Persistence of Beauveria bassiana

Biological Control 61 (2012) 194–200

Contents lists available at SciVerse ScienceDirect

Biological Control journal homepage: www.elsevier.com/locate/ybcon

Persistence of Beauveria bassiana (Ascomycota: Hypocreales) as an endophyte following inoculation of radiata pine seed and seedlings Michael Brownbridge a,1, Stephen D. Reay b, Tracey L. Nelson a, Travis R. Glare c,⇑ a

AgResearch Ltd., Lincoln Research Centre, Private Bag 4749, Christchurch 8140, New Zealand Silver Bullet Forest Research, Auckland, New Zealand c Bio-protection Research Centre, P.O. Box 84, Lincoln University, Lincoln 7647, New Zealand b

h i g h l i g h t s

g r a p h i c a l a b s t r a c t

" We investigated two methods to establish Beauveria bassiana as endophytes of pine seedlings. " Fungi were applied as seed coating and root dip treatments. " B. bassiana was successfully established in pine seedlings. " Persistence of established fungi decreased over 9 months.

a r t i c l e

i n f o

Article history: Received 15 April 2011 Accepted 5 January 2012 Available online 14 January 2012 Keywords: Entomopathogens Beauveria spp. Pinus radiata Endophytes

a b s t r a c t The entomopathogenic fungus Beauveria bassiana commonly causes disease on a range of insects, including bark beetle pests of plantation forest trees. However, using broadcast application of the fungus to control pest beetles in large scale plantation forests could be difficult to achieve economically. B. bassiana has also been found as an endophyte in plants, including the main commercially planted tree in New Zealand, Pinus radiata. In this study we investigated two methods to establish B. bassiana as endophytes of pine seedlings, seed coating and root dip. Two isolates previously isolated from within mature pines were used and the seedlings monitored for 9 months. Samples of unwashed, washed and surface sterilised roots, surface sterilised needles and soil were plated on semi-selective agar at 2, 4 and 9 months after inoculation. B. bassiana was successfully established in pine seedlings using both root dip and seed coating. The fungus was found in soil, non-sterile and sterilised samples at 2 and 4 months, but only one seedling of 30 was positive for fungus in surface sterilised samples after 9 months. Ó 2012 Elsevier Inc. All rights reserved.

1. Introduction The introduced bark beetle Hylastes ater (Paykull) (Curculionidae: Scolytinae) is occasionally a significant pest of the predominant plantation forest species (Pinus radiata D. Don) grown in New Zealand and can periodically lead to significant mortality of

⇑ Corresponding author. Fax: +64 3 325 3864. E-mail address: [email protected] (T.R. Glare). Current address: Vineland Research and Innovation Centre, 4890 Victoria Ave. N., Box 4000, Vineland Station, Ontario, Canada L0R 2E0. 1

1049-9644/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.biocontrol.2012.01.002

newly planted pine seedlings (Reay and Walsh, 2002). Hylurgus ligniperda (F.) (Curculionidae: Scolytinae) is another exotic bark beetle pest that is currently only a minor pest of pines in New Zealand, but causes considerable damage to regenerative forests in Chile (Bain, 1977; Mausel et al., 2006). Feeding damage to seedlings may occur in second (and subsequent) rotation areas when emerging adults feed on seedlings planted in the immediate area (Reay and Walsh, 2002). These bark beetles can vector sapstain and other damaging fungi to live seedlings during sub-lethal feeding events (Reay et al., 2002). Currently, management of the replanting regime is the most effective way to minimize the risk of seedling damage by H. ater (Reay and Walsh, 2002). More recently, efforts

