Overexpression of microRNA OsmiR397 improves

letters

Overexpression of microRNA OsmiR397 improves rice yield by increasing grain size and promoting panicle branching

© 2013 Nature America, Inc. All rights reserved.

Yu-Chan Zhang1, Yang Yu1, Cong-Ying Wang1, Ze-Yuan Li1, Qing Liu1, Jie Xu2, Jian-You Liao1, Xiao-Jing Wang2, Liang-Hu Qu1, Fan Chen3, Peiyong Xin3, Cunyu Yan3, Jinfang Chu3, Hong-Qing Li2 & Yue-Qin Chen1 Increasing grain yields is a major focus of crop breeders around the world. Here we report that overexpression of the rice microRNA (miRNA) OsmiR397, which is naturally highly expressed in young panicles and grains, enlarges grain size and promotes panicle branching, leading to an increase in overall grain yield of up to 25% in a field trial. To our knowledge, no previous report has shown a positive regulatory role of miRNA in the control of plant seed size and grain yield. We determined that OsmiR397 increases grain yield by downregulating its target, OsLAC, whose product is a laccaselike protein that we found to be involved in the sensitivity of plants to brassinosteroids. As miR397 is highly conserved across different species, our results suggest that manipulating miR397 may be useful for increasing grain yield not only in rice but also in other cereal crops. Rice yield is a complex trait that is directly associated with grain size and with panicle number, the number of grains per panicle1. Although several genes have been found to regulate these traits2–8, our knowledge of the gene networks that control rice yield is still limited. Exploring new genes that modulate these traits would help us better understand the relevant molecular mechanisms and would also facilitate the breeding of new varieties with higher yields. miRNAs, a class of abundant small noncoding RNAs, have been identified as important regulators of gene expression in both plants and animals and are involved in many aspects of plant development, including the modulation of plant agricultural traits9. Two recent studies reported that OsmiR156 could negatively control the number of panicle branches and grain yield10,11. These observations suggest a role for miRNAs in controlling rice yield. However, miRNAs that positively regulate grain size, grain number and grain yield have not been reported. In the current study, we characterized an miRNA, OsmiR397, which was found to be associated with increased grain size, more rice panicle branching and higher grain productivity. We also elucidated the molecular mechanisms by which OsmiR397 increased grain yield. This miRNA downregulated the expression of its target gene,

OsLAC, which then affected the sensitivity of plants to brassinosteroids. These results should be useful for breeding high-yield crops through genetic engineering. We initially screened rice seeds to identify expressed miRNAs. Several miRNAs, especially OsmiR397, which is conserved across different species, were found to be preferentially highly expressed in rice seeds but downregulated during post-embryonic development12–14. We hypothesized that the expression of this miRNA in the seed could contribute to regulation of seed development or other agronomic traits. To evaluate the effect of OsmiR397 on rice grain traits, we generated overexpression (OX) lines in which expression of either OsmiR397a or OsmiR397b, the two isoforms of OsmiR397, was driven by the constitutively active 35S promoter (Fig. 1a). RNA blot hybridization showed that the expression of miR397 was elevated to varying degrees in these OXmiR397 transgenic lines (Fig. 1b). The OXmiR397 transgenic plants had strongly nodding (that is, drooping) panicles, which indicated an increased grain weight or panicle size, during ripening and grew taller than wild-type plants (Fig. 1a). We measured grain size and found that, compared with the wild-type plants, OXmiR397b transgenic lines showed a substantial increase in grain length (12.4%, P < 0.01) and grain width (11.7%, P < 0.05) and a slight increase in grain thickness (2.0%) (Fig. 1c,d and Supplementary Fig. 1a). Seeds of OXmiR397a lines were also enlarged in size, but were slightly smaller than seeds from OXmiR397b lines (Supplementary Fig. 1a). We also evaluated 1,000-grain weight and observed a substantial increase (7.4%/13.4% for OXmiR397a/b, respectively, P < 0.001) (Fig. 1e and Table 1). Taken together, these results suggest that overexpression of OsmiR397 increases the grain size and weight significantly. In addition to the grain size and weight, we also examined other yield-related traits1 in these OXmiR397 transgenic lines. We observed an increase in the number of primary and secondary branches and effective grains per main panicle (Fig. 1f,g and Supplementary Fig. 1b,c), accompanied by a slight increase (3.8% and 6.2%) in the length of the primary panicle in all OXmiR397a and OXmiR397b lines, respectively (Supplementary Fig. 1d). Furthermore, the OXmiR397a/b plants had slightly reduced tiller

1Key

Laboratory of Gene Engineering of the Ministry of Education, State Key Laboratory for Biocontrol, School of Life Science, Sun Yat-Sen University, Guangzhou, PR China. 2Guangdong Provincial Key Laboratory of Biotechnology for Plant Development, College of Life Sciences, South China Normal University, Guangzhou, PR China. 3National Center for Plant Gene Research, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, PR China. Correspondence should be addressed to Y.-Q.C. ([email protected]) or H.-Q.L. ([email protected]). Received 4 April; accepted 26 June; published online 21 July 2013; doi:10.1038/nbt.2646

nature biotechnology advance online publication

letters a

b

WT

3-3

6-1

4-6

14-3

19-1

OXmiR397a WT

OXmiR397b

OXmiR397a

OXLAC

c WT OXmiR397a

tRNA WT

5-1

9-3

10-5

12-3 14-3

7-1

OXLAC

OXmiR397b

OXmiR397b

tRNA

OXmmiR397 WT

2-2

5-1

6-5

12-6 15-3

d

21-3

OXmmiR397 tRNA 36 34 32 30 28 26 24 22 20 18 16 14 12 10 8 6 4 2 0

** ****

*

f

** ****

WT

g

OXmiR397b

160

** **

iR m Xm

OXmmiR397

WT

OXmiR397a

OXmiR397b

OXLAC

No. of effective grains (per main panicle)

