Planta (2008) 227:363–373 DOI 10.1007/s00425-007-0623-y
O R I G I N A L A R T I CL E
Wounding and pathogen infection induce a chloroplast-targeted lipoxygenase in the common bean (Phaseolus vulgaris L.) Helena Porta · Rosa Elia Figueroa-Balderas · Mario Rocha-Sosa
Received: 20 June 2007 / Accepted: 27 August 2007 / Published online: 26 September 2007 © Springer-Verlag 2007
Abstract Chloroplastic LOXs are implicated in the biosynthesis of oxylipins like jasmonic acid and C6 volatiles among others. In this study, we isolated the cDNA of a novel chloroplast-targeted Phaseolus vulgaris LOX, (PvLOX6). This gene is highly induced after wounding, nonhost pathogen infection, and by signaling molecules as H2O2, SA, ethylene and MeJA. The phylogenetic analysis of PvLOX6 showed that it is closely related to chloroplast-targeted LOX from potato (H1) and tomato (TomLOXC); both of them are implicated in the biosynthesis of C6 volatiles. Induction of PvLOX6 mRNA by wounding ethylene and jasmonic acid on the one side, and non-host pathogen, salicylic acid on the other indicates that common bean uses the same LOX to synthesize oxylipins in response to diVerent stresses. Keywords Lipoxygenase · Phaseolus · Ethylene · H2O2 · Pathogen · Wounding Abbreviations AOS Allene oxide synthase HPL Hydroperoxide lyase JA Jasmonic acid LOX Lipoxygenase MeJA Methyl jasmonate PvLOX6 Phaseolus vulgaris lipoxygenase 6
PvLOX6 accession number: EF196866. H. Porta · R. E. Figueroa-Balderas · M. Rocha-Sosa (&) Departmento de Biología Molecular de Plantas, Instituto de Biotecnología, Universidad Nacional Autónoma de México, Av. Universidad 2001, Cuernavaca, Morelos C. P. 6100, Mexico e-mail:
[email protected] H. Porta e-mail:
[email protected]
OPDA 12-oxo-phytodienoic acid SA Salicylic acid
Introduction Oxylipins are a group of oxygen-containing compounds derived from fatty acids that are involved in development and defense. The Wrst enzyme in the oxylipin biosynthesis is a lipoxygenase (LOX; linoleato:oxygen reductase, EC 1.13.11.12) that catalyzes the addition of molecular oxygen to polyunsaturated fatty acids containing a (Z,Z)-1,4-pentadiene conWguration. The products of LOX activity are 9-C or 13-C fatty acid hydroperoxides synthesized by 9-LOX and 13-LOX, respectively (Feussner and Wasternack 2002). Many 9- and 13-LOXs are located in the cytosol, but the chloroplast contains only 13-LOX. The products of the LOX reaction are then converted to diVerent oxylipins in at least six biosynthetic branches (Porta and Rocha-Sosa 2002). The allene oxide synthase (AOS) branch that leads to jasmonates, like jasmonic acid (JA) or 12-oxo-oxophytodienoic acid (OPDA), and the hydroperoxide lyase (HPL) branch that culminates with C6 aldehydes production, have been extensively characterized. The participation of chloroplastic LOXs in the AOS and HPL branches has been clearly established in several plants. In Arabidopsis thaliana, cosupression of the AtLOX2 gene reduces wound-induced JA accumulation and wound- and JA-inducible gene expression (Bell et al. 1995). In Nicotiana attenuata, antisense expression of NaLOX3 speciWcally reduces JA accumulation, expression of JA-induced genes, and resistance to Manduca sexta attack (Halitschke and Baldwin 2003). Transgenic potato plants with cosuppressed LOX H1 expression had very reduced levels of C6 aldehydes (Leon et al. 2002). In
123
364
