Primary Structure Deduced from Complementary DNA Sequence and ...

Vol. 267. No. 34, Issue of December 5, pp. 24235-24240, 1992 Printed in U.S. A.

THEJOURNAL OF BIOLOGICAL CHEMISTRY (c) 1992 by The American Society for Biochemistry and Molecular Biology, Inc

Primary Structure Deduced from Complementary DNA Sequence and Expression in CulturedCells of Mammalian 4-Hydroxyphenylpyruvic Acid Dioxygenase EVIDENCETHATTHEENZYMEIS A HOMODIMER OF IDENTICALSUBUNITSHOMOLOGOUSTORAT LIVER-SPECIFICALLOANTIGEN F* (Received for publication, April 27, 1992)

Fumio Endo$$, Hisataka AwataS, Akito TanoueS,Mariko Ishiguroll, Yasuyuki Eda,II Koiti Titanill, and IchiroMatsudaS From the $Department of Pediatrics, Kumamoto University Medical School, Honjo 1-1-1, Kumamoto 860, Japan, the (IDiuision of Biomedical Polymer Science, Institute for Comprehensive Medical Science,School of Medicine, Fujita Health University, Toyoake, Aichi 470-11, Japan, and theIlDivision of Immunology and Biology, Chemo-Sero-Therapeutic Institute, Kyokushi, Kumamoto 851-15, Japan

4-Hydroxyphenylpyruvic acid dioxygenaseis an im- enzyme and to shed light on inherited disorders related portant enzyme in tyrosine catabolism in most orga- to tyrosinemetabolism, especially tyrosinemia types 1 nisms. From porcine and human liver cDNA libraries and 3. w e isolated complementary DNA inserts for the enzyme. Protein sequence analysis of the porcine enzyme revealed a block of the amino terminusof the mature enzyme. Comparisonof the amino acid sequence deter- 4-Hydroxyphenylpyruvicacid dioxygenase (HPD)’(EC mined by Edman degradation of peptides derived from 1.13.11.27), an enzyme that participates in the catabolism of porcine liver 4-hydroxyphenylpyruvic acid dioxygenase with thenucleotide sequencesrevealed the primary tyrosine in most organisms, is present in liver and kidney. structure of the porcine and humanenzymes. The ma- Homogentisic acid is produced from 4-hydroxyphenylpyruvic involvesdecarboxylation, ture human and porcine enzymes have a n 89% amino acidby HPD,andthereaction oxidation, and rearrangement. The enzyme has been isolated acid sequence identity in amino acid residues andare from porcine (l), human (2), and avian livers (3), and the composed of 392 amino acid residues. A computerassisted homology search revealed that the enzymeis properties of the enzyme have been extensively characterized ( 2 , 4-12). Purification studies suggested that the human en88% identicalinaminoacidsequenceto rat liverzyme is ahomodimer of identical subunits with an M, of specific alloantigenF. A monoclonal antibody (mob 51), which can immu- 43,000 ( 2 ) , whereas the porcine liver enzyme was found to be composed of two nonidentical subunits with a similar M , of noprecipitate both the human and porcine enzymes, was developed. CulturedBMT-10 cells transfected 44,000 (1).The enzyme from thesesources contains iron; part with thecDNA insert of the human enzyme, using the of the enzymic activity is restored by the addition ofFez’, expression vectorpCAGGSneodE, produced a polypep- and the amino terminus of the enzyme is apparently blocked. tide with anM, of 43,000, which was immunoprecipi- The primary structure of the enzyme, from any source, has tated withmob 51. Enzymic activity of the enzyme was not been reported. Molecular cloning of the mammalian HPD detected in the transfected cells but not in the mock and elucidation of the primary structure of the enzyme is transfected cells. These findings suggest that the hu- expected to provide a basis for elucidating molecular mechaman 4-hydroxyphenylpyruvic acid dioxygenase is a nisms involved in the oxidation of 4-hydroxyphenylpyruvic homodimer of two identical subunits with an M, of acid. 43,000. Liver-specific alloantigen F seems to closely be related to the enzyme or possibly to the subunitof the EXPERIMENTALPROCEDURES enzyme itself. Elucidation of the complete amino acid sequence of the enzyme is expected to reveal structure- Isolation of Porcine Liver H P D and Development of Antibodiesfunction relationships of this metabolically important For antibody production and sequence analysis, porcine liver HPD *This work was supported in part by a grant-in-aid from the National Center of Neurology and Psychiatry (NCNP) of the Ministry of Health andWelfare, Japan and from Fujita Health University. Some data were presented at the annual meeting of the Japanese Society for Inborn Errorsof Metabolism, Takamatsu, Japan, November, 1990. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with18 U.S.C. Section 1734 solely to indicate thisfact. The nucleotide sequence($ reported in this paper has been submitted to theGenBankTM/EMBLDataBankwith accession number($ 1113390. To whom correspondence should be addressed Dept. of Pediatrics, Kumamoto University Medical School, Kumamoto 860, Japan. Tel.: 096-344-2111 (ext. 5654); Fax: 096-366-3471.

