Kim et al[11]. The transformed ..... [8] van Assche F, Cardinaels C, Clijsters H. Induction of enzyme ... [11] Kim K N, Lee J S, Han H, Choi S A, Yoon E S. Isolation.
a&f
#. Actu Genetica Sinica.
May
2006,
ISSN 0379-41 72
33 (5): 4 4 1 4 8
Isolation and Expression Analysis of Plastidic Glucose-6phosphate Dehydrogenase Gene from Rice (Oryza saliva L.) HOU Fu-Yun', HUANG Ji', LU Ju-Fei2, WANG Zhou-Fei', ZHANG Hong-Sheng"" 1. State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 2 10095, China;
2. College of Agriculture, Yangzhou University, Yangzhou 225009, China
Abstract: Glucose-6-phosphate dehydrogenase is a rate-limiting enzyme of pentose phosphate pathway, existing in cytosolic and plastidic compartments of higher plants. A novel gene encoding plastidic glucose-6-phosphate dehydrogenase was isolated from rice (Oryzu sativa L.) and designated OsG6PDH2 in this article. Through semiquantitative RT-PCR approach it was found that OsG6PDH2 mRNA was weakly expressed in rice leaves, stems, immature spikes or flowered spikes, and a little higher in roots. However, the expression of OsG6PDH2 in rice seedlings was significantly induced by dark treatment. The complete opening reading frame (ORF) of OsG6PDH2 was inserted into pET30a (+), and expressed in Escherzchia coli strain BL21 (DE3). The enzyme activity assay of transformed bacterial cells indicated that OsG6PDH2 encoding product had a typical function of glucose-6-phosphate dehydrogenase. Key words: rice; glucose-6-phosphate dehydrogenase; gene cloning; expression analysis
Pentose phosphate pathway (PPP) is an important metabolism pathway in plants. It provides niotinamide adenine dinucleotide phosphate (NADPH) for reductive synthesis, and intermediate metabolites for many biosynthetic processes, such as ribose-5-phosphate and etythrose-4-phosphate, which are precursors for biosynthesis of aromatic amino acids, nucleic acids and coenzymes"'. Glucose-6-phosphate dehydrogenase (G6PDH)
ternr5'. The substantial evidences showed that transcription of G6PDH genes or their enzymatic activities were prominently increased in plants in response to stresses including pathogenesis[6', osmotic stress'71 and metal toxicity[81. The OsG6PDH1, cytosolic G6PDH gene, was previously cloned from rice (Olyza sativa L.), and its mRNA was constitutively expressed in various tissue of rice, such as roots,
oxidizes glucose-6-phosphate to 6-phosphogluconate and reduces NADP' to NADPH in PPP. Since it is the invertible step of this pathway, G6PDH is known as a rate-limiting enzyme in PPP. G6PDH has been found in both cytosolic and plastidic compartments of cells in higher plants""'. The plastidic G6PDH isoforms in
stems and leaves'". In this article, we report the isolation and expression of a plastidic G6PDH gene (OsG6PDH2) of rice, which can be very helpful in further understanding the molecular mechanism and biochemical functions of PPP in plants.
plants are classified into two classes, P1 and P2, based on their differences in amino acid sequence and protein immune character is ti^'^'. P1 is tightly regulated by photosynthetic redox system in green tissues, while P2 is a little insensitive to photosynthetic sys-
1 Materials and Methods 1.1 Plant materials and stress treatment Rice seeds (0. sativa sub. Japonica) cv. Jiucaiqing were surface-sterilized using 10% NaClO and
Received: 2005-04-23; Accepted: 2005-09- 13 This work was supported by the National Transgenic Plant Research Program in China (No.JY03AI I O I ) , Major Project of Province Key Laboratory of Plant Functional Genome in Yangzhou University (No.KJS03098) and Changjiang Scholars and Innovative Research Team in University(PCS1RT).