addition, levels of C6 aldehydes in transgenic tomato plants with suppressed TomLOXC expression are strongly diminished (Chen et al. 2004). All these data highlight the relevance of plastids and 13-LOXs in oxylipin biosynthesis. Activity, protein, or mRNA accumulation of chloroplastic LOXs has been described in response to wounding or pathogen interaction in a number of non-legume plants like rice (Peng et al. 1994), potato (Royo et al. 1996), tomato (Heitz et al. 1997), wheat (Bohland et al. 1997), N. attenuata (Halitschke and Baldwin 2003), and maize (Nemchenko et al. 2006). In legumes, only one putative chloroplast-targeted LOX has been reported in Vigna unguiculata. Its mRNA accumulates in response to dehydration, high salinity, heat, and hormones implicated in stress and defense responses like abscisic acid (ABA), methyl jasmonate (MeJA), and salicylic acid (SA) (Iuchi et al. 1996). It is well established in French bean plants that the response to pathogens involves LOX activity and production of oxylipins. Croft et al. (1993) discovered that a 13LOX pathway was mainly activated after bean leaves were inoculated with Pseudomonas syringae, observing that cis3-hexenol and trans-2-hexenal were the main oxylipins produced. Moreover, induced systemic resistance (ISR) in bean plants infected with a non-pathogenic Pseudomonas putida strain stimulates 13-LOX and HPL activities, and C6 volatiles production (Ongena et al. 2004). JA accumulation has been reported in bean after infection with an incompatible Uromyces phaseoli strain (Cavallo and Raggi 2002). As a chloroplastic 13-LOX is required for C6 volatiles synthesis in potato and tomato, and for JA acid in Arabidopsis and N. attenuata, the existence of chloroplast-targeted P. vulgaris LOX seems to be a requirement for C6 volatiles production and JA biosynthesis in plant–microbe responses. Common bean is a major source of food for many countries, representing 50% of legumes consumed by humans (http://www.fao.org). Therefore understanding of defense mechanisms in this crop, like the synthesis of JA and C6 volatiles initiated by chloroplast-targeted LOXs, becomes particularly relevant. Previously several LOX cDNAs or genes from P. vulgaris have been isolated (Meier et al. 1993; Eiben and Slusarenko 1994; Porta et al. 1999; Porta and Rocha-Sosa 2000), but the lack of a chloroplastic transit peptide in their products suggests that none of them participate in JA or C6 volatiles biosynthesis. In this study a cDNA (PvLOX6) that encodes a chloroplast-targeted LOX was isolated and characterized. Experiments using a PvLOX6-GFP fusion conWrmed its chloroplastic localization. Expression analysis showed that wounding or nonhost pathogen infections, as well as signaling molecules like H2O2, SA, ethylene, and MeJA induced PvLOX6. On the basis of these observations, we suggest that common bean uses the same LOX to synthesize oxylipins against wounding and a non-host pathogen infection.
123
Planta (2008) 227:363–373
Materials and methods Plant material and plant treatments Common bean plants, P. vulgaris L. cv. Negro Jamapa (Productora Nacional de Semillas; http://www.sagarpa.gob.mx/) were grown in vermiculite, or in a hydroponics system, as described in Porta et al. (1999). Cotyledon leaves from 13-day old plants were wounded in both leaXets with dialysis forceps, and collected at indicated time intervals. Healthy leaves were collected as controls. MeJA (>90% pure, Sigma; http://www.sigmaaldrich.com/) was dissolved in N,N-dimethylformamide to prepare a 100 mM stock solution. Leaves from 13-day old plants were sprayed (10 ml for each plant) with 50 M MeJA Wnal concentration. Ethephon (99% pure, Sigma) was dissolved in ethanol (100 mM stock solution) and added to the hydroponics solution to 100 M Wnal concentration. Leaves were sprayed (10 ml for each plant) with 4 mM SA or 5 mM H2O2water solutions. To induce bacterial infection, leaves of 13-day old were syringe inWltrated (without a needle) with P. syringae pv. tabaci as described in Garcia-Ponce and Rocha-Sosa (2000). All plant material was frozen immediately after collecting in liquid N2 and stored at ¡70°C until used further. Immunoblotting Chloroplasts from non-wounded or 6-h wounded 13-day old leaves were isolated, as described by Schubert et al. (2002). Chloroplast proteins were extracted and heated at 70°C for 10 min in SDS-PAGE sample buVer. After SDS-PAGE, LOX protein was probed in chloroplast protein extracts by western blot experiments using polyclonal antibodies against Solanum tuberosum LOX