was purified as previously described (5) but withsome modifications (13). Theenzyme activity was eluted from a Mono Q column as three peaks of isozymes, the same as for the human liver enzyme (2). The enzyme in the first peakwas additionally purifiedonaSuperose column (13). Antiserum and specific IgG directed to the enzyme protein were prepared as described (13). For preparation of mousemonoclonal antibody directed against theenzyme protein, mice were immunized a t 2-week intervalswith 25-50pgof the purified protein, using Freund’s adjuvant, and hybrid cells were isolated, as described (14). These hybrid cells were monitored for production of IgG that crossreacted with the porcineliver enzyme. Mouse IgG was purified from

’ The abbreviations usedare: HPD, hydroxyphenylpyruvicacid dioxygenase; HPLC, high performance liquid chromatography; PE, pyridylethyl.

24235

24236

Mammalian 4-Hydroxyphenylpyruvic Dioxygenase Acid

radiolabeled 4-hydroxyphenylpyruvic acid as a substrate. Immunoascites fluid, as described (15) and was used for additional experiprecipitation of the HPD protein in the extract of liver or transfected ments. monoclonal antibody asfollows. Tissue Protein Sequence Analysis-Porcine H P D was reduced with tri-n- cells wascarried out using the and cells were homogenized in 50 mM potassium phosphate buffer butylphosphine (Wako Pure Chemical Co., Osaka, Japan) (16) and pyridylethylated with 4-vinylpyridine (Tokyo Kasei, Kogyo, Japan) (pH 7.4) and centrifuged a t 10,000 X g for 20 min a t 4 "C. The (17) in the presence of 7 M guanidine hydrochloride containing0.1 M enzyme-IgG complex was precipitated with ProteinA-agarose (PharTris-HCI (pH 8.5) and 1 mM EDTA and kept overnight in a dark macia LKB Biotechnology Inc.) as described (15),andthenthe room at 25 "C. The reaction mixture was separated were separated by sodium dodecyl by gel permeation proteins bound to the agarose HPLC on tandem columns of TSK G3000 S W X L (7.8 X 300 mm sulfate-polyacrylamide gel electrophoresis (34). Immunoblot analyses each, Tosoh, Tokyo, Japan) in6 M guanidine hydrochloride contain- with anti-HPD rabbitIgG were carried out by the method of Towbin ing 10 mM sodium phosphate (pH6.0), and then S-pyridylethyl(PE)- et al. (35) as described (13). protein was desalted by reversed-phase HPLC using a Bakerbond WP-C4 column (4.6 X 50 mm, J. T. Baker Inc., Phillipsburg, NJ). RESULTS Methionylbonds of thePE-protein werecleaved with cyanogen bromide in 70% formic acid, as described by Gross (18). Peptides The conventionally purified HPD from porcine liver conwere primarily separated by gel permeation HPLC on a TSK G2000 tained a single species of polypeptide with an MI of 43,000 SW XL (7.8 X 300 mm, Tosoh, Tokyo, Japan). Peptide fractions were desalted and further separated by reversed-phase HPLC on a (Fig. 1). Theresults of sodium dodecyl sulfate-polyacrylamide column of Senshu Pak VP304(2.1 X 125 mm, Merck, Germany) with gel electrophoresis and gel filtration on a calibrated Superose gradients of acetonitrile into 0.1% aqueous trifluoroacetic acid (19). column suggested that the purified porcine HPD was a homAmino acid compositions of the intact S-PE-protein andcyanogen odimer of subunits with an M , of 43,000. The purified porcine bromide peptides were determined in a Hitachi L-8500 amino acid liver HPD was used for antibody production. analyzer or with a Waters Pico-tag system (20,21). Sequence analyses An attempt at immunoaffinity isolation of porcine HPD were carried out in an Applied Biosystems 470A protein sequenator was made using the mob 51, one of the monoclonal mouse (22) connectedto a 120A phenylthiohydantoin analyzer. Oligonucleotide Probes-Mixtures of oligonucleotide probes corre- IgGs that recognizes porcine HPD. In this experiment, a sponding to the appropriate portions of the peptideswere synthesized partially purified HPD preparation (DEAE-Sephadex step, and radiolabeled at the 5' ends, with [-y-:"P]ATP (specific activity Ref. 5) was applied on a Sepharose gel column immobilized 3,000 Ci/mmol) and T4 polynucleotide kinase (23). The sequences of with mob 51 (2 mg/ml gel). The column was washed with 50 or antisense oligo- mM Tris-HC1 (pH 7.4) containing 500 mM NaCl, andproteins the parts of the peptides and corresponding sense nucleotides probes (mixtures)were as follows: probe 1, C(C/G)AA(A/ T/A/G)CCT(T/G)GA(T/G)GATT for Asn-His-Gln-Gly-Phe-Gly; were eluted with 100 mM NaPCOs(pH 11.0). A single species for of protein with an M, of 43,000 was found in the eluate probe 2, CA(A/G)GA(A/G)TA(T/C)GT(G/A/T/C)GA(T/C)TA obtained by sodium dodecyl sulfate-polyacrylamide gel