@ Corresponding author. E-maiI:hszhang@njau,edu.cn
442
a{%%$$Acta Genetica Sinica
Vo1.33 No.5 2006
washed with tap water for germination in the incuba-
extension at 72°C for 10 min. PCR products were sepa-
tor at 30°C. The germinated seeds were grown in sand
rated on a l % agarose gel and purified by Gel Extraction Kit (HuaShun, Shanghai, China) according to the
irrigated with common nutritional solution in a climate chamber with 16 h light (30°C) and 8 h darkness (22°C) as suggested by Huang et a1 "I. Seedlings at 3 4 leaf-stage were treated under continuous darkness "'I. These plant materials were collected at various times after treatment, quickly frozen in liquid nitrogen and stored at -80°C for RNA isolation. Seedlings were
also transplanted in the experimental fields of Nanjing Agricultural University in the normal season. One week before flowering and after flowering, roots, stems, leaves, and spikes were separately harvested and immediately stored at -80"Cfor RNA isolation.
1 . 2 RNA preparation and first strand cDNA synthesis
manufacture's protocol. The purified product was cloned into the vector pGEM-T (Promega, USA) and sequenced by BBST (Shanghai, China).
1.4 Sequence analysis The analysis of nucleotide sequence and prediction of signal peptide were conducted with DNAssit and Signal P2.0 (http://genome.cbs.dtu.dk), respectively. To explore the potential function of OsG6PDH2, the 1 500 bp sequence upstream the translation initiation codon of OsG6PDH2 was extracted from rice genome database in GenBank and analyzed for the putative transcription factor binding sites using the TRANSFAC database (http://www.
Total RNAs were prepared from rice seedlings or various tissues using Trizol Regeant (HuaShun, Shanghai, China) according to the manufacture's instructions. The first strand cDNAs were synthesized with 2 pg of
transfac.gbf.de/). The sequence alignment was per-
purified total RNAs @retreated with DNase I ) using the RT-PCR system (Promega, USA).
with full amino acids of plant G6PDH proteins by MEGA2 program (version 2.0).
1.3 Cloning of OsG6PDH2 cDNA from rice
1.5 Enzymatic activity assay
Cloning of OsG6PDH2 cDNA was performed following the method suggested by Huang et ~ 1 ' ~ ~ ' ' ' . In order to isolate the plastidic G6PDH cDNA from rice, the cDNA sequence of Arubidopsis G6PDH (GenBank accession No. AY099561) was used as a query probe to search rice genome database in GenBank through BLAST algorithm program. The highly
A 1 791 bp of cDNA fragment encoding the complete plastidic G6PDH protein was amplified using
homologous sequence with the probe obtained was assembled into the putative cDNA sequence. Based on the assembled sequence, a pair of specific primers were designed for cloning of the plastidic G6PDH gene from rice, and their sequences were as follows: (36-21: 5'-CATGGCGCTCTCCTGCATG-3' and (36-22: 5'-ATCATCTGGGTCATGCCTTC-3'. The first strand cDNA prepared from rice seedlings were used as a template of PCR. PCR conditions were a pre-denaturation of 5 min at 94°C; 35 cycles of 94"Cdenaturation for 50 s, 58°C annealing for 50 s, and 72'C extension for 90 s; a final
formed with CLULTAX (version 1.8) and viewed by GeneDoc software (Pittsburgh Supercomputing Center, USA). The phylogenetic tree was re-constructed
the sense primer (CGATATCGGCATGGCGCTCTCCTGC) and the antisense primer (CAAGCTTATCATCTGGGTCATGCCTTC) (The underlined bases were the restriction sites for EcoR V and HindIII, respectively with the same PCR conditions described as in the gene cloning mentioned earlier. The PCR fragment was purified and cloned into pET30a (+) (Novagen, Germany) to produce the construct pET30a(+)-OsG6PDH2, which was confirmed by sequencing (BBST, Shanghai, China). The E. coli strain BL21 (DE3) (Novagen, Germany) was transformed with pET30a(+)-OsG6PDH2 and the empty plasmid (pET30a (+)) for control. The assay of G6PDH activity in E. coli was conducted following the method as described by Kim et ul"". The transformed strains were incubated
HOU Fu-Yun et al.: Isolation and Expression Analysis of Plastidic Glucose-6- phosphate Dehydrogenase Gene from Rice.. . ...
in 3 mL of LB liquid media with 30 pL overnight at 37°C with aeration. When ODhooofthe media reach about 0.5, the expression of target gene was induced by adding the isopropyl-thiogalactopyanoside(IPTG) at a final concentration of 1 mmoVL. After continuous incubation for 4 h, cells were collected by a centrifugation at 4 OOO r/min and 4 "C, then re-suspended in l mL of lysing buffer (20 mmoVLTris-HC1, 5 mmoVL imidazole) for sonication. The assay of G6PDH activity was measured in 100 pL of reaction mixtures (100 mmoVL Tris-HC1, pH 8.0, 10 mmol/L MgC12,3 mmoVL NADP', 3 mmoVL G-6-P) containing 20 pL of the crude extract. The relative activity of G6PDH was determined in the Spectramax Plus (Molecular Devices, CA, USA) by measuring changes in absorbance at 340 nm under 25 "C, which represented the reduction of NADP' amount. The final results were summarized from three independent trials.