7 39

7b 39 iR

Xm O

O

T W

39

iR Xm

7a

140

O

OXLAC

** ** *

** **

120 100 80 60 40 20

39

7

7b

iR

39

m

iR

Xm

Xm

O

O

T

W

39

iR

Xm

7a

0 Figure 1 Phenotypes of OXmiR397 and OXLAC transgenic rice plants. (a) Gross morphology of wild-type, OXmiR397a, OXmiR397b and OXLAC transgenic plants. Scale bars, 40 cm. The upper panels of each image are magnifications of the area in the indicated square. Scale bars, 5 cm. (b) RNA hybridization of miR397 in T3 (3rd generation of transgenic lines) OXmiR397a, OXmiR397b and mutant miR397 in T3 OXmmiR397 transgenic lines. tRNA was used as control. Three OXmiR397a lines (4-6, 14-3 and 19-1), four OXmiR397b lines (7-1, 9-3, 10-5 and 14-3) and three OXmmiR397 lines (6-5, 15-3 and 21-3) were used in this study. (c) Grains (grains with hulls) (left) and brown rice grains (hulled grains) (right) of wild-type and transgenic plants. Scale bars, 3 mm. (d) Magnifications of the brown grains of the wild-type, OXmiR397b and OXLAC plants. Scale bar, 3 mm. (e) The 1,000-grain weight of the wild-type plants and the OXmiR397a, OXmiR397b and OXmmiR397 transgenic plants. (f) The panicle morphologies of the wild-type and the transgenic plants. Scale bars, 10 cm. (g) The number of effective grains per main panicle. From left to right: gray bar, wild-type plants; blue bars, OXmiR397a 4-6, 14-3 and 19-1 transgenic lines; pink bars, OXmiR397b 7-1, 9-3, 10-5 and 14-3 transgenic lines; yellow bars, OXmmiR397 6-5, 15-3, and 21-3 transgenic lines. Values in e,g are the means ± s.d. (f, n = 3 replicates; g, n = 60 plants). Significant differences were identified at the 5% (*) and 1% (**) probability levels using Student’s t-test.

O


1,000-grain weight (g)

e

numbers (8.3 ± 0.2/8.2 ± 0.4, respectively) compared with wild-type of vascular bundles (Supplementary Fig. 3b). The OXmiR397a/b plants (8.5 ± 0.7) and headed earlier than the wild-type plants by lines had 14.0 ± 0.8/13.3 ± 1.3 large vascular bundles (LV) and 26.3 ± ~1 week (Supplementary Fig. 2), which would reduce the waste 2.8/29.8 ± 2.9 small vascular bundles (SV) on average, with a higher of photosynthetic production by the later tillers and shorten the number than the wild-type plants (12.0 ± 1.8 (LV) and 24.0 ± 3.1 planting cycle. To observe the actual grain yield in the OXmiR397 (SV), respectively) (Supplementary Table 2). Thus, we concluded plants, we conducted a plot field experiment in Beijing (40°02′N, that miR397 affects vascular bundle formation in the peduncle and 116°02′E). Overall, the OXmiR397a/b plants increased the grain yield consequently increases the peduncle diameter, which may account by 17.0%/24.9%, respectively, in the test plot (Table 1). These results for the increased panicle branching and grain number. indicated that OsmiR397 substantially enhanced grain yield in rice. The full rice grain (grain with hull) is mainly made up of a spikelet We observed no significant differences between WT and OXmiR397 hull and an endosperm. The size of a grain is restricted by the size of plants based on six traits measuring grain quality (Supplementary its spikelet hull and we indeed observed an enlarged endosperm in Table 1), suggesting that the overexpression of OsmiR397 may not the brown rice grains (hulled grains) of OXmiR397 plants (Fig. 1c,d). influence the grain’s cooking and eating quality traits. Therefore, the spikelet hulls just before flowering and the mature To further understand the mechanism by which OsmiR397 endosperm were analyzed to evaluate the effect of OsmiR397 on the increases the number of grains and panicle branches, we analyzed spikelet hull size and the cell area of the endosperm. The spikelet hulls the peduncle vascular bundles because previous reports have suggested that the number of vascular bundles in the peduncle corre- Table 1 Yield of wild-type, OXmiR397 and OXmmiR397 plants grown in paddies WT OXmiR397a OXmiR397b OXmmiR397 sponds to the panicle branches and the grain Traits 26.8 ± 0.9 28.8 ± 1.0 30.4 ± 0.7 26.3 ± 1.1 number15,16. Consistent with the increased 1,000-grain weight (g) (P < 0.001) (P < 0.001) number of panicle branches, the peduncle Panicles per plot 542.1 ± 42.1 528.2 ± 16.0 523.4 ± 25.8 534.7 ± 21.9 diameter in OXmiR397a/b lines was increased Yield per plot (kg) 1.85 ± 0.20 2.16 ± 0.16 2.31 ± 0.11 1.80 ± 0.25 (Supplementary Fig. 3a). We prepared trans(P = 0.011) – 17.0 24.9 0 verse sections of the internode immediately Yield increase over WT (%) below the neck node and counted the number Values shown are the means ± s.d. (n = 4 plots). Significant differences were identified using Student’s t-test.