elecGln-Glu-Tyr-Val-Asp-Tyr; probe 3, ATGAA(T/C)TA(T/C)AC(G/A/ T/C)GG(G/A/T/C)TG for Met-Asn-Tyr-Thr-Gly-Cys; probe 4, trophoresis (data not shown). ATGGC(G/A/T/C)AA(T/C)TA(T/C)GA(G/A)GA for Met-Ala-AsnImmunoprecipitation of human HPD fromcrude human Tyr-Glu-Glu;probe 5, CCC(G/A/T/C)AT(T/C/A)AA(T/C)GA(G/ liver homogenates was carried out using the immobilized mob A)CC(G/A/T/C)GC(G/A/T/C)CC for Pro-Ile-Asn-Glu-Pro-Ala-Pro; 51. When the immunoprecipitate was analyzed by sodium probe 6, TC(T/C)TC(G/A/T/C)GT(T/C)TT(G/A/T/C)A(G/A)(G/ dodecyl sulfate-polyacrylamide gel electrophoresis and imA/T/C)GC(G/A/T)AT for Ile-Ala-Leu-Lys-Thr-Glu-Asp. Screening of cDNA Libraries-A porcine liver cDNA library, con- munoblots were analyzed using conventional antiserum, an structed by inserting cDNA copies of poly(A') RNA from porcine immunostained protein migrated slightly faster than did the liver into theEcoRI site of bacteriophage vectorh g t l l , was purchased porcine HPD (Fig. 1). Among the monoclonal mouse IgGs, from Clontech Laboratories, Inc. (Palo Alto, CA). Approximately 6 only mob 51 cross-reacted with human HPD in the liver X 10" recombinantphageplaquesfromthe cDNA library were screened by hybridization with radiolabeled nucleotide probes. Pre- homogenate. Thus, the immunochemical procedure provided hybridization, hybridization, and washingof nitrocellulose filters were evidence that porcine and human HPD are composed of a single subunit with an MI of 42,500-43,000. carried out a t 40 "C. Other conditions were as described elsewhere (24). The second screening of porcine and human cDNA libraries with the cDNA insert as a probe was carried out asdescribed (25). A 1 2 3 4 human liver cDNA library, constructed by inserting cDNA copies of poly(A+) RNA from human liver into theEcoRI site of bacteriophage vector Xgtll, was purchased from Clontech Laboratories, Inc. Mr. DNA Sequence Analysis-Restriction fragments of the cDNA in43,000 serts were subcloned into appropriately digested pUC18. The DNA -bsequences were determined by the dideoxy chain termination method (26) (kit obtainedfrom Takara, Kyoto, Japan) using alkali-denatured plasmids as templates (27). Plasmid Construction and DNA Transfection-We used the plasFIG. 1. Sodium dodecyl sulfate-polyacrylamide gel electromid vector pCAGGSneodE (28), which contained the neomycin rephoresis of purified protein and immunoprecipitation of porsistant gene, the cytomegalovirus intermediate early enhancer, the chicken /%actin promoter, and a polyadenylation signal. Part of the cine and human enzyme. The purified protein (3 pg) (lane I ) or cDNA insert of the human HPD, which contained entirecoding, 11- immunoprecipitates(lanes 2-4) were separated on 10% polyacrylbase pair 5' noncoding, and 23-base pair 3' noncoding sequenceswas amide gels containing 0.1% sodium dodecyl sulfate, as described under inserted into the EcoRI site of the plasmid vector pCAGGSneodE. "Experimental Procedures." The gel was stainedwith Coomassie HMTlO cellsderivedfrom a monkey cell line (29) were grown in Brilliant Blue G 250 (lane I ) or analyzed by immunoblotting (lanes 10% fetal calf serum 2-4). For immunoprecipitation, crude extracts of human and porcine KPMI 1640 (GIBCO)supplementedwith (GIBCO), maintained ina 5% CO, atmosphere at 37 "C, and used for liver were incubated with mob 51 (3 pg) for 60 min a t room temperthe transfection experiments. Transfection of DNA was performed ature, and then50 p1 of protein A-agarose (Pharmacia) suspended in Tris-HCI buffer (pH 7.4, 1:1, v/v) was added to the mixture. The using lipofection (BethesdaResearchLaboratories,Gaithersburg, MD) (30), according to instructions from the supplier. The transincubation was continued for another 60 min, and then the preparafected cells were treated as described (31) and then were cultured for tion was centrifuged a t low speed. The gel pellet was washed three 21 days in the presenceof G418 and collected using a rubber police- times with ice-cold phosphate-buffered saline solution, and the proman. Cell extracts were prepared (15, 32) and used for protein assay, tein associated with the gel was analyzed by sodium dodecyl sulfateimmunoprecipitation, immunoblot analysis, and enzyme assay. For polyacrylamide gel electrophoresis, followed by immunoblotting, mock transfection, the expression vector alone was used. using anti-HPD rabbit IgG (22). Lane 2, purified porcine liver HPD; Enzyme Assay, Immunoprecipitation, and Immunoblots-The en- lane 3, immunoprecipitated human HPD; lane 4, mob 51 alone. The zyme activity of HPD was measured as described(32, 33) using arrow indicates the subunitof HPD.