1.6
Semiquantitative RT-PCR assay
For semiquantitative RT-PCR assay, the primers and PCR parameters described earlier were used to detect the expression of OsC6PDH2 in various rice tissues. As an internal control the constitutively expressed actin gene in rice was amplified from various tissues to generate the 800 bp fragment. The sequences of the primers for actin gene are Al: S-ggaactggtatggtcaaggc-3', A2: S-agtctcatggataaccacag-3'. The PCR conditions for amplifying actin gene were a pre-denaturation of 5 rnin at 94°C; 27 cycles of 50 s at 94'C, 50 s at 56"C, 60 s at 72°C and an extension for 10 min at 72°C.
2 Results 2.1 Isolation and sequence analysis of OsC6PDH2 When the cDNA sequence of Arubidopsis G6PDH gene (GenBank accession No. AY099561) was used as a query probe to search rice genome database in Genbank, a BAC clone (APOO5462) was found to be highly homologous with the probe sequence. A putative full-length cDNA sequence was obtained by sequence assembling. With the specific primers and RT-PCR
443
approach, the cDNA fragment was amplified from the cDNA preparation of rice seedlings. Sequence analysis showed that it contained a complete opening reading frame (OW) of 1 764 bp and had 79% identity with the Arubidopsis plastidic G6PDH gene. The analysis of genomic structure revealed that it contained 10 extrons and 9 introns [lZ1.It has been designated OsG6PDH2 and deposited in GenBank with accession number AY339367. The predicted product of OsG6PDH2 comprised of 588 amino acids with a calculated molecular mass of 66 KDa and isoelectric point of 8.5. Like most of plastidic G6PDH enzymes previously reported, OsG6PDH2 had a putative transit peptide at its N-terminus and a cleavage site between Gly55 and Va156. One conserved G-6-P binding site (IDHYLG) and two conserved cysteine residues ( C Y S ' and ~~ C Y S ' ~were ~ ) found in OsG6PDH2 (Fig. 1). The conserved cysteine residues may be responsible for the thiol-regulation of plastidic G6PDHs in higher plants [13]. The OsG6PDH2 had 81%-87% of identities in amino acid with the plastidic G6PDHs from Arubidopsis (Accession No. AAM20413), tobacco (Accession No. AAF87216), and potato (Accession No. BAC23041), but only 49% with its cytosolic counterpart OsG6PDH1 (Accession No. AAL79959). On the phylogenetic tree of G6PDH proteins in higher plants (Fig. 2), the cytosolic G6PDHs including rice OsG6PDH 1, wheat TaG6PDH1, alfalfa MsG6PDH1, and tobacco NtG6PDHl were grouped into one class and the plastidic G6PDHs into another, which were further separated into P1 and P2 types. The type of P1-G6PDH includes tobacco NtG6PDH2, Arubidopsis AtG6PDH1 and spinach SoG6PDH1, whereas the P2-G6PDH contains rice OsG6PDH2, tobacco NtG6PDH3, Arubidopsis AtG6PDH3 and potato StG6PDH1.