advance online publication nature biotechnology

a

j CDS

Relative expression of OsLAC

ATG

9/13 Os05g38420 671

d

0.6 0.4 0.2 0

of the OXmiR397a/b plants were longer and wider than those of wildtype plants (Supplementary Fig. 3c,d). Cross-sections of spikelet hulls (Supplementary Fig. 3e,f) and mature grains (Supplementary Fig. 3i) from the OXmiR397 lines revealed that OXmiR397 lines had more outer parenchyma cells in the grain hull with similar cell length (Supplementary Fig. 3g,h) than the wild-type plants, whereas the endosperm cell area was smaller than in wild-type plants (Supplementary Fig. 3j). These results suggest that the enlarged grain hull and endosperm size, which led to an increase in the grain size and grain weight in the OXmiR397 lines, mainly resulted from cell division but not cell expansion. It is well known that miRNAs exert their functions on the development of organisms through their downstream targets9,17. To determine the molecular mechanism by which OsmiR397 regulates development in vivo, we investigated its downstream targets. Previous studies have predicted that miR397 targets laccase (LAC) in rice, Arabidopsis thaliana, tobacco and Populus trichocarpa18, and the reported target for OsmiR397 is LOC_Os05g38420 (OsLAC)19. To further validate the target, we mapped the OsmiR397-directed cleavage sites of OsLAC using RNA ligase–mediated rapid amplification of cDNA ends (RLM-RACE). The result showed that cleavage occurred between the 10th and 11th base pair of the OsmiR397 target site, indicating that OsLAC can be precisely cleaved in vivo in a process involving OsmiR397 (Fig. 2a). We then investigated the spatial expression patterns of OsmiR397 and OsLAC in various rice organs using β-glucuronidase (GUS) activity analysis. This analysis revealed that both OsmiR397 and OsLAC were expressed mainly in the young panicles and grains (Fig. 2b–d). We carried out RNA in situ hybridization to examine their expression in the inflorescence meristem. Both OsmiR397a/b and OsLAC were expressed in the primordia of the panicle branches during the development of the inflorescence meristem (Fig. 2e–i). Although the spatial expression patterns were similar, OsmiR397a/b negatively nature biotechnology advance online publication

g

h

i

39

7

7b 39

O Xm

90 80 70 60 50 40 30 20 10

AC

W

T

0 XL

f

100

O

e

iR

iR

k

iR

c

0.8

W T 39 7a

b

-5′ -5′

1.0

m

3′3′-

miR397a miR397b

1.2

3′-UTR

O Xm

5′-UTR

O Xm

Figure 2 Confirmation of OsmiR397-mediated downregulation of OsLAC and the expression patterns of OsmiR397 and OsLAC. (a) The OsmiR397 cleavage site in the OsLAC mRNA was determined by RNA ligase–mediated 5′-RACE in wild-type plants. (b–d) The spatial expression pattern analysis of OsmiR397a (b), OsmiR397b (c) and OsLAC (d) in young panicles and grains by GUS staining. Scale bars, 2 mm. (e–i) In situ hybridization of OsmiR397 (e) and OsLAC (f) during panicle development in wild-type plants. OsFON1 was used as a positive control (g), (h) is the negative control for OsmiR397, and (i) is a sense probe for OsLAC. Scale bars, 200 µm. (j) Relative expression levels of OsLAC mRNA in wildtype and T3 transgenic plants which were determined by qRT-PCR. From left to right: gray bar, wild-type plants; blue bars, OXmiR397a 4-6, 14-3 and 19-1 transgenic lines; pink bars, OXmiR397b 7-1, 9-3, 10-5 and 14-3 transgenic lines; yellow bars, OXmmiR397 6-5, 15-3, and 21-3 transgenic lines. (k) Relative expression levels of OsLAC in wild-type and T3 OXLAC transgenic plants. From left to right: gray bar, wild-type plants; green bars, OXLAC 1-1, 2-1, 4-1 and 12-1 transgenic lines. Actin2 was used as the reference gene for qRT-PCR. Values are the means ± s.d. j,k, n = 3 replicates.



letters

regulated OsLAC (Figs. 1b and 2j). In OXmiR397b transgenic lines having higher levels of OsmiR397 expression than that in the OXmiR397a lines, the expression of OsLAC was more severely suppressed than in the OXmiR397a plants (Fig. 2j). These results suggest that the expression level of OsLAC is dependent on the level of OsmiR397 through an OsmiR397-directed cleavage mode in vivo. Because OsmiR397 was found to lead to an increase in grain size and grain number per panicle, we evaluated the effect of ectopic expression of OsLAC. We hypothesized that mutations in the site in OsLAC targeted by OsmiR397 would lead to a decrease in grain productivity. Therefore, we generated transgenic plants (OXmLAC) carrying an OsmiR397-resistant OsLAC gene (mLAC) that contained six mismatches to the site targeted by OsmiR397 but did not introduce any amino acid changes. The mismatches introduced in the OXmLAC lines had a lethal phenotype, and all of the lines failed to advance past the seedling stage (Supplementary Fig. 4a). We also overexpressed OsLAC using the constitutively active 35S promoter, resulting in 35S::LAC (OXLAC) lines (Fig. 1a). Of the OXLAC lines, only four survived. qRT-PCR analysis of OsLAC mRNA expression in these transgenic lines showed that the level of OsLAC mRNA increased substantially in the OXLAC transgenic lines (Fig. 2k). Similar to the OXmLAC transgenic plants, some of the OXLAC plants also had lethal defects (Fig. 3a). Furthermore, OXLAC plants had a semi-sterile phenotype, and only some of the plants produced mature grains (Fig. 3b). We hypothesized that the phenotypes of the OXmiR397 transgenic lines might be attributable to the altered expression level of OsLAC. As expected, in contrast to the grain size of OXmiR397 transgenic lines, the grain size of the OXLAC lines was smaller than that of the wild-type plants (Fig. 1c,d and Supplementary Fig. 4c), and the 1,000-grain weight decreased significantly (−32.2%, P < 0.001) (Fig. 3c). In addition, the main panicle length, the number of primary and secondary branches, and grains per main panicle decreased notably in all the OXLAC lines (Fig. 3d and

letters a

b

c

d


No. of effective grains (per main panicle)