-

Mammalian 4-Hydroxyphenylpyruvic Acid Dioxygenase

-

24237

A Sequenator analysisof the porcine S-PE-protein (70 pmol) c P yielded nophenylthiohydantoininthree cycles of Edman degradation. Thus, the amino terminusof porcine HPD was Iblocked. hhpdPl Amino acid sequences of seven peptides (denoted by the AhpdPS prefix M: M2, M3, M4, M5, M6, M7, and M8) were deterhhpdP14 mined partially or completely through the carboxyl terminus (Table I). On the basis of the amino acid sequences, several oligonucleotide probes were synthesized and used to screen t h e porcine liver cDNA library. Among the oligonucleotide B probes, theoligonucleotides named probe 4,5, and6 produced three positive clones. Each of these recombinant phageclones produced positivesignals withthethree oligonucleotide hhpdH3l PO~YA probes. hhpdHl poly A The nucleotide sequences of the inserts from these clones hhpdH23 and deduced amino acid sequences revealed that the cDNA inserts encode the porcine HPD precursor protein (Figs. 2 0 0.5 1.o and 3). We repeated screening of the same library and obI I I I tained additional phage clones. The nucleotide sequences of kilobase(s1 the cDNA inserts of these phage clones were determined. The human liver cDNA librarywas then screened with the cDNA FIG. 2. Partial restriction maps of porcine and human HPD insert obtained from theporcine liver library to obtain phage cDNA inserts. The open bar represents an open reading frame. A , clones carrying inserts thatcovered the entire coding region porcine cDNA inserts; B , human cDNA inserts. of human HPD (Fig. 2). Two phage clones named XhpdPl from the porcine library The firstclone XgpdPl carried a cDNA insert of 1.3 kilobases and XhpdH31 from the human librarywere analyzed in detail. and covered theentire codingsequence of porcine HPD mRNA. The XhpdH31 carried a 1.5-kilobase insert with 21TABLE I base5'-untranslated,full-length coding, and 202-base 3'Summary of amino acid sequence analysis of cyanogen bromide (M) untranslated regions. peptides Both the porcine and human cDNA inserts contained an open reading frame that could be translated to 393 amino Cycle M2 M3 M4 M6 M5 M7 M8 M8-K2 acid residues (Figs. 3 and 4). The nucleotide sequence sur1Glu Asn Glv Am Ala Gln Pro Ala rounding the putative initiation codon in the human cDNA Asn Ile Phe 2 Asp AS; Ser ASP TYr Glu Thr 3 His Ala Leu insert was similar to the consensus sequencedescribed by TYr Asn Arg Leu Glu 4 Glu Glu Gln Gln Pro GlY Kozak (36). A polyadenylation signal was present at 180 base Glu Pro 5 Val Glu Thr Cys" T r p Phe pairs downstreamof the stopcodon of TAG in humancDNA. Gln Val Ser Ala 6 LY s Phe Tyr His Northern blot analysis of mRNAindicated onlya single Pro Glu Ile 7 His Meth Arg Phe Leu species of mRNA was present in the humanliver, and size of Leu Phe 8 GlY Leu Pro LYs GlY themRNA for human HPD was estimatedtobe 1.7-1.8 9 ASP Meth LYs Glu Arg TrP GlY 10 GlY Val Phe Ser kilobases long (data not shown). G~Y LYs 11 Val Ile Asn Val Glu LY s The predicted primary structures of porcine and human 12 LSY Ser Gln Leu Ala ASP HPD precursorproteins were compared withthepartial Thr Gln 13 ASP Pro Arg ASP amino acid sequences of peptides of the porcine enzyme. As Ile 14 Ile Thr Asn Thr ASP shown Fig. 3, these sequences were the same in six regions, Thr Gln 15 Ala Asn Phe Gln residues 83-118, 151-174, 194-224,230-273,341-365, and His Glu Ile 16 Phe T h r ASP 17 Glu Asn Val His 341-365 of the predicted sequence, thereby confirming that Gly ASP Thr 18 Val Phe Pro ASP the isolated cDNA insert codes forporcine HPD.Among eight 19 Glu Glu Leu TYr GlY peptides (denoted by the prefix M) isolated from a digest of Asn 20 ASP Ala Leu TYr the theS-PE-protein (1.5 nmol) withcyanogenbromide, 21 Cys" Ser Ser ND GlY amino acidcomposition of peptideM1 resembled that of 22 ASP Ala Asn GlY LYS residues 2-82of theamino acidsequencepredictedfrom 23 TYr Leu Ala Leu Phe 24 Ile Pro Asn GlY cDNA inserts (Fig. 3). Sequenator analysis showed that the 25 Val Val amino terminus of peptide M1was also blocked (not shown). 26 Gln Gln After digestion of peptide M1by Achromobacter protease I, 27 LYS ND another amino-terminal blocked peptide (Ml-K1) wasiso28 Ala Ile lated by reversed phase HPLC.Molecular mass of this blocked 29 Arg Ala 30 Glu Leu peptide was estimated to be 743.08, using a PE-SCIEX API 31 Arg LYs I11 biomolecular mass analyzer, in agreement with experimen32 GlY Thr tal error within the value (742.76) calculated for the acetyl Ala 33 Glu group; hence the amino terminus of the enzyme was acety34 Ile ASP lated. Sequenator analysis (Table I) and mass spectrometric 35 Ile measurement (data not shown)of the carboxvl-terminalDeD36 Val .. ." by Achromobacter protease I indicated " Cys was identified as phenylthiohydantoinof the S-pyridylethyl tide (M8-K2) generated that 6 amino acidresidues at the carboxyl terminus were derivative. missing in the purified enzyme. It is not clear whether this Met was identified as phenylthiohydantoin of homoserine. determined. not ' ND, cleavage occurredsteps during of purification. I