H1 (Leon et al. 2002). Protein blocking was done with PBS-T/3% defatted milk (v/w) incubating overnight at 4°C followed by 1 h incubation at room temperature with the primary antibody diluted 1:1,000 in PBS-T. AP-goat anti-rabbit conjugate secondary antibodies (1:3,000 dilution; Zymed; http://www.invitrogen.com) were incubated for 30 min at room temperature. The blotted membrane was washed three times for 5 min with PBS-T after both the primary- and secondary-antibody incubation. Color was developed using BCIP/NBT substrate kit (Zymed). Relative protein band intensity was determined using the ImageJ software (http://rsb.info.nih.gov/ij/). Relative units were obtained using as reference the three more abundant bands stained in the protein gel. Immunolocalization Non-wounded or 24 h wounded P. vulgaris leaves from 13-day old plants were Wxed overnight in a glutaraldehyde–
Planta (2008) 227:363–373
formaldehyde solution (0.5–4%). Samples were dehydrated in graded ethanol and ethanol–xylol series and embedded in paraYn. Three micrometers sections were used for optical microscopy. After tissue deparaVination and rehydration, protein blocking was done with PBS-T/3% defatted milk (v/w) incubating overnight at 4°C followed by 1 h incubation at room temperature with primary antibodies against Solanum tuberosum LOX H1 (Leon et al. 2002) diluted 1:100 in PBS-T. AP-goat anti-rabbit conjugate secondary antibodies (1:1,000 dilution; Zymed) were incubated for 30 min at room temperature. Tissue slices were washed three times for 5 min with PBS-T, after both the primaryand secondary-antibody incubation. Color was developed as described above. Cloning of PvLOX6 Total mRNA from wounded leaves was used for cDNA synthesis. Total RNA (5 g) and 500 g oligo(dT25)VN were heated at 70°C for 10 min. Tubes were cooled on ice and 1 l dNTPs (10 mM), 2 l DTT (0.1 M), and 4 l Wrst strand buVer 5£ were added. Reactions were incubated at 42°C for 2 min and 1 l (200 units/l) of MoMLV-RT (Invitrogen) was added. cDNA synthesis was carried out at 37°C for 50 min. Reactions were stopped heating at 70°C for 15 min. For the PCR ampliWcation, a sample (2 l) of the Wrst strand cDNA reaction was used. PCR reactions (50 l) contained 0.1 mM upper (5⬘-GAACATCCATATCCAAG GCGTTGC-3⬘), lower (5⬘-TTCAAATTCTTCGTCCCTC AACC-3⬘) primers, designed based on V. unguiculata chloroplastic LOX sequence (accession no. BAA13542) and 2.5 units of Taq DNA polymerase (Invitrogen). Samples were ampliWed using a Gene AMP PCR System 2400 (Applied Biosystems; http://www.appliedbiosystems.com) as follows: 3 min at 94°C Wrst denaturing step; 30 cycles of 15 s at 94°C, 30 s at 58°C, and 30 s at 72°C; and 5 min at 72°C as a Wnal extension step. PCR products were analyzed by standard agar gel electrophoresis stained with ethidium bromide. The PCR product was cloned into pCR 2.1 vector, using the Topo TA cloning system (Invitrogen) and sequenced. To obtain the 5⬘-end coding sequence for PvLOX6, rapid ampliWcation of cDNA 5⬘-end (RACE 5⬘) was performed using the First choice RLM-RACE kit (Ambion; http://www.ambion.com). cDNA was obtained from 10 g of total RNA extracted from wounded common bean leaves, using the 5⬘RACE speciWc outer primer 5⬘-GA GCATCTATTTCTGAGAAAACAGG-3⬘ following the manufacturer’s instructions. The polymerase chain reaction was carried out using the 5⬘RACE inner primer 5⬘-TGTCTTCAGCGCTATCAACG-3⬘. The resulting DNA ampliWcation product was cloned in pBluescript II KS+ (Stratagene; http://www.stratagene.com) and sequenced. The complete
365