Figure 3 Mechanism analysis of OsmiR397140 30 mediated OsLAC silence in increasing grain 120 25 yield. (a) Lethal phenotype of the OXLAC 100 20 transgenic plants. Scale bar, 5 cm. (b) Semi** ** ** 80 ** sterile phenotype of OXLAC transgenic plants. 15 ** 60 ** Scale bars, 2.5 cm. (c,d) Comparison of the 10 ** 40 OXLAC WT OXLAC WT ** 1,000-grain weight (c) and the number of 5 20 grains (d) per main panicle. From left to right: 0 0 gray bar, wild-type plants; green bars, OXLAC OXLAC × OXLAC × OXmiR397b OXmmiR397 WT 1-1, 2-1, 4-1 and 12-1 transgenic lines. (e) The panicles of the OXLAC crossed with OXmiR397b or OXmmiR397 plants. Scale bar, 34 1.2 32 ** ** 10 cm. (f–h) 1,000 grain weight (f), Relative 30 ** 1.0 expression levels of OsLAC mRNA (g) and seed 28 26 0.8 morphologies (scale bar, 3 mm) (h) in wild-type 24 and OsLAC-RNAi transgenic plants. From left 22 0.6 20 to right: gray bar, wild-type plants; orange 18 0.4 bars, OsLAC-RNAi 1-1, 2-1 and 3-1 transgenic 16 14 0.2 lines. Actin2 was used as the reference gene OsLAC12 RNAi for qRT-PCR. Scale bar, 3 mm. (i) Photograph of 0 10 WT wild-type and transgenic plant seedlings spotted with 1,000 ng/µl 24-epibrassinolide onto the angle between the second leaf blade and sheath for 24 h. The second leaves were marked using a red bar. Scale bar, 2 cm. WT 45 (j) Length of the uppermost four internodes of OXmiR397a 40 OXmiR397b the wild-type, OXmiR397a, OXmiR397b, OXLAC 35 OXLAC and OXmmiR397 plants. From left to right: gray 30 OXmmiR397 bars, wild-type plants; pink bars, OXmiR397a 25 20 4-6, 14-3 and 19-1 transgenic lines; green 15 bars, OXmiR397b 7-1, 9-3, 10-5 and 14-3 10 transgenic lines; purple bars, OXLAC 1-1, 2-1, 5 4-1 and 12-1 transgenic lines; and yellow bars, 0 WT OXmiR397b OXmiR397a OXLAC 1st 2nd 3rd 4th OXmmiR397 6-5, 15-3, and 21-3 transgenic Internode lines. Values are the means ± s.d. (c,f,g, n = 3 replicates; d, n = 40 plants, except for OXLAC 1-1, which had a severe lethal phenotype, n = 15 plants; j, for OXLAC plants, n > 30 plants; for others, n > 60 plants). Significant differences were identified at the 5% (*) and 1% (**) probability levels using Student’s t-test. W T O XL AC

W O T XL AC

e

g

i

O WT sL R AC N Ai

j

Internode length (cm)


O WT sL R AC N Ai

h



f

* ** * ****

**

******

********** **

**

** ** **

** ****

**

** ****

* *

**** **

Supplementary Fig. 4d–f). The overall theoretical grain yield per main panicle decreased by 81.2% compared with wild-type plants. Moreover, the OXLAC lines had fewer vascular bundles (Supplementary Fig. 3b and Supplementary Table 2), smaller spikelet hulls (Supplementary Fig. 3c,d) with fewer grain hull cells (Supplementary Fig. 3e–h), slightly enlarged endosperm cells (Supplementary Fig. 3i,j) and a delayed heading time (Supplementary Fig. 2). Taken together, these results indicate that the phenotypes of OXLAC plants were in contrast to those of OXmiR397 plants, which expressed lower level of OsLAC than wild-type plants. To further validate the specific binding of the OsmiR397 to OsLAC mRNA, we also generated transgenic plants overexpressing the OsmmiR397 gene (OXmmiR397 line), which contained several mismatches to the OsLAC binding site but also produced a 21-nt small RNA. RNA blot hybridization was done to detect the expression of mutated OsmiR397 (the 21-nt small RNA) (Fig. 1b). As expected, qRT-PCR analysis showed that there was no significant difference in the OsLAC mRNA level in the OXmmiR397 lines (Fig. 2j), that is, the negative regulatory role of OsmiR397 on OsLAC was disrupted when the sequence of OsmiR397 was mutated. Consistent with our previous observations, the phenotype of the OXmmiR397 transgenic plants was very similar to that of wild-type plants and no obvious increase in the grain size or grain weight was observed (Fig. 1a,c,f,g and Supplementary Figs. 1 and 2). To further explore the relationship between the dosage of the OsLAC mRNA and the grain weight, we examined OsLAC expression in OXmiR397a plants with varying grain weights. There was a negative correlation between the

**

OsLAC expression level and the grain weight (Supplementary Fig. 4b). These data suggest that OsmiR397-guided cleavage of the OsLAC mRNA might account for the increased grain yield in rice. We next crossed the OXLAC and OXmiR397b plants to further confirm the cleavage of the OsLAC mRNA accounted for the observed phenotypes. All the transgenic lines of OXmiR397b were able to fully rescue the reduced grain size and grain number per main panicle of all the ten OXLAC plants. We also crossed the OXLAC and OXmmiR397 plants as controls. As expected, the transgenic lines of OXmmiR397 could not rescue the phenotypes of all the OXLAC plants (Fig. 3e). To eliminate the possibility of OsmiR397 function on other potential targets, we also generated OsLAC RNA interference (RNAi) lines. The phenotype of these plants was similar to that of the OXmiR397 lines (Fig. 3f–h). These results support the hypothesis that OsmiR397 increased grain yield through the downregulation of OsLAC. We next investigated the mechanism by which the OsLAC might affect yield. Laccases belong to the polyphenol oxidase family with various spatial-temporal modes and functions20,21. However, there are no published reports on the relationship between the functions of laccases and grain yield. We performed RNA-seq on the young panicles of the wild-type, OXmiR397b and OXLAC plants and found that lots of brassinosteroid-related genes were differentially expressed between the three samples (Supplementary Fig. 5a). As brassinosteroids have been reported to play an important role in regulating rice grain yield6,7, we speculated that OsLAC might be involved in the brassinosteroid pathway. To explore this hypothesis, we tested the sensitivity of plants to brassinosteroids using the lamina inclination assay22,23. Notably, we advance online publication nature biotechnology