~~

~

Mammalian 4-Hydroxyphenylpyruvic Acid Dioxygenase +I ATGACGTCTTACAGCGACAMGGAGAGMGCCCGAGAGAGGCCGATTCCTCCACTTCCACTCCGTGACCTTCT~GTTGGCAATGCCMA

90

YetThr~Frly~SerA~y~GlyGluLysProGluArgGlyArgPheLeuHisPheHisSerVaIThrPheTrpValGlyAsnAlaLys 30

MI-Kl CAGGCTGCGTCGTACTACTGCAGCAAGATAGGCTTCGAACCCCTAGCCTACAAGGGCCTGGAGACGGGGTCCCGGGAGGTGGTCAGCCAC 180 GlnAlaAlaSerTyrTyrCysSerLyslleGlyPheGluProLeuAlaTyrLysGlyLeuGluThrGlySerArgGluValValSerHia 60 GTGGTCAAGCAAGATAAGATTGTGTTTGTCTTCTCCTCTGCCCTCAACCCCTGGAACAAAGAGATGGGCGATCACCTGGTGAMCACGGC 270 V a l V a l L y s G l n A s p L y s I l e V a l P h e V a I P h e S e r S e r A l a L e u A s n P r o T r p A s n L y s G l u Y e t G l y A ~ ~ H l ~ C ~ ~ a ! ~ ~90 ~~.nG!y~

Y2 GACGGAGTGAAGGACATTGCGTTCGAGGTGGAAGACTGTGACTACATAGTGCAGAAAGCCCGGGAACGGGGCGCCATAATCGTACGGGAG 360 AsDGlvValLysAsDlleAlaPheGluVaIGl~~CvsAsgTvrIleVplGlnLvsAlaAraGluArgGlvAlallelleValArgGlu 120 GMGTTTGCTGTGCTGCAGACGTTCGGGGACACCACACACCCCTGGATAGAGCAAGACMGTTTGGGAAGGTACGCTGGT~AGAAGATG 450 ProTrplleGluGlnAspLysPheGlyLysValLysPheAlaValLeuGlnThrPheGlyAspThrThrHirThrLeuV~lGluL~sYet150

FIG. 3. Nucleotide sequenceand amino acid sequence of porcine HPD. Amino acids are numbered starting with the tentative initiation methionine.The regions identifying partial amino acid sequences (MZ, M3, M4, M5, M6, M7, M 8 ) have solid underlines.

ACTTTCTGCCTGGATTCGAGGCCCCAACCTTCACAGACCCTACTACACCGGCTGCTACTTTCCAAGCTGCCCAMTGTGGTCTCGAGATA 540 ~ n ~ y ~ ~ ~ ~ y ~ ~ ~ h ~ ~ ~ ~ P h e G l u A l ~ P ~ ~ ~ ~ P h Q ~ h ~ ~ ~ P r o L e u L ~ ~ Qle~ L180 v r L e u P r p l y Y3 ATTGATCACATTGTGGGGAACCAGCCTGATCAGGAGATGGAGTCTGCCTCTCMTGGTACATGAGGAACCTACAGTTCCACCGGTTCTGG 630 IleAspHislleValGlyAsnGlnProAspGlnGluYetGluSerAlaSerGlnTr~TvrYet~raAsnLeuGlnPheHisAraPheTr~ 210 Y4 Y5 TCTGTGGATGACACGCAGATACACACGGAGTACAGTGCTCTGAGGTCCGTTGTGATGGCCAATTATGAGGAGTCCATCAAGATGCCCATT 720

SerVa!~~hs~Ihr~!n!!eHinThrG_!~TyrSar~!eL_e?rAroSerVaIVaIYetA!~~Ty16!~6!~Se~l!~~y~LlPro!~lq 240 Y7

Y6

AATGAGCCAGCGCCGGGCAAGAAGAAGTCCCAGATCCAGGAATATGTGGACTATAACGGGGGCGCTGGGGTCCAGCACATTGCTCTCAAG

810

A ~ 6 ! ~ P r s A ! a P r ~ ~ ! ~ l y p l _ y S L y ~ L y ~ ~ ~ ~ ~ ! ~ ! ! _ e G ! n G l u T y ~ V a I A s g T ~ ! A s _ n G ! y G ! y A l ~ G ! ~ V a ! ~ ! 270 ~H!g!l~Al~LeuLy