M. Brownbridge et al. / Biological Control 61 (2012) 194–200

have been made to explore the potential for biocontrol agents to mitigate this pest (Glare et al., 2008; Reay et al., 2008, 2010). While fungi have been shown to be important agents of natural mortality in bark beetle populations, the actual impact of these pathogens on beetle populations is estimated to be relatively low (Balazy, 1968). Fungi from the genus Beauveria (Balsamo) Vuillemin have been reported most commonly from bark beetles (Wegensteiner, 2004). The classification of Beauveria species is currently in review; using multigene phylogenies, Rehner and colleagues have delimited six well supported clades (Rehner and Buckley, 2005). In addition to the known species (Beauveria bassiana s.s., Beauveria brongniartii, Beauveria vermiconia, Beauveria caledonica and Beauveria amorpha), they have also described Beauveria malawienisis (Rehner et al., 2006). All have been shown to be pathogenic to arthropods (Chandler et al., 2000; Glare et al., 2008; Zimmermann, 2007), and are found in a diverse range of habitats (Meyling and Eilenberg, 2007; Quesada-Moraga et al., 2007; Vega et al., 2008). Three species, B. bassiana B. caledonica and B. malawiensis, have been isolated from soil and infected insects collected in P. radiata forests in New Zealand. In these surveys, B. caledonica was the prevalent pathogen isolated from bark beetles (Glare et al., 2008; Reay et al., 2008). All three species were confirmed as being pathogenic to both H. ater and H. ligniperda adults in laboratory assays. B. bassiana is capable of endophytic colonization of a range of plant species. These include maize (Bing and Lewis, 1991; Wagner and Lewis, 2000; Cherry et al., 2004), tomato (Ownley et al., 2004), cocoa (Posada and Vega, 2005; Vega et al., 2008), coffee (Posada et al., 2007; Vega et al., 2008), bananas (Akello et al., 2007), date palm (Gómez-Vidal et al., 2006) and opium poppy (QuesadaMoraga et al., 2006). In a recent survey of 33 sites from four geographically distinct areas in New Zealand, B. bassiana was found to be present as an endophyte in P. radiata (Reay et al., 2010). Reay et al. (2010) recovered 18 isolates from P. radiata needles collected from 125 trees, a single isolate from four P. radiata seedling root samples and a single isolate from seeds taken from four cones removed from a single mature tree. All of these B. bassiana isolates were confirmed as entomopathogens in laboratory assays against H. ligniperda adults and Tenebrio molitor L. (Coleoptera: Tenebrionidae) larvae. B. bassiana was previously isolated from Pinus monticola by Ganley and Newcombe (2006), but to our knowledge the fungus has not otherwise been documented from pines. The colonization of plant tissues by Beauveria has been demonstrated to provide protection against insect damage, or has inhibited insect development and establishment (Bing and Lewis, 1991; Cherry et al., 2004; Ownley et al., 2004; Vega et al., 2008). Some protection against phytopathogens has also been documented (Ownley et al., 2004, 2010). However, in most endophytic occurrences by B. bassiana, the effect on insects is unknown. Using Beauveria spp. to control bark beetles by conventional spray application techniques would likely be ineffective due to the behavior of bark beetles and associated high costs of treating large forested areas. Consequently, alternative methods of delivery are required to use these pathogens in an effective biocontrol strategy. As part of a study exploring the potential use of B. bassiana to regulate bark beetles through endophytic colonization, we investigated the ability of some B. bassiana isolates to establish as endophytes in pine seedlings after root and seed inoculation. 2. Material and methods 2.1. Production of inoculum Isolates of B. bassiana originally recovered from mature pine trees in New Zealand were used in the experiments. Isolates F647 (Genbank GU237004) and F668 (Genbank GU237005) were

195

previously isolated from needles of mature P. radiata trees from two distinct geographical locations (North and South Islands) in New Zealand (Reay et al., 2010). Both isolates belong to Clade A (B. bassiana sensu stricto) of Rehner and Buckley (2005). Conidia were harvested from 12-day old cultures grown at 20 °C on potato dextrose agar (PDA) (Merck, NJ) overlain with clear cellophane; this system allows easy removal of conidia by peeling the cellophane off the surface of the medium. Suspensions containing ca. 108 conidia/mL 0.01% Triton X-100 were prepared for incorporation into the coating matrix. 2.2. Inoculation of Pinus radiata P. radiata seeds were obtained from a commercial supplier (ex New Zealand, strict origin undeterminable). Two methods of inoculation were subsequently used: a seed treatment and root dip. Prior to inoculation, seeds were surface sterilised by soaking in 99% ethanol for 1 min before being sterilised in 10% NaOCl for 5 mins. Subsequently, they were rinsed twice in sterile distilled water for 1 min and then soaked in sterile distilled water for 24 h at 4 °C. 2.3. Seed coating Prior to seed coating treatments being applied, seeds were placed on sterile filter paper in 55 mm Petri dishes (10 seeds/dish) and air dried in a laminar flow hood. Seeds were coated with either a preparation of xanthan gum (Xan) (0.2%) or methylcellulose (MC) (2%). Coatings were prepared by adding 5 mL of a 2 108 conidia/ mL 0.01% sterile aqueous Triton X-100 suspension to 20 mL of coating to give a final concentration of 5 107 conidia per mL. Viability of the conidia was assessed by spreading 100 lL of inoculum over the surface of a Sabouraud dextrose agar (SDA) (Difco, NJ) plate and incubating at 20 °C. Germination was assessed after 18 h by putting one drop of lactophenol cotton blue (Merck, NJ) onto the plate, overlaying with a coverslip and examining under a microscope; three assessments were made on 100 randomly selected conidia for each germination assessment (Goettel and Inglis, 1997). Viability was >90% for all batches of conidia used. Control treatments were prepared for each fungus using the same method but 5 mL of 0.01% Triton only was added to the xanthan or methylcellulose coating. In total, six treatments were prepared; 1. F668 Xan, 2. F668 MC, 3. F647 Xan, 4. F647 MC, 5. Xan Control (no fungi), 6. MC Control (no fungi). Fifty gram batches of seed were placed in a rotating Erweka (Heusenstamm, Germany) coating pan (45° angle, 200 rpm) and 25 mL of coating material applied via a spray gun at 4 bar pressure. Where seeds started clumping, unheated forced air was applied using a hairdryer to break clumps. After coating, seeds were removed from the pan and placed onto trays until dry in appearance, prior to packaging into TGT bags (Convex Plastic Limited, Hamilton, NZ) (six bags per 50 g treatment). Bags were held at 20 °C. Spore loadings on the seeds were determined after preparation. For each coating and fungus, 10 seeds were placed into 10 mL sterile 0.01% Triton X-100 in a sterile 20 mL plastic tube. Two replicate tubes were prepared for each coating. Seeds were soaked for 30 mins to allow coatings to rehydrate before shaking the tubes on a wrist shaker (Lab-Line, India) set at maximum for 10 mins. Serial dilutions were then prepared and 100 lL aliquots plated onto a semi selective agar medium, BSM (Beauveria selective medium: quarter strength PDA containing 350 mg/L streptomycin sulfate, 50 mg/L tetracycline hydrochloride and 125 mg/L cycloheximide (Sigma)). Two replicate plates were prepared for each dilution. Plates were incubated at 20 °C and colony forming units (cfu’s) counted after 10 days.