letters found that, compared with wild type, OXmiR397 plants were much more sensitive to 24-epibrassinolide treatment (the leaf angle increased faster during the treatment under different 24-epibrassinolide concentrations and treatment conditions), whereas OXLAC plants were almost completely insensitive to 24-epibrassinolide treatment (Fig. 3i and Supplementary Fig. 5b–e), suggesting that negative regulation of OsLAC by OsmiR397 is related to brassinosteroid responses. We further compared the OXmiR397 and OXLAC plants to previously reported brassinosteroid-related mutants 6,7,22,23, and found that the phenotype traits of the OXLAC plants were actually very similar to those of the brassinosteroid-deficient mutants, including erect leaf (Supplementary Fig. 5f), shortened internodes (Fig. 3j and Supplementary Fig. 5g), reduced vascular number and grain size (Fig. 3c, Supplementary Figs. 3b and 4c, and Supplementary Table 2). In contrast, OXmiR397 plants have a phenotype consistent with enhanced brassinosteroid signaling6,7,22. These observations further supported the involvement of OsmiR397 and OsLAC in brassinosteroid-regulated plant growth and development. Next, we measured the levels of four endogenous, downstream, brassinosteroid molecules (brassinolide, castasterone, typhasterol and teasterone) in the developing seeds of the wild-type, OXmiR397b and OXLAC plants. Brassinolide was undetectable in all plants. The levels of the other three endogenous brassinosteroids were slightly lower in OXmiR397 plants, but were increased about two to threefold in OXLAC plants compared with the wild type (Supplementary Table 3). It has been widely accepted that brassinosteroid signals could regulate BR biosynthesis genes through negative feedback 22,24. In the RNA-seq data of the OXLAC sample, upregulation of most potential brassinosteroid biosynthesis genes, among which four reported brassinosteroid biosynthesis genes were validated by qRT-PCR, also supported this phenomenon (Supplementary Fig. 5a,h–k). Thus, we conclude that OsmiR397 enhanced brassinosteroid signaling, but not brassinosteroid accumulation, by downregulating the OsLAC gene, which in turn increases grain yield. In summary, we identified a role for OsmiR397 in the regulation of the grain yield in rice. Ectopic expression of OsmiR397 led to a greater number of branches and grains per main panicle, increased grain size and substantially enhanced grain yield. To our knowledge, no previous report has described a positive regulatory role of miRNAs in the control of plant seed size and grain yield. Furthermore, we demonstrated that OsmiR397 regulates its target gene, OsLAC, which we showed to be involved in the brassinosteroid sensitivity of the plants, leading to increases in grain yield. Investigation of genes directly regulated by OsLAC may provide clues leading to the determination of the molecular mechanism in brassinosteroid signaling. As miR397 is highly conserved in different crop species18, our results suggest that manipulating miR397 may be useful for increasing grain yields in other cereal crops. Methods Methods and any associated references are available in the online version of the paper. Accession codes. SRA: Study SRP026496, including three experiments, SRX317255, SRX317256, SRX317257. Note: Any Supplementary Information and Source Data files are available in the online version of the paper. Acknowledgments We thank Q. Qian for helping with the field trial and C.C. Chu for the comments on brassinosteroid analysis. This research was supported by a key project of the

nature biotechnology advance online publication

National Natural Science Foundation of China (No. U0631001 and 90917011), funds from Ph.D. Programs Foundation of Ministry of Education of China (20120171130003), and from the Natural Science and Technology Department of Guangdong Province (2009A020102001 and S2011020001232). AUTHOR CONTRIBUTIONS Y.-C.Z. conceived the experiment, and together with Y.Y., C.-Y.W., Z.-Y.L. and Q.L. carried it out; J.X. and J.-Y.L. carried out the transgenic plant generation and analysis; X.-J.W. and L.-H.Q. analyzed the data; F.C. carried out the field trial; P.X., C.Y. and J.C. performed brassinosteroid detection; Y.-C.Z., H.-Q.L. and Y.-Q.C. conceived the experiment and wrote the paper. COMPETING FINANCIAL INTERESTS The authors declare no competing financial interests. Reprints and permissions information is available online at http://www.nature.com/ reprints/index.html.

1. Xing, Y. & Zhang, Q. Genetic and molecular bases of rice yield. Annu. Rev. Plant Biol. 61, 421–442 (2010). 2. Song, X.J., Huang, W., Shi, M., Zhu, M.Z. & Lin, H.X.A. QTL for rice grain width and weight encodes a previously unknown RING-type E3 ubiquitin ligase. Nat. Genet. 39, 623–630 (2007). 3. Mao, H. et al. Linking differential domain functions of the GS3 protein to natural variation of grain size in rice. Proc. Natl. Acad. Sci. USA 107, 19579–19584 (2010). 4. Xue, W. et al. Natural variation in Ghd7 is an important regulator of heading date and yield potential in rice. Nat. Genet. 40, 761–767 (2008). 5. Sakamoto, T. et al. Genetic manipulation of gibberellin metabolism in transgenic rice. Nat. Biotechnol. 21, 909–913 (2003). 6. Hong, Z. et al. A rice brassinosteroid-deficient mutant, ebisu dwarf (d2), is caused by a loss of function of a new member of cytochrome P450. Plant Cell 15, 2900–2910 (2003). 7. Tanabe, S. et al. A novel cytochrome P450 is implicated in brassinosteroid biosynthesis via the characterization of a rice dwarf mutant, dwarf11, with reduced seed length. Plant Cell 17, 776–790 (2005). 8. Sakamoto, T. et al. Erect leaves caused by brassinosteroid deficiency increase biomass production and grain yield in rice. Nat. Biotechnol. 24, 105–109 (2006). 9. Bartel, D.P. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281–297 (2004). 10. Miura, K. et al. OsSPL14 promotes panicle branching and higher grain productivity in rice. Nat. Genet. 42, 545–549 (2010). 11. Jiao, Y. et al. Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice. Nat. Genet. 42, 541–544 (2010). 12. Zhu, Q.H. et al. A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains. Genome Res. 18, 1456–1465 (2008). 13. Xue, L.J., Zhang, J.J. & Xue, H.W. Characterization and expression profiles of miRNAs in rice seeds. Nucleic Acids Res. 37, 916–930 (2009). 14. Chen, C.J. et al. Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus. RNA Biol. 8, 538–547 (2011). 15. Ikeda-Kawakatsu, K. et al. Expression level of ABERRANT PANICLE ORGANIZATION1 determines rice inflorescence form through control of cell proliferation in the meristem. Plant Physiol. 150, 736–747 (2009). 16. Terao, T., Nagata, K., Morino, K. & Hirose, T. A gene controlling the number of primary rachis branches also controls the vascular bundle formation and hence is responsible to increase the harvest index and grain yield in rice. Theor. Appl. Genet. 120, 875–893 (2010). 17. Jones-Rhoades, M.W., Bartel, D.P. & Bartel, B. MicroRNAS and their regulatory roles in plants. Annu. Rev. Plant Biol. 57, 19–53 (2006). 18. Jones-Rhoades, M.W. & Bartel, D.P. Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Mol. Cell 14, 787–799 (2004). 19. Jeong, D.H. et al. Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage. Plant Cell 23, 4185–4207 (2011). 20. Riva, S. Laccases: blue enzymes for green chemistry. Trends Biotechnol. 24, 219–226 (2006). 21. Berthet, S. et al. Disruption of LACCASE4 and 17 results in tissue-specific alterations to lignification of Arabidopsis thaliana stems. Plant Cell 23, 1124–1137 (2011). 22. Yamamuro, C. et al. Loss of function of a rice brassinosteroid insensitive1 homolog prevents internode elongation and bending of the lamina joint. Plant Cell 12, 1591–1606 (2000). 23. Zhang, L.Y. et al. Antagonistic HLH/bHLH transcription factors mediate brassinosteroid regulation of cell elongation and plant development in rice and Arabidopsis. Plant Cell 21, 3767–3780 (2009). 24. Nakamura, A. et al. The role of OsBRI1 and its homologous genes, OsBRL1 and OsBRL3, in rice. Plant Physiol. 140, 580–590 (2006).