P6 ACGGAAGACATCATCACAGCGATTCGCAGCTTGAGAGAGAGAGGTGTGGAGTTCTTGGCTGTTCCATTCACCTACTACAMCAACTGCAG

900

ThrGluAsgllelleThrAlalleArgSerLeuArgGluArgGlyValGluPheLeuAlaValProPheThrTyrT~rLysGlnLeuGln

300

GAGMGCTCAAGTCGGCCAAGATCCGGGTAMGGAGAGCATCGATGTCCTGGAGGAGCTG~TCCTGGTGGACTACGACGAGAAAGGA 990 GluLysLeuLysSerAlaLyrlleArgValLyrGluSerIleArpValLeuGluGluLeuLysIleLeuValAtpTyrA~pGluLysGly 330 TACCTCCTGCAGATTTTCACCAAACCCATGCAGGACCGACCGACAGTCTTCCTGGAAGTCATTCAGCGCAACAACCACCAGGGTTTTGGA TyrLeuLeuGlnl lePheThrLysProYetFlnAsDArtlP~oThrVp!PhQL~GluVal I leGlnAraAsnAsnHisGlnGlvPheG!y

1080 360

Y8 GCCGGCAACTTCAACTCACTATTCAAGGCCTTCGAGGAGGAGCAAGAACTTCGGGGTAACCTCACGGA~CAGACCCCAACGGGGTGCCG 1170 ~~yAsnPheAsnSerLeuPheLysAlaPheGluGluGluGlnGluLeuAraGIvAsnLeuThrAsDThrAsDProAsffilyValPro 390

Y8-K2 TTCCGCCTGTAGGCCCGGCTGATCCCGCCTGACCCACCGAAGCCCCTCCCACTGCGGCGTATGGGCCACGCCCCCTCGCCCTGGAGCACG 1260 PheArgLeu'.'

humanHPD 1 rat F antigen

51

MT EF

50

IETGSREWSHVIKCGKIVFVIJCIS~

101 151

150

R

200

201

FIG. 4. Homology of amino acid sequences of human HPD and rat antigen F. Identical amino acids are boxed.

&K

251

300

301 351

LTNMETNGWPGM

Theseresultstakentogether show that the translation product of porcine HPD is processed at both the amino and carboxyl termini; the putative initiation methionylresidue is removed, and thenewly formed amino-terminal threonylresidue seems to be blocked by an acetyl group (37). It is most likely that the mature porcine HPD is composed of 386 amino acid residues (residues 2-387) with an acetyl group at the amino terminus. Based on this, therelative M, of the subunit of the human enzyme was calculated to be 44,276.7, a value in a good agreement with the 42,500-43,000 estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Comparison of the predicted amino acid sequences of the porcine and human enzymes revealed that both the enzymes are highly homologous, with an 87.5% overall identity. The

393 319

homology of nucleotide sequences between the porcine and human HPD cDNAswas 88.6% in the coding region. Transfectionand expression experiments of HPD were done to determine whether the cDNA of HPD was indeed coded for the mammalian HPD protein. When the cDNA insert from the human liver cDNA library was transfected into BMT-10 cells, a considerable amount of immunoreactive protein with anM, 43,000 to themob 51 was synthesized (Fig. 5). On the other hand the mock transfected cells produced no detectable amount of the immunoreactive polypeptide. Thus, the transfectedcells synthesized a polypeptide with an M , of 43,000, which was immunoprecipitated with mob 51. Measurement of the enzymic activity of HPD in these cells indicated that the extract from the transfectedcells contained the

Mammalian 4-Hydroxyphenylpyruvic

1 2 3 4 5 Mr. 43,000

IgG HC 4-

FIG. 5. Immunoblot analysis of recombinant human HPD expressed in BMT-10 cells. Cell lysates of transfected BMT-10 cells prepared as described under “Experimental Procedures” were subjected to immunoprecipitation with immobilized mob 51. The immunoprecipitates were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotting, as described. Lane 1, purified HPD from porcine liver; lane 2, purified porcine HPD was immunoprecipitatedwith mob 51; lane 3, immunoprecipited HPD from porcine liver; lane 4, immunoprecipitated HPD expressed in BMT-10 cells; lane 5, immunoprecipitated fraction frommock transfection. The bands with an M,of 43,000 were the purified HPD from porcine liver and the human recombinant HPD. ZgG HC indicates heavy chain of mouse IgG.