196


The loadings for the MC treatments were 8.70 106 conidia per seed for isolate F647, and 7.80 106 conidia per seed for isolate F668. For the Xan treatments the loadings were 4.40 106 conidia per seed for isolate F647 and 5.10 106 conidia per seed for isolate F668. The viability of the coated seeds was tested by placing 10 seeds per treatment on filter paper moistened with sterile distilled water in 55 mm diam Petri dishes which were placed in the dark at 20 °C for 2–3 weeks. Control seeds for both the MC and Xan treatments had a germination rate of 81% and 88%, respectively. Seeds coated with F647 MC had a 69% germination rate, F647 Xan had a 94% germination rate, F668 MC had a 94% germination rate, and F668 Xan had an 84% germination rate. For each treatment, 30 seeds were sown to ensure that five seedlings from each treatment were available for sampling at each of the three sampling periods (see below). Seeds were individually planted into South-Hort Garden Grow Compost (Southern Horticultural Products Ltd., Christchurch, New Zealand) in multi-cell trays and held in a greenhouse at 15 °C in the dark until seeds began to germinate. Once germinated, seedlings were allowed to grow for 8 weeks before being individually transplanted into PB 1½ (approx. 0.9 L) planting bags (Egmont, NZ) containing the same growing medium and were grown in a greenhouse at approximately 20 °C. Seedlings were watered weekly for the remainder of the trial. At 2, 4 and 9 months after germination five seedlings from each treatment were randomly chosen and destructively sampled as described below.

ium and all soil removed from the roots. For each seedling, six needles and six roots were cut from the seedling using sterile scissors. Soil from around the seedling roots was also collected and a 1 g sub-sample processed by dilution plating to determine propagule loadings in the growing medium. Each root was cut into three pieces using sterile scissors. One root section per root sample from the different treatments was then treated as follows: a. Unwashed root: Each selected root section was cut in half using sterile scissors and placed onto quarter-strength PDA. b. Washed root: Each root section was washed in sterile distilled water for 1 min before being cut in half using sterile scissors and placed onto BSM. c. Sterile root: Each root section was washed in sterile distilled water for 1 min before being surface sterilised by soaking in ethanol (96%) for 1 min, followed by 10% sodium hypochlorite (0.04% active NaOCl) for 5 mins, before rinsing twice in sterile distilled water for 1 min. After sterilisation each root was cut in half using sterile scissors and placed onto BSM. Needle samples: The six needles from each seedling were surface sterilised as described above, cut into three pieces using sterile scissors and placed onto BSM. All BSM plates were sealed with Parafilm (Pechiney Plastic Packaging Company, Chicago, IL) and incubated at 20 °C for 10– 14 days. Developing colonies that appeared to be Beauveria sp. were then subcultured onto new BSM plates which were incubated at 20 °C. The identity of Beauveria spp. colonies was confirmed by visual examination of conidiating cultures.

2.4. Root dipping Due to the shortage of pine seedlings, only one fungal isolate (F668) was used in this experiment. Root dip coatings were prepared with either Xan (0.2%) or MC (2%) as described above. In total, four root dip treatments were prepared: 1. F668 Xan, 2. F668 MC, 3. Control Xan (no fungi), 4. Control MC (no fungi). Batches of 10 surface sterilised P. radiata seeds were placed on sterile filter paper moistened with sterile distilled water in 55 mm Petri dishes. Dishes were placed in the dark at 20 °C for 2–3 weeks until the seeds germinated. When the radicle on germinated seeds was 2–3 cm long, they were inoculated with F668 or the blank coatings described above. Each radicle was inoculated by holding seeds in sterilised forceps and dipping the root into the coating suspension for 10 s, after which the seedlings were placed in a sterile Petri dish to allow the coating to air-dry. Treated seedlings were individually planted into 6-Paks containing Garden Grow compost (South-Hort, NZ) and grown in a greenhouse at approximately 20 °C, transplanting into PB bags at 8 weeks old. Seedlings were watered weekly for the remainder of the trial. Radicle loadings were determined by placing a coated root into 5 mL of sterile 0.01% Triton X-100 in a sterile 20 mL plastic tube. Roots were allowed to soak for 10 min to rehydrate the coating, and tubes were then shaken on a wrist shaker set at maximum for a further 10 min. Serial dilutions were prepared from the stock suspension and 100 lL aliquots plated onto BSM. Two repli-plates were prepared for each dilution. Plates were incubated at 20 °C and cfus counted after 10 days. Radicle loadings for the F668 treatments were 1.3 107 conidia for the MC treatment and 2.13 106 for the Xan treatment. At 2, 4 and 9 months after germination five seedlings from each treatment were randomly chosen and destructively sampled as described below.