ONLINE METHODS


Plant materials, growth conditions and measurements of agronomic traits. The rice cultivar used in the experiments is Zhonghua 11 (Oryza sativa japonica). Rice seeds from the control plants and the transgenic plants imbibed in darkness for 2 d at 30 °C and then were grown for ~20 d in a soil seed bed at 28 °C, 70% humidity (12 h light/12 h dark), and then the seedlings were transplanted to a field. The field was located in Guangzhou, China (23°08′N, 113°18′E). The growing season extends from late April to late September. During this period, the average low temperature range is ~22.9 –25.5 °C, and the average high temperature range is ~29.7–32.9 °C. The day length ranged from 12 to 13.5 h. Plants were maintained under routine management practices. The grain length, width and thickness, the number of primary and secondary branches, the number of effective grains and the internode length were determined when the seeds were harvested. For each line, data from 60 or more individual plants were obtained and subjected to statistical analyses, except for the OXLAC lines (n > 30 plants), which had a lethal and semi-sterile phenotype, with only some of them producing mature grains. Generation of transgenic rice plants. A binary vector, pHQSN, which was constructed by inserting the CaMV35S promoter into the multiple cloning sites of pCAMBIA1390 between the HindIII and XbaI sites, was used in this work to generate the overexpressing transgenic lines. The genomic DNA sequences of the pre-miR397a, pre-miR397b, pre-mmiR397, OsLAC and OsmLAC genes were cloned into the XbaI/EcoRI sites of pHQSN between the CaMV35S promoter and the Nos terminator. The primers used to amplify the inserts were as follows: miR397a, 5′-GAATCTAGAACACGCTCTACCTAC ATCGTGT-3′ and 5′-ATTGAATTCTCACCTCGTCTGCTGGGGACCT-3′; miR397b, 5′-TAATCTAGAGAGCTCATCTAAAGTCTGA-3′ and 5′-TAAG AATTCATGCTTGTATTATAAGACATCTG-3′; and OsLAC, 5′-TATTCTAG AATGGCGGCAGCCTCCTCTGTTC-3′ and 5′-ATAGAATTCCTAGCATTT TGGGAGATCCAACGGT-3′. The primers for introducing mismatch to the OsmiR397 and OsLAC to generate the OXmmiR397 and OXmLAC lines are as follows: OsmmiR397, 5′-CATGTTGATGCGCATTTGGCCGGTGATCT GATCATCATCAGCGCTTGAGTGAATCATGCGTTTGGCATCTCTGCC ATGCAACCA-3′ and 5′-GACCGGTTACCGTTGTTCATCAACGCTCGA GTGAATGATGCATTTGATTCTCTGTTTCCATACCGACT-3′; OsmLAC; 5′-GCTGATAAATGCAGCTCTGAACGACGAGCTCTTCTTCTCCATCGC CAACCACA-3′ and 5′-CTCAGCATGTACGTCTTCCCGGGCTTCACCT-3′ (the underlining indicates the mutant sites). The fused gene was under the control of the CaMV35S promoter. Another binary vector, pRNAi-35S vector, which was constructed from the pCAMBIA1305 and has two multicloning site regions to facilitate the cloning of target gene fragments in the sense and antisense orientations, and hairpin RNA constructs driven by the CAMV35S promoter, were used to generate the OsLAC RNAi transgenic lines25. A 588-bp cDNA fragment of OsLAC between 1,028 to 1,616 bp that corresponds to the 3′ region of the coding sequence was used for the construction of OsLAC RNAi transgenic lines. The RNAi construct was inserted into the HindIII and BamHI sites (for the forward insert) and the PstI and MluI sites (for the reverse insert) of the pRNAi-35S vector. Primers used to amplify the insert for LAC-RNAi vector were 5′-CGAGCTCTTCTTCTCCATCG-3′ and 5′-AGCGGGTAGTACGGGAAGTT-3′. The transgenic rice plants were generated according to the Agrobacterium tumefaciens-mediated transformation methods as described26. Briefly, embryonic calli were induced from rice seeds on N6 basal medium supplemented with 2 mg/l 2,4-D. After co-cultivation of the calli with Agrobacterium strain EHA105 harboring the binary vector, the calli were transferred to selection medium supplemented with hygromycin. Hygromycin-resistant calli were subsequently used for shoot regeneration and root induction. The transgenic plantlets were then transferred to the field of the experimental station for normal growth and seed harvesting. T3 seeds that were homozygous for the transgene were harvested and several lines with high expressing levels were used for further analysis. Three OXmiR397a lines (4-6, 14-3, 19-1), four OXmiR397b lines (7-1, 9-3, 10-5, 14-3), four OXLAC lines (1-1, 2-1, 4-1, 12-1), three OXmmiR397 lines (6-5, 15-3, 21-3) and three OsLAC RNAi lines (1-1, 2-1, 3-1) were used in this study. Northern blot analysis. Total RNA was isolated with TRIzol (Invitrogen) from each sample according to the manufacturer’s instructions. Northern blot analysis