1

2

3

FIG. 6. Enzyme activity of recombinant HPD expressed in BMT-10 cells. Cell lysates of transfected BMT-10 cells were used for enzyme assay. The mean of the enzymic activities from three independent assays was expressed in nmol/min/mgprotein. I , BMT10 cells; 2, BMT-10 cells transfected with expression vector pCAGGSneodE; 3, BMT-10 cells transfected with pCAGGSneodE and cDNA for HPD.

activity, whereas the mock transfected cells showed little activity (Fig. 6). These results show that thecDNA insert carried all of the sequence information necessary for full expression of the enzyme protein and activity. It is also evident that themature human of protein was composed of two identical subunits with an M , 43,000. DISCUSSION

We obtained evidence that mammalian HPD is a homodimer of the identical subunit composed of 386 amino acid residues. Purification of the human HPD by other workers (8,12) indicated that therelative molecular mass of the active human enzyme is 87,000 and the subunit mass is 43,000, determined using polyacrylamide gels containing SDS. These data are in good accord with our results. It was reported that the amino terminus of human and avian HPD was blocked (2, 6); and our present data suggest that the amino-terminal threonyl residue seems to be acetylated. Microheterogeneity of purified enzymes from various sources revealed three major forms of avian enzyme that are enzymatically active with isoelectric points of I = 6.0, I1 = 6.2, and I11 = 6.4 (6). The porcine enzyme was eluted from the Mono Q column as three peaks(5). A similar heterogeneity was noted for the human enzyme, and these forms were immunologically identical (2). Processing of the carboxylterminal amino acids seen in the present study might relate t o heterogeneity of the enzyme protein. A computer-assisted search for homology of the amino acid

Acid Dioxygenase

24239

sequences suggested that the sequences are not homologous to any known oxidases, including pyruvate dehydrogenase (38) or branched-chain keto acid dehydrogenase (39). The human and porcine HPD are highly homologous to rat liverspecific alloantigen F (40) (Fig. 4). Liver-specific antigen F, first reported in 1968, was immunoprecipitated by sera frommice immunized with watersoluble liver extracts of allogenic mice (41).Although biological function of the antigen is not well understood, this antigen is widely distributed among species of mammals (42-46). Part of the primary structure of rat antigen F was deduced by molecular cloning of the cDNA obtained by immunoscreening of the ratliver cDNA library with allo-antisera to theantigen (40). The present studyrevealed that theamino acid sequence of rat antigen F is highly homologous to human and porcine HPD, with an approximately 90% identity. The relative molecular masses of antigen Ffrom mouse and humanliver were reported to be 43,000 (45) and 44,000 (42), respectively, which is similar to the M , of 43,000 noted for mouse and human liver HPD (8, 13). In addition, both antigen F and HPD (47) are expressed in the liver and kidney. These data suggested that HPDis a proteinclosely related to antigen F or is antigen F itself. There are threeknown types of hereditary tyrosinemias. In a mouse model for the type I11 tyrosinemia, HPD activity is genetically defective, andthe subunitprotein of HPD is undetectable by immunoblot analysis of liver extracts (13). Our preliminary study on tyrosinemic mice’ indicated that (i) tyrosinemic mice lack the F antigen, and (ii) the hypertyrosinemic gene in the mice is located on chromosome 5 as isthe F antigen (48). Molecular analysis of tyrosinemic mice indicated that mRNA related to the HPD cDNA was absent in the liver? All of these data support our working hypothesis that HPDenzyme protein is F antigen itself. Molecular cloning of the mammalian HPD andelucidation of the primary structure of the enzyme are expected to provide a basis for elucidating molecular mechanisms involved in the oxidation of 4-hydroxyphenylpyruvic acid and the molecular events related to disorders of tyrosine metabolism. Acknowledgments-We are grateful to M. Suzuki for protein sequence analysis and mass spectrometric measurements of peptides, to Dr. J. Miyazaki for the expression vector, and to M.Ohara for helpful comments. REFERENCES 1. Roche, P.A., Moorehead, T. J. & Hamilton, G. A. (1982) Arch. Biochem. Biophys. 216.62-73 2. Lindstedt, S. & Odelhog, B. (1987) Methods Enzymol. 142,139-142 3. Wada, G. H., Fellman, J. H., Fujita, T. S. & Roth, E. S. (1975) J. Biol. Chem. 250,6720-6726 4. Rundgren, M. (1977) J. Biol. Chem. 252,5085-5093 5. Buckthal, D.J., Roche, P. A., Moorehead, T. J., Forbes, B. J. & Hamilton, G. A. (1987) Methods Enzymol. 142, 132-138 6. Fellman, J. H. (1987) Methods Enzymol. 1 4 2 , 148-154 7. Lindstedt, S., Odelhog, B. & Rundgren, M. (1982) Comp. Biochem. Physiol. 72,537-541 8. Lindblad, B., Lindstedt, G.,Lindstedt, S . & Rundgren, M. (1977) J. Biol. Chem. 252,5073-5084 9. Lindstedt, S. & Rundgren, M.(1982) J.,Bio&Che,m. 257,11922-11931 10. Lindstedt, S. & Rundgren, M. (1982) Btochtm. Btophys. Acta 704,66-74 11. Lindstedt, S. & Odelhog, B. (1987) Methods Enzymol. 142, 143-148 12. Rundgren, M. (1977) J . Biol. Chem. 252,5094-5099 13. Endo, F.,Katoh, H., Yamamoto, S. & Matsuda, I. (1991) Am. J. Hum. Genet. 4 8 , 704-709 14. Endo, F., Motohara, K., Indo, Y. & Matsuda, I. (1987) Pediotr. Res. 2 2 , 627-633 15. Endo, F., Tanoue, A,, Kitano, A., Arata, J., Danks, D. M., Lapiere, C. M., Sei, Y., Wadman, S. K. & Matsuda, I. (1990) J. Clin. Invest. 8 5 , 162169 16. Ruegg, U. & Rudinger, J. (1977) Methods Enzymol. 47,111-116 17. Hermodson, M. A., Ericsson, L. H., Neurath, H. & Walsh, K. A. (1973) Biochemistry 12,3146-3153 18. Gross, E. (1967) Methods Enzymol. 1 1 , 232-255

