) found that proteins were more stable upon immobilization onto the highly curved surface of single-walled carbon nanotubes than when immobilized on flat graphite flakes. The authors hypothesize that protein stabilization on highly curved surfaces is due to the prevention of lateral protein–protein interactions that lead to protein denaturation. The method we have developed employing surface-specific affinity tags for the adsorption of enzymatic proteins to MNPs has potential for broad application in many areas of nanotechnology due to its simplicity and specificity. This method could potentially be used for the self-assembly of bio-NP hybrids for use in construction of nanodevices and nanosensors (Gray 2004; Astier et al. 2005). The development of self-assembly is important for the progress of the nanotechnology field and for effective and efficient construction of bio-NP hybrids at industrial scales (Whitesides and Grzybowski 2002; Zhang 2003a). We also believe that the procedures described in this paper can simplify immobilization of many other proteins to inorganic nanoparticle or to inorganic ‘‘macro’’ surfaces. Future research should look into not only the specificity and strength of affinity peptide fusion proteins for a given surface/material type and morphology and the subsequent mechanism of that interaction, but also the surface chemistry, conditions, and nanoparticle topology necessary to maintain protein structure and function. Acknowledgements This research was funded by grants from the M. J. Murdock Charitable Trust (grant #2005123JVZ), the Idaho EPSCoR Program (grant #EPS0132626), and the Idaho INBRE Program (NIH grant #P20 RR016454). We express appreciation to Franklin Bailey
123
1024 from the Electron Microscopy Center at the University of Idaho; we thank Cornelia Sawatzky for editorial assistance.
References Alcalde M, Ferrer M, Plou FJ, Ballesteros A (2006) Environmental biocatalysis: from remediation with enzymes to novel green processes. Trends Biotechnol 24:281–287 Astier Y, Bayley H, Howorka S (2005) Protein components for nanodevices. Curr Opin Chem Biol 9(6):576–584 Asuri P, Bale SS, Karajanagi SS, Kane RS (2006a) The protein-nanomaterial interface. Curr Opin Chem Biol 17:562–568 Asuri P, Karajanagi SS, Yang HC, Yim TJ, Kane RS, Dordick JS (2006b) Increasing protein stability through control of the nanoscale environment. Langmuir 22:5833–5836 Atanasijevic T, Shusteff M, Fam P, Jasanoff A (2006) Calcium-sensitive MRI contrast agents based on superparamagnetic iron oxide nanoparticles and calmodulin. Proc Natl Acad Sci USA 103:14707–14712 Bergmann JG, Sanik J Jr (1957) Determination of trace amounts of chlorine in naphtha. Anal Chem 29:241–243 Brown S (1992) Engineered iron oxide-adhesion mutants of the Escherichia coli phage lambda receptor. Proc Natl Acad Sci USA 89:8651–8655 Brown S (1997) Metal-recognition by repeating polypeptides. Nat Biotechnol 15:269–272 Bruce IJ, Sen T (2005) Surface modification of magnetic nanoparticles with alkoxysilanes and their application in magnetic bioseparations. Langmuir 21:7029–7035 Dyal A, Loos K, Noto M, Chang SW, Spagnoli C, Shafi K et al (2003) Activity of Candida rugosa lipase immobilized on c-Fe 2 O 3 magnetic nanoparticles. J Am Chem Soc 125:1684–1685 Fernandes EGR, Queiroz AAAD, Abraham GA, Roma´n JS (2006) Antithrombogenic properties of bioconjugate streptokinase-polyglycerol dendrimers. J Mater Sci: Mater Med 17:105–111 Gray JJ (2004) The interaction of proteins with solid surfaces. Curr Opin Struct Biol 14:110–115 Gupta AK, Gupta M (2005) Synthesis and surface engineering of iron oxide nanoparticles for biomedical applications. Biomaterials 26:3995–4021 Hansen MJ, Natale N, Kornacki P, Paszczynski AJ (2006) Conjugating magnetic nanoparticles for application in health and environmental research. Paper presented at the 48th annual Idaho Academy of Science Meeting and Symposium, Moscow, Idaho, 4 June 2006 Harris TJ, von Maltzahn G, Derfus AM, Ruoslahti E, Bhatia SN (2006) Proteolytic actuation of nanoparticle selfassembly. Angew Chem Int Ed Engl 45:3161–3165 Hayashi T, Sano KI, Shiba K, Kumashiro Y, Iwahori K, Yamashita I, Hara M (2006) Mechanism underlying specificity of proteins targeting inorganic materials. Nano Lett 6:515–519 Holloway P, Trevors JT (1998) A colorimetric assay for detecting haloalkane dehalogenase activity. J Microbiol Methods 32:31–36