2.6. DNA extraction and sequencing To extract DNA from pure cultures of isolated fungi, 10 mL of PD broth (Difco, NJ) was inoculated with conidia taken from discrete colonies and grown at 20 °C for 2 days. The medium was then filtered through sterile Whatman’s No. 1 filter paper. DNA was isolated from mycelia after grinding in liquid nitrogen, using Puregene DNA isolation solutions (Qiagen) following the manufacturer’s instructions and re-suspending in 20 ll of sterile ddH2O. The concentration of DNA used in the PCR reactions was determined empirically and ranged from 1 to a 10 dilution of the initial isolation. Amplification of a fragment of the EF1-a gene was performed using the primers EF349 (50 - TGGCCACCAGCACTCACTAC) and EF1685R (50 - ATGTCACGGACGGCGAAA), designed to amply an internal fragment of approximately 1350 bp. PCR reactions were performed in 25 ll volumes containing 0.4 lM of each primer (Invitrogen, California), 200 lM dNTPs (Innovative Sciences, Dunedin, New Zealand), 2.5 ll reaction buffer, 1.5 mM MgCl2, 2 ll DNA and FastStart Taq (0.7 U/reaction) (Roche). Amplifications were carried out in a thermal cycler (Mastercycler) using 40 cycles of 45 s at 95 °C, 45 s at 55 °C and 2 min at 72 °C. Positive and negative (dH2O) controls were included in each PCR run. PCR products were sequenced directly (Lincoln University Sequencing Unit, New Zealand). Sequences were checked for identification first by BLASTN (Altschul et al., 1990), then Beauveria sequences aligned with previously obtained sequences for the isolates F647 and F668 using DNAMan (Lynnon Biosoft, Canada) and MEGA (Kumar et al., 2008).

3. Results 2.5. Isolation of fungi Five seedlings per treatments were selected at random at each sampling period. Seedlings were removed from the growing med-

The design of the experiment allowed sampling for the presence of B. bassiana in soil, on roots and in roots and needles over a 9 month period. Both isolates of B. bassiana successfully estab-

197


lished, at low incidence levels, as endophytes in pine seedlings using both seed treatment and root dip methods.

3.1. Seed coating At the 2-month sampling period, B. bassiana was recovered from seedlings grown from isolate F647 MC- and Xan-treated seed (Table 1). For seeds coated with F647 MC, B. bassiana was isolated ten times. Twice, three isolations were associated with a single seedling (soil, washed and sterile roots; soil, unwashed and washed roots). Three isolations were made from another seedling (soil, washed and sterile roots), two from another (soil and washed roots) and soil from a final seedling. For the F647 Xan seed treatments, four isolations were made from a single seedling (all samples except sterile needles), three from one seedling (soil, unwashed and washed roots), and two isolations were made from seedlings twice (soil and washed; soil and sterile roots). For seeds coated with F668 MC, B. bassiana was isolated nine times from five seedlings, from soil or washed root samples. Concurrently, five isolations were made from seeds coated with F668 Xan. B. bassiana was isolated twice from two seedlings (soil and unwashed roots; soil and washed roots). The remaining three isolations were made from soil associated with the three remaining seedlings. At 4 months, B. bassiana was recovered from F647 MC seed treatments (Table 1). B. bassiana was isolated a total of 31 times from the processed samples, including 14 times from five seedlings. Positive samples were made from all five soil and washed root samples. In addition, B. bassiana isolations were made from sterile root and needle samples of one seedling, and the sterile roots of another seedling. For seeds coated with F647 Xan at this time, B. bassiana was isolated from soil and washed roots of the same seedling four times, with a single isolation (from washed roots) taken from the remaining tree. For the F668 MC seed treat-

ment samples, B. bassiana was isolated six times from three seedlings, and from the soil of each of these seedlings. In addition, isolations were made from both the unwashed and washed roots of one of these seedlings, and the washed roots of another. Only two isolations were made at the 4 month sampling period for seeds treated with F668 Xan, both from soil. At 9 months, B. bassiana was isolated only once (a sterile root sample from the F647 MC seed treatment) from all seedlings sampled (Table 1). In this seed coating experiment, F668 did not appear to have colonized the pine seedlings as it was not recovered from sterile root or needle samples collected 2, 4 or 9 months after inoculation of seed, irrespective of whether MC or Xan were used in the coating. During the 9-month sampling period, B. bassiana was isolated from control treatments on two occasions; a washed root section at the 2 month sampling period from the Xan treatment (one seedling) and from a single soil sample (MC treated seed processed at 4 months).