PvLOX6 cDNA was obtained using an upper primer (5⬘-AA AATGCTATAAACTAAGAAAAAGAAGG-3⬘) designed based on the 5⬘RACE sequence. The lower primer (5⬘TCACTGGGAACTTAAATTATTGC-3⬘) was designed based on 3⬘-UTR EST sequence (accession no. CV539188) 100% homologous to the partial 5⬘-cDNA PVLOX6 sequence isolated in this study. DNA and RNA extraction and gel-blot analysis Genomic DNA was extracted from 7-d old leaves according to Saghai-Maroof et al. (1984). DNA (20 g) was cleaved with NcoI or HindIII (Roche; http://www.roche.com). After separation on a 0.7% (w/v) agarose gel, DNA was denatured and blotted to Hybond-N+ membrane (AmershamPharmacia Biotech; http://www.gelifescience.com). The membrane was prehybridized in 7% SDS, 0.3 M of NaH2PO4 pH 7.2, and 1 mM EDTA and hybridized in the same buVer with the 32P-labeled random-primed PvLOX6 PCR product (406 bp). After overnight hybridization, the membrane was washed twice with 0.1£ SSC, 0.1% SDS at 65°C for 15 min and autoradiographed. Total RNA was extracted following the protocol reported by Logemann et al. (1987). RNA quality was evaluated by gel electrophoresis and quantiWed spectrophotometrically. Northern–blot analysis was performed as described in Garcia-Ponce and Rocha-Sosa (2000) using 30 g of RNA per lane and hybridized as described for Southern analysis. DNA sequencing and sequence analysis DNA was sequenced using the Taq FS Dye Terminator Cycle Sequencing Fluorescence-Based Sequencing kit (Applied Biosystems) following the instructions of the manufacturer. Computer analysis was performed with the Wisconsin Package Version 10.2, Genetics Computer Group (GCG), Madison, WI, USA. Construction of PvLOX6-GFP fusion PvLOX6 cDNA was fused to GFP using pENTR Directional TOPO cloning kit (Invitrogen). The primers used were GWforward 5⬘- CAACCATGCCGGCTAAACAAAT TCAT-3⬘, and GWreverse 5⬘-AATGGAGATGCTGTAA GGAACACC-3⬘. After cloning the PCR product, in vitro recombination was done between the entry clone and the destination vector pEarleyGate 103 (http://www.arabidopsis.org/) to produce a C-terminal fusion of PvLOX6 protein in frame with GFP-6xHis. A transient transformation assay was performed, using 13-day old Arabidopsis plants and the A. tumefaciens strain C58C1 pGV2260, as described by Tadeusz et al. (2005). Subcellular localization of PvLOX6GFP fusion-protein was done by confocal laser-scanning
123
366
microscopy using a Zeiss LSM 510 META microscope with a C-Apochromat 40£/1.2 W corr objective (http:// www.zeiss.com). The Wlter sets used were excitation laser Ar2 488 nm emission Wlters: green channel (BP 500–530), red channel (LP 560 for GFP), and chlorophyll autoXorescence, respectively. Bioinformatics
Planta (2008) 227:363–373
proteins, polyclonal primary antibodies raised against LOX H1 were used to detect an equivalent protein in P. vulgaris. Immunoblotting experiments were done using protein extracts from chloroplast isolated from wounded and nonwounded leaves from common bean. A faint band of around 100 kDa was observed in chloroplasts isolated from non-wounded leaves (Fig. 1a, lane C1), but the level of the equivalent band showed a 4-fold
Predicted amino acids sequence of chloroplast LOXs were aligned using Clustal W (Thompson et al. 1994) at WWW Service at the European Bioinformatics Institute (http:// www2.ebi.ac.uk/clustalw). An unrooted tree was constructed, using the maximum parsimony algorithm with bootstrap (1,000 replicate trees), by the PAUPsearch program (Wisconsin Package Version 10.2, Genetics Computer Group; GCG, Madison, WI, USA). Trees were drawn using the TreeView program (Page 1996). Accession numbers are shown in parentheses. A. thaliana AtLOX2 (At3g45140), A. thaliana AtLOX3 (At1g17420), A. thaliana AtLOX4 (At1g72520), A. thaliana AtLOX6 (At1g67560), Citrus jambhiri (BAB84352), Hordeum vulgare Lox 2:Hv:1 (P93184), H. vulgare Lox 2:Hv:2 (Q8GSM3), H. vulgare Lox 2:Hv:3 (Q8GSM2), Nicotiana attenuata LOX2 (AAP83137), N. attenuata LOX3 (AAP83138), Oryza sativa LOXC (NP001062200), O. sativa Lox2 (NP0010446180), O. sativa RC1 (AJ270938), Phaseolus vulgaris PvLOX6 (EF196866), Populus deltoides LOX1 (AAZ57444), P. deltoides LOX2 (AAZ57445), Sesbania rostrata LOX1 (CAC43237), Solanum lycopersicum LOXC (AAB65766), S. lycopersicum LOXD (AAB65767), Solanum tuberosum H1 (X96405), S. tuberosum H3 (X96406), V. unguiculata (BAA13542), Zea mays LOX10 (DQ335768), Z. mays LOX11 (DQ335769).