2. 2 Analysis of the cis-elements in the promoter region of OsG6PDH2 Within 1 500 bp sequence upstream translation initiation codon (ATG) of the OsG6PDH2, several important cis-elements were identified with Matinspector atinspector progrm. A bZIP transcription factor binding
%f%’%d
444
OsG6PDH2 StG6PDHI AtG6PDHI NtG6PDH2 OsC6PDHI
: : : : :
OsG6PDH2 StG6PDHI AtG6PDHI NtG6PDH2 OsG6PDHI
: : : : :
OsG6PDH2 StG6PDHI AtG6PDHI NtG6PDH2 OsG6PDH1
: : :
OsG6PDH2 StG6PDHI AtG6PDHI NtG6PDH2 OsG6PDHI
: : :
Acta Genetica Sinica
vo1.33 No.5 2006
:
:
:
:
OsG6PDH2 StG6PDHI AtG6PDHI NtG6PDH2 OsG6PDH1
: : : :
OsG6PDH2 StG6PDHl AtG6PDHI NtG6PDH2 OsG6PDHI
: : : : :
OsG6PDH2 StG6PDHI AtG6PDHl NtG6PDH2 OsG6PDH1
: : : :
OsG6PDH2 StG6PDHl AtG6PDHl NtG6PDH2 OsG6PDHI
: : : : :
:
:
Fig. 1 Alignment of OsG6PDH2 with several plant G6PDH proteins The conserved G-6-P binding site and redox regulatory CysI4’ and CysI5’ are underlined and marked by asterisks, respectively. GenBank accession numbers of G6PDH proteins are NtG6PDHP2 (AAF87216, Nicotiana tabucum),StG6PDH 1 (BAC23041, Sokunwn tuherosum), OsG6PDH2 (AAQ0267 1, Oryza sativa),At5g35790 (AAM204 13, Arabidopsis), and OsG6PDH 1 (AAL79959, Oryza sutiva).
sites, an ABA responsive element,.a CRT/DRE element and one W-box existed in the promoter region of OsG6PDH2 at 446 to 464 bp, 757 to 783 bp, 412 to 424 bp, and 279 to 293 bp, respectively.
2 . 3 Expression of OsG6PDH2 cDNA in E. coli To c o b the enzymatic activity of OsC6PDH2 en&g protein, the complete ORF of OsG6PDH2 was in-
serted into pE?TOa(+) vector, then the recombinant plasmid
pET3Oa(+)-OsG6PDH2 and the empty vector were independently transformed into the E. coli strain BL21(DE3)and expressed by adding IPTG The crude enzyme extracts of cells after sonication were directly d e ~ t e for d the enzymatic activities, whichwere r e p a n t e d as the changes in absorbance values in the Spectramax Plus. The results showed that the activity of the cells containing pET’30a(+)-OsG6PDH2
HOU Fu-Yun
ef ul.: Isolation
and Expression Analysis of Plastidic Glucose-6- phosphate Dehydrogenase Gene from Rice., ....
445
NtG6PDH3 94
StG6PDH 1 AtG6PDH3
L O s G 6 P D H 2
99
I
I
p2
AtG6PDH1 loo
7
7 82
NtG6PDH2 SoG6PDH 1 DbG6PDH 1
100
OsG6PDH 1 TaG6PDH 1
Cytosolic G6PDH
NtG6PDH 1
5d
I 4
81
I AtG6PDH6
' 0. I
Fig. 2 Phylogenetic tree of plant G6PDH proteins The Arabian numbers in the figure is trustful percentage using bootstrap method and the scare bar represents evolution unit. The accession number of plant G6PDH proteins in GenBank are as follows: NtG6PDH3 (CAA04994, Nicotiunu tabacum), StG6PDH1 (BAC23041, Solanum tuberosum), AtG6PDH3 (AACOO588, Arabidopsis), OsC6PDH2 (AAQ02671, Oryza sativa), AtG6PDHI (Q43727, Arabidopsis), NtG6PDH2 (AAF872 16, Nicotiana fahacum), SoG6PDH 1 (T09088, Spinacia oleracea ), DbG6PDHI (CAB52685, Dunaliellu bioculutu), PsG6PDH 1 (AAR26303, Populus suaveolens), OsG6PDH 1 (Oryza sativa, AAL79959), TaC6PDH 1 (BAA97662, Triticum uestivum), MsG6PDH 1 (AAB41552, Medicaga sativa), NtG6PDHI (Nicotiana tabacum, CAA04993), AtG6PDHS (Q9LK23, Arabidopsis), and AtG6PDH6 (Q9FJI5, Arabidopsis).
was three folds higher than thaf of the cells carrying empty PETE%(+) (Fig.3). The IPTG could sigruficantly increase the G6PDH activity, probably through inducing more expression of pET-3Oa(+)-OsC6PDH2in the transformed cells. This indicated that OsC6PDH2 might be a functional gene encoding G6PDH protein since the fusion protein had the activity of G6PDH. 2.4
then declined to the baseline level at 16 h (Fig. 5).