3.2. Root Dipping (F668 only) At the 2 month sampling period radicle treatment with isolate F668 appeared to enable its establishment as an endophyte in both the MC and Xan carriers (Table 2). B. bassiana was isolated from 12 and five samples treated with F668 MC and F668 Xan, respectively (Table 2). For seedlings treated with F668 in MC, four isolations were from a single seedling (all samples except sterile needles), while three samples (soil and unwashed and washed roots) were made from another seedling. Twice, two isolations were made from a single tree (soil and washed roots; washed and sterile roots). At 4 months B. bassiana was isolated eight times from F668 MC treatments. Three isolations were from a single seedling (soil, washed and sterile roots), two isolations from another seed-

Table 1 Seed coating experiment: Proportion of treesa that were positive for Beauveria (n = 5). Treatment

Sample

2 month (+/SE)

4 month (+/ SE)

9 month (+/ SE)

Control MC Control MC Control MC Control MC Control MC Control Xan Control Xan Control Xan Control Xan Control Xan F647 MC F647 MC F647 MC F647 MC F647 MC F647 Xan F647 Xan F647 Xan F647 Xan F647 Xan F668 MC F668 MC F668 MC F668 MC F668 MC F668 Xan F668 Xan F668 Xan F668 Xan F668 Xan

Sterile needle Sterile root Washed root Unwashed root Soil Sterile needle Sterile root Washed root Unwashed root Soil Sterile needle Sterile root Washed root Unwashed root Soil Sterile needle Sterile root Washed root Unwashed root Soil Sterile needle Sterile root Washed root Unwashed root Soil Sterile needle Sterile root Washed root Unwashed root Soil

0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0.2 (0.20) 0 (0.0) 0 (0.0) 0 (0.0) 0.6 (0.24) 0.6 (0.24) 0 (0.0) 1 (0.0) 0 (0.0) 0.4 (0.24) 0.6 (0.24) 0.4 (0.24) 1 (0.0) 0 (0.0) 0 (0.0) 0.4 (0.24) 0.4 (0.24) 1 (0.0) 0 (0.0) 0 (0.0) 0.4 (0.24) 0.2 (0.20) 0.8 (0.20)

0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0.2 (0.20) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0.2 (0.20) 0.4 (0.24) 1 (0.0) 0.2 (0.20) 1 (0.0) 0 (0.0) 0 (0.0) 1 (0.0) 0 (0.0) 0.8 (0.20) 0 (0.0) 0 (0.0) 0.4 (0.24) 0.2 (0.20) 0.6 (0.24) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0.4 (0.24)

0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0.2 (0.20) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0)

a Multiple needle or root pieces were on each plate from each tree. A plate was recorded as positive even if only one sample was recorded as having Beauveria spp. growing out of it.

198

M. Brownbridge et al. / Biological Control 61 (2012) 194–200 Table 2 Root dipping experiment: Proportion of treesa that were positive for Beauveria (n = 5). Treatment

Sample

2 month (+/SE)

4 month (+/ SE)

9 month (+/ SE)

Control MC Control MC Control MC Control MC Control MC Con Xan Con Xan Con Xan Con Xan Con Xan F668 MC F668 MC F668 MC F668 MC F668 MC F668 Xan F668 Xan F668 Xan F668 Xan F668 Xan

Sterile needle Sterile root Washed root Unwashed root Soil Sterile needle Sterile root Washed root Unwashed root Soil Sterile needle Sterile root Washed root Unwashed root Soil Sterile needle Sterile root Washed root Unwashed root Soil

0 (0.0) 0.2 (0.20) 0 (0.0) 0 (0.0) 0.2 (0.20) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0.4 (0.24) 0.8 (0.20) 0.4 (0.24) 0.8 (0.20) 0.2 (0.20) 0.2 (0.20) 0.4 (0.24) 0 (0.0) 0.2 (0.20)

0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0.2 (0.20) 0.4 (0.24) 0 (0.0) 1.0 (0.0) 0 (0.0) 0.2 (0.20) 0.4 (0.24) 0.2 (0.20) 0.4 (0.24)

0 (0.0) 0 (0.0) 0.2 (0.20) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0)

a Multiple needle or root pieces were on each plate from each tree. A plate was recorded as positive even if only one sample was recorded as having Beauveria spp. growing out of it.

ling (soil and washed roots), with the remaining three isolations from the soils of the three remaining seedlings. At this time, six separate isolations were made from three individual seedlings treated with F668 Xan. B. bassiana was isolated from the soil, unwashed and washed roots associated with one seedling, and from soil and the sterile roots of another seedling. Single isolations were made from three seedlings (soil, washed roots and sterile roots). B. bassiana was not isolated from any soil samples from the F668 MC or Xan treatments at 9 months. B. bassiana was isolated from three control MC treatment samples as follows: one sterilised root sample (2 months), one washed root sample (9 months) and a single soil sample (2 months). B. bassiana was not isolated from any other control samples. 3.3. Sequence confirmation of fungal identification The identification of several colony types routinely recovered from roots was checked by sequencing a portion of the elongation factor gene (Rehner and Buckley, 2005). A 900 bp consensus sequence was compared for each recovered colony and BLASTed. Three species were confirmed through sequencing. Two Beauveria isolates, from pines inoculated with F668 or F647, were confirmed as identical to those strains. Two additional colonies of a type frequently observed but morphologically-distinct from Beauveria, were identified as Lecanicillium psalliotae, a recognized nematode pathogen (Gan et al., 2007), with 98% identity to GenBank accession AB378518.1. The final fungus had a sequence identity of 98% to Geomyces pannorum, strain S6C2 (GenBank: AJ509866.1), a widespread saprophyte in soil. These two fungi were common in our sterile and non-sterile samples and were evidently capable of becoming endophytic. 4. Discussion In this study we demonstrate for the first time, albeit at low levels, the successful inoculation of B. bassiana into P. radiata. It was possible to use seed coating or root dipping as methods to allow B. bassiana isolates to enter and colonize pine seedlings, although the association was difficult to detect beyond 9 months. The ability to establish B. bassiana in plants following artificial inoculation has been demonstrated for corn (Bing and Lewis,