Results Wounding induced a P. vulgaris chloroplast-targeted LOX To understand the molecular responses to wounding or pathogen infection in P. vulgaris, particularly those involving oxylipin production, we have previously isolated several LOX cDNAs, whose mRNA accumulated upon wounding or pathogen infection (Porta et al. 1999; Porta and Rocha-Sosa 2000). None of the deduced proteins encoded by these cDNAs seem to contain a chloroplasttransit peptide; however, chloroplast-targeted LOXs must be required for oxylipins like jasmonates and C6 volatiles biosynthesis in common bean, as demonstrated for other plants. S. tuberosum chloroplastic LOX H1 (101 kDa) is usually induced by wounding, and other eVectors (Leon et al. 2002). On the basis of the high identity between LOX
123
Fig. 1 Lipoxygenase (LOX) from P. vulgaris is induced in chloroplast after wounding. a Chloroplastic LOX isoform is enriched in chloroplasts isolated from wounded leaves. Left panel, protein extracts (20 g) from chloroplasts isolated from control (lane C1) and 6 h wounded leaves (lane W1) was detected by Western blotting using antibody against anti-H1 (Leon et al. 2002) as primary antibody, and anti-rabbit antibody as secondary antibody. Arrows point the position of chloroplast-targeted LOX. Coomassie Blue staining of respective extracts is shown in lanes C2 and W2 (right panel). Lane M, molecular markers in kDa. b Immunolocalization of chloroplast PvLOX6 protein in P. vulgaris in a wounded wild-type leaf section and c in a nonwounded leaf. Leaf sections were incubated with antibodies against anti-H1 (Leon et al. 2002) as described in “Material and methods”. Epidermal (e), parenchyma (p), and mesophyll (m) cells. Scale bar 20 m
Planta (2008) 227:363–373
increase in chloroplast isolated from wounded leaves (Fig. 1a, lane W1). To verify the localization of chloroplasttargeted LOX, immunohistochemical analysis was performed using the same primary antibodies as those in the western blot analysis. The result indicated that the LOX protein was heavily accumulated in chloroplasts of palisade, parenchyma, and mesophile cells from wounded tissue (Fig. 1b). On the other hand, a very faint signal was detected from the analysis of non-wounded tissue.These results clearly demonstrate that common bean contains a wound-induced chloroplastic LOX.
367
a
ATG
TAA
406 PvLOX6
1115 2805
b
Cloning of a wound-induced chloroplast-targeted LOX Once the presence of common bean chloroplastic LOXs was demonstrated, we decided to clone a wound-induced chloroplast-targeted LOX. To design chloroplastic LOX speciWc primers, a multiple alignment of cytoplasm and chloroplasttargeted LOXs from several plants was constructed (data not shown). Using these primers, a cDNA product of 406 bp was ampliWed from total RNA isolated from P. vulgaris wounded leaves, and was cloned and sequenced. This product shares 85% similarity with a V. unguiculata chloroplast LOX (accession no. BAA13542). The 5⬘-end of this putative P. vulgaris chloroplast LOX gene was obtained, using 5⬘RACE. A 1,110 bp long cDNA product was ampliWed, its deduced protein is 86% similar to the V. unguiculata chloroplastic LOX. With this sequence, a BLAST search was done at Phaseomics (http://www.ccg.unam.mx/phaseolusest/ Data_download.htm), the international consortium for Phaseolus genomics database (Ramirez et al. 2005). A 100% identical EST (accession no. CV538989) was identiWed, but this clone lacked its 5⬘-end. To obtain the whole cDNA sequence, an upper primer was synthesized, based on the 5⬘-UTR 1,100 bp cDNA sequence, and the lower primer was designed based on the 3⬘-UTR CV538989 EST sequence. A 2,805 bp long cDNA product (accession no. EF196866) was ampliWed from total RNA isolated from P. vulgaris wounded leaves, using these primers (Fig. 2a). This cDNA sequence comprised a 40 bp long 5⬘-UTR, a 2,706 bp long open reading frame, and a 58 bp long 3⬘UTR sequence, and was called PvLOX6. The deduced PvLOX6 protein had 902 amino acids with a molecular mass of 102.8 kDa. PvLOX6 shared 81, 64, and 65% amino acid sequence identity with V. unguiculata LOX, Populus deltoides LOX1 (accession no. AAZ57444), and S. tuberosum LOX H1 (accession no. X96405), respectively. PvLOX6 contains conserved residues among plant LOXs, including those involved in catalysis, like His residues 560, 565, and 752, Asp 756 and Ile 836 residues (Fig. 2b). A chloroplast-transit peptide was predicted in the amino terminus of PvLOX6, using Predotar (http:// urgi.versailles.inra.fr/predotar/predotar.html) or ChloroP
Fig. 2 a, b Structure of PvLOX6 cDNA clones and deduced amino acid sequence. a The alignment of the partial and complete clones is shown. The 406 bp fragment was used as probe in southern- and northern blot detection. Solid box represents coding sequence. b Nucleotide and deduced amino acid sequence of chloroplastic P. vulgaris lipoxygenase PvLOX6. Underlined is the putative chloroplast transit peptide; in bold are residues involved in binding of the iron atom; and, in italics are indicated residues highly conserved among plant LOXs
123
368
(http://www.cbs.dtu.dk/services/ChloroP/). It also showed characteristic features of transit peptides that allow translocation of proteins into chloroplasts, including a high proportion of the hydroxyl amino acid S and T (16%), and a low abundance (