Expression of OsG6PDH2
Using semiquantitative RT-PCR assay, the transcription level of OsC6PDH2 was detected in rice roots, stems, leaves, immature spikes about 1 week before flowering, and spikes 1 week after flowering. The OsG6PDH2 gene was slightly expressed in various rice tissues but only in roots (Fig. 4).However, the transcripts of OsC6PDH2 in rice seedlings were significantly induced by dark treatment. It reached the peak at 4 h after dark treatment and
1
2
3
Induction of recombinant OsG6PDH2activity in E. cot% 1,2, and 3 represent the cells containing pET-30a(+), pET-3Oa(+)OsG6PDH2 uninduced by IPTG and PET-30a (+)-OsG6PDH2 induced by IPTG respectively.
Fig. 3
%f$?#
446
1
2
3
4
5
OsG6PDH2
Acta Genetica Sinica Vo1.33 No.5
2006
the plastidic G6PDH (OsG6PDH2) mRNA in rice seedlings was induced by dark treatment. According to their differences in amino acid sequences and immune characteristic, the plastidic
actin
Fig. 4 Expression of OsG6PDH2 in various rice tissues 1-5 indicate roots, stems, immature spikes, leaves, and spike 1 week after flowering, respectively. 0
4
8
16
24h OsG6PDH2 actin
Fig. 5 Expression of OsG6PDH2 in rice seedlings at different times after dark treatment
3 Discussion Glucose-6-phosphatedehydrogenase (G6PDH) is present in cytosolic and plastidic compartmentsof cells in higher plants. Both cytosolic G6PDH and plastidic G6PDH have a conserved G-6-P binding site, similar molecular weight and isoelectric point, but the plastidic G6PDH has an additional transit peptide in its amino acid sequences [I4]. In rice, there is only 49% identity in amino acids between the OsG6PDH2 and its cytosolic counterpart OsG6PDH1, and cytosolic G6PDH gene has five more exons than its plastidic counterpart. By viewing the phylogenetic tree, cytosolic G6PDH genes in plants may have a common ancestor with those from animal and fungal, but plastidic G6PDH genes probably originated from prokaryote [151. The activities of two forms of G6PDH are inhibited by high concentrations of NADPH, and in vivo are tightly modulated by the redox balance of the NADPW NADP' pool. In addition, palstidic G6PDH is redox modified by the ferredoxidthioredoxin (Fd/Td) system [163171. During photosynthesis, NADP' is redoxed by the photosystem I , and the plastidic G6PDH is inactivated via dithiol-disulfide protein m interaction in green tissues [Ig1. Therefore, the oxidative steps of PPP are unnecessary, and plastidic G6PDH has its activity only in dark circumstance. In this experiment,
G6PDH proteins in plants are divided into two groups: P1 and P2. Although the activities of both P1 and P2 are inhibited by NADPWNADP', and inactivated by dithiothreitol (DTT), the P2 enzymes are strikingly less sensitive than the P1 enzyme to two forms of NADPH m~dulation[''~.Therefore, the activities of P2 enzymes are higher than P1 in plant cells. In general, the transcripts of P1 isozyme are most prominent in green tissues and the P2-G6PDH mRNA expressed with highest steady-state transcript levels in roots [I1. The higher expression of P2 genes has been observed in roots of tobacco, tomato and Arubidopsis upon exposure to nitrate [201. Recent studies reported that a plastidic isoform of G6PDH in barely roots had properties similar to those of P2, and was induced in response to ammonium or glutamate [211. Our results demonstrated that OsG6PDH2 mRNA was weakly expressed throughout the plant tissues, but a little higher in roots. This suggests that OsG6PDH2 encoding product may be the P2 form plastidic G6PDH involved in nitrite reduction or glutamate assimilation. The two-cysteine residues are responsible for the thiol-ferredoxin regulation of plastidic G6PDH in potato, and are involved in the function of plastidic G6PDH under lighddark reaction [221. In this article, the OsG6PDH2 was regulated by dark treatment, which might be related with two highly conserved cysteine residues (Cys14' and C Y S ' ~ ~ ) . Pentose phosphate pathway (PPP) is an important metabolism pathway in plants. A number of reports showed that the transcription of G6PDH mRNA or G6PDH activity was changed in plants in response to stresses including pathogenesis, osmotic stress and metal toxicity, or during seed germination and plant senescence [6-8*231.However, it is not clear how the plants regulate the efficiency of PPP in the molecular level during these processes. In rice, both the cytosolic G6PDH gene (OsG6PDHl) and plastidic G6PDH gene (OsG6PDH2) were subsequently isolated and
HOU Fu-Yun et al.: Isolation and Expression Analysis of Plastidic Glucose-6- phosphate Dehydrogenase Gene from Rice.. ....