nature biotechnology

was done as described with some modifications27. Briefly, 80 µg of total RNA from the transgenic and wild-type plants were resolved on a denaturing 10% polyacrylamide gel and then electrophoretically transferred to Hybond-N + membranes (Amersham, GE Life Sciences) using a semidry blotting apparatus (Bio-Rad). The membranes were then irradiated with UV light for 4 min and baked at 80 °C for 50 min. DNA oligonucleotides complementary to different miRNA sequences were synthesized (Sangon, Shanghai). The 5′ ends of the DNA probes were labeled with [γ-32P]ATP (Yahui Co.) using T4 polynucleotide kinase (TaKaRa). The membranes were prehybridized for at least 30 min in hybridization buffer (5× SSC, 20 mM NaH2PO4 pH 7.2, 7% SDS, 2× Denhardt’s Solution) and then were hybridized overnight at 42 °C. After washing three times with 2× SSPE/0.1% SDS at room temperature, the membranes were exposed to a phosphor screen and visualized using a Typhoon 8600 variable mode imager (Amersham Biosciences). The probes used for the northern blot analysis were as follows: miR397, 5′-GTTCATCAACGCTGCA CTCAA-3′ and mmiR397, 5′-CATCAAC GCTCGAGTGAATGA-3′. Plot field experiment. Plants of wild type, OXmiR397a, OXmiR397b and OXmmiR397 were grown under natural condition in Beijing (40°02′N, 116°02′E). The planting density was 19 cm × 22 cm, with one plant per hill. The area per plot was 3.39 m2. We mixed several transgenic lines for each plot except wild type. OXmiR397a plots were a mixture of OXmiR397a 4-6, 14-3, and 19-1 transgenic lines; OXmiR397b plots were a mixture of OXmiR397b 7-1, 9-3, 10-5, and 14-3 transgenic lines and OXmmiR397 plots were a mixture of OXmmiR397 6-5, 15-3 and 21-3 transgenic lines. The plot yields, panicle number per plot, tiller number per plant and 1,000-grain weight were determined when the seeds were harvested. Data are from the randomized complete block design with four replications. Values are means ± s.d. Examination of OsLAC expression by qRT-PCR analysis. Total RNAs from rice seedlings 20 d after germination were reverse transcribed using the PrimeScript RT reagent kit (Takara, Japan). The real-time PCR was carried out using SYBR Premix Ex Taq (Takara, Japan) for the detection of the PCR products. Actin2 was chosen as the reference gene. The realtime PCR was done according to the manufacturer’s instructions (Takara, Japan), and the resulting melting curves were visually inspected to ensure the specificity of the product detection. The quantification of OsLAC expression was done using the comparative Ct method. Experiments were done in triplicate, and the results are represented as the mean ± s.d. (s.d.). For Actin2, the primers were Actin2-F (5′-GTGCTTTCCCTCTATGCT-3′) and Actin2-R (5′-CTCGGCAGAGGT GGTGAA-3′); for OsLAC, the primers were OsLAC-F (5′-GAGGAGG TGCCCATCATGTTC-3′) and OsLAC-R (5′-CCTTCAGCTTAAACGTGTCTTGG -3′). Histochemical GUS staining. A binary vector, pCAMBIA1303, was used to generate the GUS-OsmiR397a/b and GUS-OsLAC transgenic lines. The ~2,000 bp regions upstream of the OsmiR397a/b or OsLAC were used as the promoter region to control the expression of GUS gene. The GUS activity in the transgenic plants was localized by histochemical staining with 5-bromo-4-chloro-3-indolyl-β-d-glucuronic acid (X-Gluc). Transgenic plants were cut and incubated overnight at 37 °C in staining buffer (1 mM X-Gluc, 100 mM sodium phosphate (pH 7.0), 10 mM EDTA, 0.5 mM K 4Fe(CN)6, 0.5 mM K3Fe(CN)6, and 0.1% (v/v) Triton X-100) and then destained in 70% ethanol before photographing. In situ hybridization. RNA in situ hybridization was done as described previously with minor modifications28. Briefly, plant materials were fixed in FAA fixative for 8 h at 4 °C after vacuum infiltration dehydrated using a graded ethanol series followed by a xylene series, and embedded in Paraplast Plus (Sigma-Aldrich). Microtome sections (8 µm) were mounted on Probe-On Plus microscope slides (Fisher). The 146-bp region of OsLAC was amplified with the primers 5′-CACATGAGCTGGGGACTGAAA-3′ and 5′-GCAAATGCAACCAATCTTG ACT-3′ and then subcloned into the pEASYT3 (TransGen Biotech) vector and used as the template to generate sense and antisense RNA probes. The OsFON1 probes were prepared as described in a previous paper29. The antisense probe was transcribed using T7 RNA polymerase, and the sense probe was synthesized using SP6 RNA polymerase.