1991), poppy (Quesada-Moraga et al., 2006) and cocoa (Posada and Vega, 2005). Posada et al. (2007) used sprays, drench and injection to inoculate coffee plants with B. bassiana. In the coffee plants, Beauveria was recovered from only one plant injected with spores after 6 months, while no other treatment resulted in recovery after 2 months. Quesada-Moraga et al. (2006) showed that a strain of B. bassiana could become endophytic after spraying on opium poppy plants; 40% of plants grown from seed coated with B. bassiana were positive for endophytic Beauveria. Posada and Vega (2005) found that while B. bassiana would enter cocoa plants, it did not persist beyond 2 months in the plants. Similarly, we found infection of pine seedlings with two isolates of B. bassiana originally obtained from mature pine trees could not be detected using the described experimental methods beyond 9 months. Beauveria was recovered from only one plant (in a sterile root sample) at 9 months. There was no obvious change in plants infected with B. bassiana in the current study, including no apparent differences in growth (data not shown). There is no question that B. bassiana can be endophytic in mature Pinus trees and even seed (e.g. Reay et al., 2010; Ganley and Newcombe 2006), suggesting longterm associations over the life of the plant. It may be that the cultural methods used to recover the fungus are not sensitive enough to detect fungus in all situations, that the associations with plants are strain-specific, occur naturally at low levels of incidence, or can occur at different times throughout the life of a plant. However, we used strains recovered from mature pines, which could be expected to be adapted to endophytic lifestyle. It was interesting that from both root dip and seed coating, the fungus could move from plant into soil effectively in the first months. The current study did not resolve whether B. bassiana multiplies in the soil or plant rhizosphere. However, our results showed that Beauveria propagules (measured as colony forming units) declined and virtually disappeared from soil samples over 9 months, suggesting little multiplication in either the soil or plant rhizosphere. Both isolates were recovered from needles when the root dip method was used to inoculate pines, indicating translocation of the fungus within seedlings. It is unknown whether endophytic colonization of pines by B. bassiana is in any way beneficial to the tree. Other studies on B. bassiana as endophytes have shown some effects against insects in maize (Bing and Lewis, 1991; Cherry et al., 2004), bananas (Akello et al., 2008a,b) and poppies (Quesada-Moraga et al., 2009). It has


also been demonstrated that B. bassiana can reduce impacts of soilborne mycopathogens of plants (Ownley et al., 2004, 2008, 2010; Vega et al., 2009). Further research is required to investigate effects of Beauveria colonization in pines. There were a number of instances of inconsistent recovery of the fungus from treated plants. For example for F647 MC at the 4 months sample point, B. bassiana was isolated from all five soil and washed root samples, yet was not recovered from unwashed root samples taken from these seedlings. This result indicates that the methods used to isolate B. bassiana may not be sensitive enough to ensure recovery of low levels of inoculum, and results may in fact under-represent the actual incidence of B. bassiana in the test samples. The low recovery rates may be a result of competition from other fungi and bacteria in the system, leading to inhibition of B. bassiana germination or growth. It is also possible that the surface sterilisation method used on small sections of plant material may have inhibited outgrowth, although this would not explain the lack of recovery from unwashed root. Quesada-Moraga et al. (2009) suggested that microbiological methods were not as sensitive as molecular-based methods, as few fungal fragments are likely to be present in plant pieces. Future studies that explore the relationships and distribution of the fungus will greatly increase the certainty or reliability of isolation results, and need to be combined with molecular techniques that can detect low levels of test fungi even if their growth on a standard isolation medium is inhibited. Consequently, research is needed to develop more rigorous molecular methods of detection. The identification of specific primers may also provide a means of differentiating among background fungal colonizers and the inoculated species. The inability to be able to detect significant differences among treatments may be a consequence of the relatively small number of positive samples identified and the apparent variability in isolation success. In the current study, other fungal endophytes were also isolated on the semi-selective agar. Two, Geomyces and Lecanicillium, were identified specifically using sequencing of the elongation factor gene. Geomcyes has not previously been recorded as a significant endophyte in plants. This species was present in many of the soil samples, but presence in plants may indicate that many saprophytic fungi have the ability to enter plants. Other studies on B. bassiana as endophytes in plants have recorded other fungal and bacterial endophytes (e.g. Posada and Vega, 2005, 2006; Vega et al., 2008; Ganley and Newcombe, 2006). In the current study, B. bassiana was also recovered from samples taken from seedlings that were not inoculated with the two isolates used. While the source of this inoculum is not known and may be due to cross contamination, we have previously recovered Beauveria from surface sterilised seed (Reay et al., 2010), indicating that background infections are likely to exist. It is noteworthy that in most instances, B. bassiana was only recovered from unwashed roots or soil. If similar studies are undertaken in the future, background ‘infection’ levels of sterilised seed should be determined. It is possible that background infection provided some of the positive results obtained. However, the levels of infection recorded from treated seedlings were higher than those in the controls, indicating that background infection was unlikely to be a dominant cause of infection in these seedlings. With the development of rigorous molecular methods of isolation, molecular surveys may be effectively utilized to differentiate between background fungal strains and those used in the plant treatments. Acknowledgments We would like to thank David Wright for assistance with seed coating. This study was funded by the Foundation for Science, Research and Technology, Ecosystem Bio-Protection Programme LINX0304.