441
2004,41(2) : 243-256. showed different expression patterns in various rice [6] Sindelar L, Sindelarova M, Burketova L. Changes in tissues. The OsC6PDHI mRNA was highly expressed activity of glucose-6-phosphate and 6-phosphogluconate in immature spike, roots and leaves"I, whereas dehydrogenase isozymes upon potato virus Y infection in OsC6PDH2 was weakly expressed in various rice tistobacco leaf tissues and protoplast. Plant Physiol Biosues but a little higher in roots (Fig. 4).Wendt ef ~ 1 . " ~ ~ chem, 1999, 37(3) : 195-201. and Knight et u ~ . [ * ~ I found that the transcripts of [7] Nemoto Y, Sasakuma T. Specific expression of gluP2-G6PDH gene are highly expressed in the roots of cose-6-phosphate dehydrogenase (G6PDH) gene by salt stress in wheat (Triticum nestivum L.). Plant Sci, 2000, potato and tobacco, respectively. Different expression 158(1-2) : 53-60. patterns of G6PDH isoenzyme genes indicate that they [8] van Assche F, Cardinaels C, Clijsters H. Induction of may participate PPP in organ-specific manner. The enzyme capacity in plants as a result of heavy metal toxprediction of transcription factor binding sites demonicity:dose-response relations in Phaseolus vulgaris L. strated that a bZIP protein recognition sites, an ABA treated with zinc and cadmium. Environ Pollut, 1988, responsive element, a CRTDRE element and a W-box 52(2) : 103-115.
exist in the promoter region of OsC6PDH2. Anderson et ~ 2 1 . ' ~found ~' that the bZIP binding site was related to the light regulation of plastidic G6PDH in PPP in pea. Therefore, bZIP recognition site may be involved in the light-regulated expression of OsC6PDH2. W-box is the recognition sites for WRKY transcription factors, suggesting that OsG6PDH2 may play a role in response to defenses or osmotic stress[261.CRTDRE and ABA responsive elements may be correlated with 0smotic stress. As a key enzyme of PPP, cloning of two G6PDH genes from rice could be helpful to study the molecular mechanism and biochemical function of PPP in plants.
References:
[9] HUANG Ji, WANG Jian-Fei, ZHANG Hong-Sheng, CAO Ya-Jun, LIN Chang-Fa, WANG Dong, YANG Jin-Shui. In silico cloning of glucose-6-phophate dehydrogenase cDNA from rice. Acta Genet Sin, 2002, 29( 1 1 ) : 1012-1016 (in Chinese with an English abstract). [lo] HUANG Ji, ZHANG Hong-Sheng, CAO Ya-Jun, QIAN Xiao-Yin, YANG Jin-Shui. Strategy of in silico cloning of functional genes in rice. Chinese J Rice Sci, 2002, 16(4) : 295-298 (in Chinese with an English abstract). [ 111 Kim K N, Lee J S, Han H, Choi S A, Yoon E S. Isolation
and characterization of a novel rice Ca2'-regulated prtein kinase gene involved in responses to diverse signals including cold, light, cytokinins, sugars and salts. Plant Mol Biol, 2003,52(6) : 1191-1202. [12] White 0, Soderlund C, Shanmugan P, Fields C. Information contents and dinucleotide compositions of plant in-
[I] HUANG Ji, WANG Jian-Fei, ZHANG Hong-Sheng. Advances on plant pentose phosphate pathway and its key
tron sequences vary with evolutionary origin. Plant Mol
enzymes. Chinese Bull Bot, 2004, 21(2) : 139-145 (in
[I31 Jeffery J, Hobb S, Jornvall H. Glucose-6-phosphate dehydrogenase from Saccharomyces cerevisiac: characteri-
Chinese with an English abstract). [2] Hauschild R, Von Schaewen A. Differential regulation of glucose-6-phosphate dehydrogenase isoenzyme activities in potato. Planr Physiol, 2003, 133(1) : 47-62.