123
J Nanopart Res (2008) 10:1009–1025 Ito A, Shinkai M, Honda H, Kobayashi T (2005) Medical application of functionalized magnetic nanoparticles. J Biosci Bioeng 100:1–11 Janssen DB (2004) Evolving haloalkane dehalogenases. Curr Opin Chem Biol 8:150–159 Janssen DB, Pries F, van der Ploeg J, Kazemier B, Terpstra P, Witholt B (1989) Cloning of 1,2-dichloroethane degradation genes of Xanthobacter autotrophicus GJ10 and expression and sequencing of the dhlA gene. J Bacteriol 171:6791–6799 Jordan BJ, Hong R, Gider B, Hill J, Emrick T, Rotello VM (2006) Stabilization of a-chymotrypsin at air-water interface through surface binding to gold nanoparticle scaffolds. Soft Matter 2:558–560 Katz E, Willner I (2004) Integrated nanoparticle-biomolecule hybrid systems: synthesis, properties, and applications. Angew Chem Int Ed Engl 43:6042–6108 Keuning S, Janssen DB, Witholt B (1985) Purification and characterization of hydrolytic haloalkane dehalogenase from Xanthobacter autotrophicus GJ10. J Bacteriol 163:635–639 Koneracka´ M, Kopcansky´ P, Timko M, Ramchand CN (2002) Direct binding procedure of proteins and enzymes to fine magnetic particles. J Magn Magn Mater 252:409–411 Kouassi GK, Irudayaraj J, McCarty G (2005a) Activity of glucose oxidase functionalized onto magnetic nanoparticles. Biomagnet Res Technol 3:1 Kouassi GK, Irudayaraj J, McCarty G (2005b) Examination of cholesterol oxidase attachment to magnetic nanoparticles. J Nanobiotechnol 3:1 Li D, Teoh WY, Selomulya C, Mal R (2006) Designing magnetic nanoparticles for bioseparation. Paper presented at the American Institute for Chemical Engineers (AIChE) Spring National Meeting, Orlando, FL, 23 April 2006 Liu WT (2006) Nanoparticles and their biological and environmental applications. J Biosci Bioeng 102:1–7 Liu Q, Xu Z, Finch JA, Egerton R (1998) A novel two-step silica-coating process for engineering magnetic nanocomposites. Chem Mater 10:3936–3940 Luo S, Wehr NB, Levine RL (2006) Quantitation of protein on gels and blots by infrared fluorescence of coomassie blue and fast green. Anal Biochem 350:233–238 Marczenko Z (1976) Spectrophotometric determination of elements. Halsted Press, New York Marvanova S, Nagata Y, Wimmerova M, Sykorova J, Hynkova K, Damborsky J (2001) Biochemical characterization of broad-specificity enzymes using multivariate experimental design and a colorimetric microplate assay: characterization of the haloalkane dehalogenase mutants. J Microbiol Methods 44:149–157 Naik RR, Brott LL, Clarson SJ, Stone MO (2002) Silica-precipitating peptides isolated from a combinatorial phage display peptide library. J Nanosci Nanotechnol 2:95–100 Roach P, Farrar D, Perry CC (2006) Surface tailoring for controlled protein adsorption: effect of topography at the nanometer scale and chemistry. J Am Chem Soc 128:3939–3945 Rossi LM, Quach AD, Rosenzweig Z (2004) Glucose oxidasemagnetite nanoparticle bioconjugate for glucose sensing. Anal Bioanal Chem 380:606–613
J Nanopart Res (2008) 10:1009–1025 Sarikaya M, Tamerler C, Jen AKY, Schulten K, Baneyx F (2003) Molecular biomimetics: nanotechnology through biology. Nat Mater 2:577–585 Savage N, Diallo MS (2005) Nanomaterials and water purification: opportunities and challenges. J Nanopart Res 7:331–342 Schanstra JP, Rink R, Pries F, Janssen DB (1993) Construction of an expression and site-directed mutagenesis system of haloalkane dehalogenase in Escherichia coli. Protein Expr Purif 4:479–489 Swanson PE (1999) Dehalogenases applied to industrial-scale biocatalysis. Curr Opin Biotechnol 10:365–369
1025 Tratnyek PG, Johnson RL (2006) Nanotechnologies for environmental cleanup. Nano Today 1:44–48 Whitesides GM, Grzybowski B (2002) Self-assembly at all scales. Science 295:2418–2421 Zawadzka AM, Crawford RL, Paszczynski AJ (2006) Pyridine2,6-bis(thiocarboxylic acid) produced by Pseudomonas stutzeri KC reduces and precipitates selenium and tellurium oxyanions. Appl Environ Microbiol 72:3119–3129 Zhang S (2003a) Fabrication of novel biomaterials through molecular self-assembly. Nat Biotechnol 21:1171–1178 Zhang W (2003b) Nanoscale iron particles for environmental remediation: an overview. J Nanopart Res 5:323–332
123