* H. Katoh, F. Endo, H. Awata, and I. Matsuda, manuscript in preparation. H. Awata, F. Endo, and I. Matsuda, manuscript in preparation.

24240

Mammalian 4-Hydroxyphenylpyruvic Acid

19. Mahoney, W. C. & Hermodson, M. A. (1980) J. Biol. Chem. 255, 1119911203 20. Heinrikson, R. L., & Meredith, S. C. (1984) A d . Biochem. 136,65-74 21. Bidlingmeyer, B.A., Cohen, S. A., & Tarvin, T. L. (1984) J. Chromatogr. 336,93-104 22. Hewick, R. M., Hunkapiller, M. W., Hood, L. E. & Dreyer, W. J. (1981) J. Biol. Chem. 2 5 6 , 7990-7997 23. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual,Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 24. Nohukuni, Y., Mitsubuchi, H., Endo, F., Asaka, J., Oyama, R., Titani, K. & Matsuda, I. (1990) Biochemistry 2 9 , 1154-1160 25. Endo, F., Tanoue, A,, Nakai, H., Hata, A,, Indo, Y., Titani, K. & Matsuda, I. (1989) J. Biol. Chem. 624,4476-4481 26. Sanger, F., Nicken, S. & Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,5463-5467 27. Hattori, M. & Sakaki, Y. (1986) Anal. Biochem. 152,232-238 28. Niwa, H., Yamamura, K. & Miyazaki, J. (1991) Gene (Amst.) 1 0 8 , 193200 29. Gerald, R. D. & Gluzman, Y. (1985) Mol. Cell. Biol. 5 , 3231-3240 30. Felgner, P. L., Gadek, T. R., Holm, M., Roman, R., Chan, H. W., Wenz, M., Northrop, J. P., Ringold, G. M. & Danielsen, M. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 7413-7417 31. Tanoue, A,, Endo, F., Akaboshi, I., Oono, T., Arata, J. & Matsuda, I. (1991) J. Clin. Inoest. 8 7 , 1171-1176

Dioxygenase 32. Endo, F., Kitano, A,, Uehara, I., Nagata, N., Matsuda, I., Shinka, T., Kuhara, T. & Matsumoto, I. (1983) Pediatr. Res. 17,92-96 33. Lindblad, B. (1971) Clin. Chim. Acta 3 4 , 113-121 34. Laemmli, U. K. (1970) Nature 227,680-685 35. Towbin, H. T., Staehelin, T. & Gordon, J. (1979) Proc. Natl. Acad. Sci. U. S. A. 76,4350-4354 36. Kozak, M. (1984) Nucleic Acids Res. 12, 857-872 37. Tsunasawa, S. & Sakiyama, F. (1984) Methods Enzymol. 106, 165-170 38. Koike, K., Ohta, S., Urata, Y., Kagawa, Y. & Koike, M. (1988) Proc. Natl. Acad. Sci. U. S. A. 86,41-45 39. Zhang, B. D., Crabb, D. W. & Harris, R. A. (1988) Gene (Amst.) 69, 159164 40. Gershwin, M. E., Coppel, L. R., Bearer, E., Peterson, M. G., Strugess, A. & Mackay, I. R. (1987) J. Immunol. 139,3828-3833 41. Fravi, G . & Lindenmann J. (1968) Nature 218,141-143 42. Mihas, A. A,, Hirschowitz, B. I. & Saccomani, G. (1976) J. Zmmunol. 1 1 6 , 1228-1235 43. Lane, D. P. & Silver, D. M. (1976) Eur. J. Immunol. 6 , 480-495 44. Silver, D. M. & Lane, D. P. (1981) Immunogenetics 12,237-251 45. Wedderburn, L., Lukic, M. L., Edwards, S., Kahan, M. C., Nardi, N. & Michison, N. A. (1984) Mol. Immunol. 21,979-984 46. Sugimura, K. & Smith, J. B. (1976) Clin. Exp. Zmmunol. 26, 28-34 47. Fellman, J. H., Fujita, T. S. & Roth, E. S. (1972) Biochim. Biophys . Acta 284,90-100 48. Hayasaka, J. & Nikaido, H. (1987) Immunogenetics2 6 , 366-369 ~

-

~

-

~

~

~

~