[3] Schnarrenberger C, Oeser A, Tolbert N E. Two isozymes each of glucose-6-phosphate dehydroenase and 6-phosphogluconate dehydrogenase in spinach leaves. Arch BiochemBiophys, 1973, 154(1) : 438-448. [4] Wendt U K, Hauschild R, Lange C, Pietersma M, Wenderoth I, von Schaewen A. Evidence for functional convergence of redox regulation in G6PDH isoform of cyanobacteria and higher plants. Plant Mol Biol, 1999, 40(3) : 487-494. [5] Wakao S, Benning C. Genome-wide analysis of glucose-6-phosphate dehydrogenase in Arabidopsis. Plant J,
B i d , 1992, 19(6) : 1057-1064.
zation of s reactive lysine residue labled with acetylsalicylic acid. Biochemistry, 1985, 24(4) : 666-67 1. von
Schaewen
A, Langenkamper G,
Graeve
K,
Wenderoth I, Scheibe R. Molecular characterization of the plastidic glucose-6-phosphate dehydrogenase from potato in comparison to its cytosolic counterpart. Planr Physiol, 1995, 109(4) : 1327-1335. HUANG Ji, HOU Fu-Yun, WANG Jian-Fei, ZHANG Hong-Sheng. Evolution styles of glucose-6-phosphate dehydrogenase and 6-phosphaogluconate dehydrogenase genes in higher plants. Chinese Bull Bot, 2005, 22(2) : 138-146 (in Chinese with an English abstract). [ 161 Scheibe R,Geissler A, Fickenscher K. Chloroplast glu-
cose-6-phosphate dehydrogenase: Km shift upon light
448
modulation and reduction. Arch Biochem Biophys, 1989, 274( 1) : 290-297. Wenderoth I, Scheibe R, van Schaewa A. Identification of the cysteine residues involved in redox modification of plant plastidic glucose-6-phosphate dehydrogenase. J Biol Chem, 1997,272(43) : 26985-26989. QU Li-Jia, GU Hong-Ya, BAI Shu-Nong, ZHAO Jin-Dong. Plant biochemistry and molecular biology. Beijing: Science Press, 2004, 530-53 ](in Chinese).
[I91 Wendt U K, Wenderoth I, Tegeler A, Von Schaewen A. Molecular Characterization of a novel glucose-6-phosphate dehydrogenase from potato (Solanum tuberosum L.). Plant
J, 2000,23(6) : 723-733. [20] Wang Y H, Garvin D F, Kochian L V. Nitrate-induced genes in tomato roots array analysis reveals novel genes that may play a role in nitrogen nutrition. Plant Physiol, 2001, 127(1) : 345-359. [21] Esposito S, Massaro G, Vona V, Di Martino Rigano V, Carfagna S, Rigano C. Ammonium induction of a novel isoform of glucose-6-P dehydrogenase in barely roots. Physiol Plant, 2001, 113(4) : 469-476.
Bj$q~
Acta Genetica Sinica Vo1.33 No.5
2006
[22] Wendt U K, Wenderoth I, Tegeler A, Von Schaewen A. Molecular characterization of a novel glucose-6-phosphate dehydrogenase from potato (Solanum tuberosum L.). Plant J, 2000,23(6) : 723-733. [23] HAN Jian-Guo, PU Xin-Chun, M A 0 Pei-Sheng. Changes of some enzymes activities in tall Fescue seed during germination under accelerated ageing. Acta Agrestla Sin,
1998, 6(2) :84-89 (in Chinese with an English abstract). [24] Knight J S, Emes M J, Debnam P M. Isolation and characterisation of a full-length genomic clone encoding a plastidic glucose 6-phosphate dehydrogenase from Nico-
tiana tabacum. Planta, 2001, 21 2(4) : 499-507. [25] Louise E, Toh-Chin Lim Ng, Kyung E. Inactivation of pea leaf chloroplastdic and cytoplasmic glucose-6-phosphate dehydrogenases by light and dithiothreitol. Plant Physiol, 1974,53(6) : 835-839. [26] Eulgem T, Rushton P J, Schmelzer E, Hahlbrock K, Somssich L E. Early nuclear events in plant defense signaling: rapid gene activation by WRKY transcription factors. EMBO J, 1999, 18( 17) : 4689-4699.