199

References Akello, J., Dubois, T., Coyne, D.S., Kyamanywa, S., 2008a. Endophytic Beauveria bassiana in banana (Musa spp.) reduces banana weevil (Cosmopolites sordidus) fitness and damage. Crop Prot. 27, 1437–1441. Akello, J., Dubois, T., Coyne, D.S., Kyamanywa, S., 2008b. Effect of endophytic Beauveria bassiana on populations of the banana weevil, Cosmopolites sordidus, and their damage in tissue-cultured banana plants. Entom. Exp. Applic. 129, 157–165. Akello, J., Dubois, T., Gold, C.S., Coyne, D., Nakavuma, J., Paparu, P., 2007. Beauveria bassiana (Balsamo) Vuillemin as an endophyte in tissue culture banana (Musa spp.). J. Invertebr. Pathol. 96, 34–42. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Bain, J., 1977. Hylurgus ligniperda (Fabricius) (Coleoptera: Scolytidae). Forest and Timber Insects in New Zealand No. 18, Forest Research Institute, New Zealand Forest Service, Rotorua, New Zealand. Balazy, S., 1968. Analysis of bark beetle mortality in spruce forests of Poland. Ekologia Polska Ser. A 16 (33), 657–687. Bing, L.A., Lewis, L.C., 1991. Suppression of Ostrinia nubilalis (Hübner) (Lepidoptera: Pyralidae) by endophytic Beauveria bassiana (Balsamo) Vuillemin. Environ. Entomol. 20, 1207–1211. Chandler, D., Davidson, G., Pell, J.K., Ball, B.V., Shaw, K., Sunderland, K.D., 2000. Fungal biocontrol of Acari. Biocon. Sci. Tech. 10, 357–384. Cherry, A.J., Banito, A., Djegui, D., Lomer, C., 2004. Suppression of the stem-borer Sesamia calamistis (Lepidoptera: Noctuidae) in maize following seed dressing, topical application and stem injection with African isolates of Beauveria bassiana. Int. J. Pest. Manag. 50, 67–73. Gan, Z., Yang, J., Tao, N., Liang, L., Mi, Q., Li, J., Zhang, K.-Q., 2007. Cloning of the gene Lecanicillium psalliotae chitinase Lpchi1 and identification of its potential role in the biocontrol of root-knot nematode Meloidogyne incognita. Appl. Micro. Biotech. 76, 1309–1317. Ganley, R.J., Newcombe, G., 2006. Fungal endophytes in seeds and needles of Pinus monticola. Mycol. Res. 110, 318–327. Glare, T.R., Reay, S.D., Nelson, T.L., Moore, R., 2008. Beauveria caledonica is a naturally occurring pathogen of forest beetles. Mycol. Res. 112, 352–360. Goettel, M.S., Inglis, G.D., 1997. Fungi: Hyphomycetes. In: Lacey, L.A. (Ed.), Manual of Techniques in Insect Pathology. Academic Press, San Diego, CA, pp. 213–249. Gómez-Vidal, S., Lopez-Llorca, L.V., Jansson, H.-B., Salinas, J., 2006. Endophytic colonization of date palm (Phoenix dactylifera L.) leaves by entomopathogenic fungi. Micron 37, 624–632. Kumar, S., Dudley, J., Nei, M., Tamura, K., 2008. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Briefings Bioinform. 9, 299–306. Mausel, D.L., Gara, R.I., Lanfranco, D., Ruiz, C., Ide, S., Azat, R., 2006. The introduced bark beetles Hylurgus ligniperda and Hylastes ater (Coleoptera: Scolytidae) in Chile: seasonal flight and effect of Pinus radiata log placement on colonization. Can. J. For. Res. 37, 159–169. Meyling, N.V., Eilenberg, J., 2007. Ecology of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae in temperate agroecosystems: potential for conservation biological control. Biol. Con. 43, 145–155. Ownley, B.H., Griffin, M.R., Klingeman, W.E., Gwinn, K.D., Moulton, J.K., Pereira, R.M., 2008. Beauveria bassiana: endophytic colonization and plant disease control. J. Invertebr. Pathol. 98, 267–270. Ownley, B.H., Gwinn, K.D., Vega, F.E., 2010. Endophytic fungal entomopathogens with activity against plant pathogens: ecology and evolution. BioControl 55, 113–128. Ownley, B.H., Pereira, R.M., Klingeman, W.E., Quigley, N.B., Leckie, B.M., 2004. Beauveria bassiana, a dual purpose biocontrol organism with activity against insect pests and plant pathogens. In: Lartey, R.T., Cesar, A.J. (Eds.), Emerging Concepts in Plant Health Management. Research Signpost, India, pp. 255–269. Posada, F., Aime, M.C., Peterson, S.W., Rehner, S.A., Vega, F.E., 2007. Inoculation of coffee plants with the fungal entomopathogen Beauveria bassiana (Ascomycota: Hypocreales). Mycol. Res. 111, 748–757. Posada, F., Vega, F.E., 2005. Establishment of the fungal entomopathogen Beauveria bassiana (Ascomycota: Hypocreales) as an endophyte in cocoa seedlings (Theobroma cacao). Mycologia 97, 1195–1200. Posada, F., Vega, F.E., 2006. Inoculation and colonization of coffee seedling (Coffea arabica L.) with the fungal entomopathogen Beauveria bassiana (Ascomycota: Hypocreales). Mycoscience 47, 284–289. Quesada-Moraga, E., Munoz-Ledesma, F.J., Santiago, A´., Lvarez, C., 2009. Systemicprotection of Papaver somniferum L. against Iraella luteipes (Hymenoptera: Cynipidae) by an endophytic strain of Beauveria bassiana (Ascomycota: Hypocreales). Environ. Entomol. 38, 723–730. Quesada-Moraga, E., Landa, B.B., Munõz-Ledesma, J., Jime˙nez-Diáz, R.M., SantiagoÁlvarez, C., 2006. Endophytic colonisation of opium poppy, Papaver somniferum, by an entomopathogenic Beauveria bassiana strain. Mycopathologia 161, 323– 329. Quesada-Moraga, E., Navas-Cortés, J.A., Maranhao, E.A.A., Ortiz-Urquiza, A., Santiago-Álvarez, C., 2007. Factors affecting the occurrence and distribution of entomopathogenic fungi in natural and cultivated soils. Mycol. Res. 111, 947– 966. Reay, S.D., Brownbridge, M., Gicquel, B., Cummings, N.J., Nelson, T.L., 2010. Isolation and characterization of endophytic Beauveria spp. (Ascomycota: Hypocreales) from Pinus radiata in New Zealand forests. Biol. Conserv. 54, 52–60.