doi:10.1038/nbt.2646


Digoxigenin-labeled RNA probes were prepared using a DIG RNA Labeling Kit (SP6/T7) (Roche) according to the manufacturer’s instructions. The custom 5′ and 3′ double-labeled LNA-modified oligonucleotides (EXIQON) (5′-GTTCATCAACGCTGCACTCAA-3′) were used to detect the most abundant miR397 produced from pre-miRNAs (miRNA precursors). A scrambled miRNA control probe was used as a negative control. Photomicrographs were taken using a bright-field microscope (Leica DM5000B). RNA-seq and bioinformatics analysis. The panicles at booting stage from the wild-type, OXmiR397b and OXLAC plants (n = 20 plants for each sample) were collected to extract the total RNA. The mRNA enrichment, RNA fragments, random hexamer primed cDNA synthesis, PCR amplification, RNAseq and bioinformatics analysis were performed at Beijing Genome Institute (BGI) (Shenzhen, China). Briefly, mRNA was enriched by using the oligo(dT) magnetic beads and interrupted to short fragments (about 200 bp), then the first and second strand cDNA is synthesized using the mRNA fragments as templates. The double-stranded cDNA is purified and a single nucleotide A (adenine) addition is made. Finally, sequencing adaptors are ligated to the fragments. The required fragments are purified by agarose gel electrophoresis and enriched by PCR amplification. The library products are ready for sequencing analysis via Illumina HiSeq 2000. After filtered the dirty raw reads, including the reads with adaptors, reads in which unknown bases are more than 10% and low quality reads, the clean reads were mapped to the reference sequences using SOAPaligner/soap2 (ref. 30). Then the sequencing was assessed, and the gene expression level is calculated by using RPKM method (Read Per kb per Million reads). The differentially expressed genes (DEGs) were then screened. The “FDR ≤ 0.001 and the absolute value of log2Ratio ≥ 1” was used as the threshold to judge the significance of the gene expression difference. Lastly, the Gene Ontology (GO) enrichment analysis of DEGs was performed as described before31 to decipher the biological processes involving the DGEs. Lamina joint inclination assay. Sterilized seeds were grown for 7 d in the dark. Uniform seedlings were then sampled by excising 2 cm segments that contained the second leaf lamina joint under dim light condition. The segments were floated on distilled water containing 10 −6 M and 10−8 M of 24-epibrassinolide, respectively. After incubation in a dark chamber at 30 °C for 24 h, 48 h and 72 h, the angle between the lamina and the sheath was measured using ImageJ23. Measurement of endogenous brassinosteroids. Developing seeds of the wild type, OXmiR397b and OXLAC plants were harvested 15 d after pollination. The fresh tissues were frozen in liquid nitrogen and then grounded to a fine

doi:10.1038/nbt.2646

powder with a Mixer Mill MM 400 (Retsch, Haan, Germany). The brassinosteroids measurement was performed based on the method as described previously with modification32. 1 g of the plant material powder was extracted with 6.25 ml of 95% aqueous methanol twice. D3-BL (150 pg) and D3-CS (500 pg) were added to the extract as internal standards. BL and CS were determined by isotope dilution, the measurements of TY and TE were based on the internal standard method using D3-CS as the reference. The extract was passed through activated MAX cartridge (6 ml, 500 mg, Waters, Milford, MA, USA) and collected for drying under gentle nitrogen stream at room temperature. The collection was loaded onto the equilibrated MCX cartridge (6 ml, 500 mg, Waters, Milford, MA, USA) after reconstitution in 4 ml of 10% methanol, then sequential washing with 5% FA in 5% methanol, 5% methanol, 5% NH 4OH in 5% methanol, 5% methanol then brassinosteroids were eluted with 80% methanol. The elution was dried and then dissolved in 200 µl of ACN to be derivatized with 30 µg DMAPBA for analysis on a UPLC (Waters, Milford, MA, USA) combined with an electrospray ionization linear ion trap mass spectrometry (5500q, AB SCIEX, Foster City, CA) system. The inlet method was set as follows: mobile phase A: 0.05% acetic acid in water, B: 0.05% acetic acid in ACN. Gradient: 0–3 min, 65%B to 75%B; 3–11 min, 75%B to 95%B; 11–12 min, 95%B; 12–13.5 min, 95%B to 65%B; 13.5–16 min, 65%B. Brassinosteroids-DMAPBA was detected in positive MRM mode. The source parameters were set as: IS voltage 5,500 V, TEM 550 °C, GS1 45, GS2 45 and curtain gas 27. All experiments involved three replicated samples to ensure the accuracy and repeatability.

25. Hu, X. & Liu, Y. The construction of RNAi vectors and the use for gene silencing in rice. Mol. Plant Breed. 4, 621–626 (2006). 26. Toki, S. et al. Early infection of scutellum tissue with Agrobacterium allows highspeed transformation of rice. Plant J. 47, 969–976 (2006). 27. Wang, J.F., Zhou, H., Chen, Y.Q., Luo, Q.J. & Qu, L.H. Identification of 20 microRNAs from Oryza sativa. Nucleic Acids Res. 32, 1688–1695 (2004). 28. Kouchi, H. & Hata, S. Isolation and characterization of novel nodulin cDNAs representing genes expressed at early stages of soybean nodule development. Mol. Gen. Genet. 238, 106–119 (1993). 29. Suzaki, T. et al. The gene FLORAL ORGAN NUMBER1 regulates floral meristem size in rice and encodes a leucine-rich repeat receptor kinase orthologous to Arabidopsis CLAVATA1. Development 131, 5649–5657 (2004). 30. Li, R. et al. SOAP2: an improved ultrafast tool for short read alignment. Bioinformatics 25, 1966–1967 (2009). 31. Zhang, G. et al. Deep RNA sequencing at single base-pair resolution reveals high complexity of the rice transcriptome. Genome Res. 20, 646–654 (2010). 32. Xin, P., Yan, J., Fan, J., Chu, J. & Yan, C. An improved simplified high-sensitivity quantification method for determining brassinosteroids in different tissues of rice and Arabidopsis. Plant Physiol. doi: http://dx.doi.org/10.1104/pp.113.221952 (25 June 2013).

nature biotechnology