200


Reay, S.D., Brownbridge, M., Cummings, N.J., Nelson, T.L., Souffre, B., Lignon, C., Glare, T.R., 2008. Isolation and characterization of Beauveria spp. associated with exotic bark beetles in New Zealand Pinus radiata plantation forests. Biol. Conserv. 46, 484–494. Reay, S.D., Walsh, P.J., 2002. The incidence of seedling attack and mortality by Hylastes ater (Coleoptera: Scolytidae) in second rotation Pinus radiata forests in the central North Island, New Zealand. N.Z. J. For. 47, 19–23. Reay, S.D., Walsh, P.J., Ram, A., Farrell, R.L., 2002. The invasion of Pinus radiata seedlings by sapstain fungi, following attack by the black pine bark beetle, Hylastes ater (Coleoptera: Scolytidae). For. Ecol. Manag. 165, 47–56. Rehner, S.A., Buckley, E.P., 2005. A Beauveria phylogeny inferred from nuclear ITS and EF1-a sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 97, 84–98. Rehner, S.A., De Muro, M.A., Bischoff, J.F., AF Rehner, S.A., De Muro, M.A., Bischoff, J.F., 2006. Description and phylogenetic placement of Beauveria malawiensis sp. nov. (Clavicipitaceae, Hypocreales). Mycotaxon 98, 137–145.

Vega, F.E., Goettel, M.S., Blackwell, M., Chandler, D., Jackson, M.A., Keller, S., Koike, M., Maniania, M., Monzoń, A., Ownley, B.H., Pell, J.K., Rangel, D.E.N., Roy, H.E., 2009. Fungal entomopathogens: new insights on their ecology. Fungal Ecol. 2, 149–159. Vega, F.E., Posada, F., Aime, M.C., Pava-Ripoll, M., Infante, F., Rehner, S.A., 2008. Entomopathogenic fungal endophytes. Biol. Conserv. 46, 72–82. Wagner, B.L., Lewis, L.C., 2000. Colonization of corn, Zea mays, by the entomopathogenic fungus Beauveria bassiana. Appl. Environ. Microbiol. 66, 3468–3473. Wegensteiner, R., 2004. Pathogens in bark beetles. In: Lieutier, F., Day, K., Battisti, A., Grégoire, J.C., Evans, H. (Eds.), Bark and Wood Boring Insects in Living Trees in Europe: A Synthesis. Kluwer Academic Publishers, Netherlands, pp. 291–313. Zimmermann, G., 2007. Review on safety of the entomopathogenic fungi Beauveria bassiana and Beauveria brongniartii. Biocon. Sci. Tech. 17, 553–596.