Progenitor Cells from the Porcine Neural Retina ... - Wiley Online Library

TISSUE-SPECIFIC STEM CELLS Progenitor Cells from the Porcine Neural Retina Express Photoreceptor Markers After Transplantation to the Subretinal Space of Allorecipients HENRY KLASSEN,a,b JENS FOLKE KIILGAARD,c TASNEEM ZAHIR,b BOBACK ZIAEIAN,a IVAN KIROV,a ERIK SCHERFIG,c KARIN WARFVINGE,d MICHAEL J. YOUNGb a

Stem Cell Research, Children’s Hospital of Orange County, Orange, California, USA; bSchepens Eye Research Institute, Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts, USA; cEye Department, Rigshospitalet and Eye Pathology Institute, Copenhagen University, Copenhagen, Denmark; dWallenberg Retina Center, Department of Ophthalmology, Lund University, Lund, Sweden Key Words. Stem cells • Photoreceptor • Rhodopsin • Recoverin • Transducin • Swine

ABSTRACT Work in rodents has shown that cultured retinal progenitor cells (RPCs) integrate into the degenerating retina, thus suggesting a potential strategy for treatment of similar degenerative conditions in humans. To demonstrate the relevance of the rodent work to large animals, we derived progenitor cells from the neural retina of the domestic pig and transplanted them to the laser-injured retina of allorecipients. Prior to grafting, immunocytochemical analysis showed that cultured porcine RPCs widely expressed neural cell adhesion molecule, as well as markers consistent with immature neural cells, including nestin, Sox2, and vimentin. Subpopulations expressed the neurodevelopmental markers CD-15, doublecortin, ␤-III tubulin, and glial fibrillary acidic protein. Retina-specific markers expressed included the bipolar marker protein kinase C␣ and the photoreceptorassociated markers recoverin and rhodopsin. In addition,

reverse transcription-polymerase chain reaction showed expression of the transcription factors Dach1, Hes1, Lhx2, Pax6, Six3, and Six6. Progenitor cells prelabeled with vital dyes survived as allografts in the subretinal space for up to 5 weeks (11 of 12 recipients) without exogenous immune suppression. Grafted cells expressed transducin, recoverin, and rhodopsin in the pig subretinal space, suggestive of differentiation into photoreceptors or, in a few cases, migrated into the neural retina and extended processes, the latter typically showing radial orientation. These results demonstrate that many of the findings seen with rodent RPCs can be duplicated in a large mammal. The pig offers a number of advantages over mice and rats, particularly in terms of functional testing and evaluation of the potential for clinical translation to human subjects. STEM CELLS 2007;25:1222–1230

Disclosure of potential conflicts of interest is found at the end of this article.

INTRODUCTION There has been recent interest in identifying and culturing stem and progenitor cells from the central nervous system (CNS). On the one hand, studies of this type provide insights into the cellular mechanism underlying CNS development [1–3], whereas on the other hand, considerable enthusiasm has been generated by the demonstrated potential of these cells for CNS repair following transplantation to the brain [4, 5] and spinal cord [6, 7] of rodents. Work has shown equal promise in the retina, both in terms of developmental neurobiology [8] and regeneration [9 –12]. Encouraging results such as these have raised the possibility of applying CNS progenitor cell transplantation to patients with retinal degenerative disorders. A major challenge facing translational efforts with respect to transplantation of stem and progenitor cells to the CNS is the need for more predictive animal models. Although rodents continue to play a pivotal role in basic science research, the further development of scientific breakthroughs into new cell-

based therapeutic modalities is hampered by the disparity between rodents and humans in terms of both the underlying biology and the surgical anatomy. This is particularly true in the eye. One animal that has proven particularly useful for modeling human subretinal surgery is the pig [13–15]. In addition to anatomical considerations, we have recently reported that the gene expression profile of cultured porcine forebrain progenitor cells more closely resembles that of the analogous human cells than that of the mouse [16]. This raises the question of whether progenitor cells can also be cultured from the pig retina and, if so, whether the gene expression of these cells resembles their human counterparts [17, 18] more than the analogous mouse cells [10]. Here we show that progenitor cells can be propagated from fetal porcine retina (porcine retinal progenitor cells [pRPCs]) and that these cells express a range of well-established immature neurodevelopmental and retinal markers in culture. The pRPCs also express mature markers after differentiation, including the rod photoreceptor marker rhodopsin, both in culture and follow-

Correspondence: Henry J. Klassen, M.D., Ph.D., Department of Ophthalmology, School of Medicine, University of California, Irvine, 101 The City Drive, Building 55, Orange, California 92868-4380, USA. Telephone: 714-456-7370; Fax: 714-456-5073; e-mail: [email protected] Received August 29, 2006; accepted for publication January 4, 2007; first published online in STEM CELLS EXPRESS January 11, 2007. ©AlphaMed Press 1066-0599/2007/$30.00/0 doi: 10.1634/stemcells.2006-0541

STEM CELLS 2007;25:1222–1230 www.StemCells.com

Klassen, Kiilgaard, Zahir et al.

1223

Table 1. Primary antibodies for immunocytochemistry Antigen

CD15 DCX GFAP NCAM Nestin PKC␣ Recoverin Rhodopsin Sox-2 Transducin ␤-III Tubulin Vimentin

Species

Supplier

Product code

Dilution

Mouse Goat Guinea pig Rabbit Mouse Goat Rabbit Mouse Goat Rabbit Mouse Mouse

BD Pharmingena Santa Cruz Biotechnologyb Chemiconc Chemicon BD Pharmingen Santa Cruz Biotechnology Chemicon R. Moldayd Santa Cruz Biotechnology CytoSignale Chemicon Sigma-Aldrichf

559045 sc-8066 AB1540 AB5032 611658 sc-12356 AB5431P 4D2 sc-17320 TF15 MAB1637 V 6630

1:100 1:100 1:200 1:100 1:400 1:1,000 1:100–200 1:500 1:50 1:1,000 1:100 1:200

a

San Diego, http://www.bdbiosciences.com/pharmingen. Santa Cruz, CA, http://www.scbt.com. Temecula, CA, http://www.chemicon.com. d University of British Columbia, Vancouver, BC, Canada. e Irvine, CA, http://www.cytosignal.com f St. Louis, http://www.sigmaaldrich.com. Abbreviations: DCX, doublecortin; GFAP, glial fibrillary acidic protein; PKC␣, protein kinase C␣. b c

ing transplantation to the subretinal space of allogeneic recipients.

MATERIALS

AND

METHODS

washed with Ca2⫹- and Mg2⫹-free Hanks’ balanced salt solution (HBSS) (Invitrogen, Carlsbad, CA, http://www.invitrogen.com). Fresh medium containing CNTF (20 ng/ml; R&D Systems) or 10% FBS, but no EGF or bFGF, was added to the experimental wells/ flasks. The differentiation medium was changed every 3 days and the cells maintained for up to 7 days.

Donor Animals

Immunocytochemistry

A pregnant sow was placed under general anesthesia, the uterine horns and fetuses were removed, and the sow was terminated prior to waking. Work was performed according to an Institutional Animal Care and Use Committee-approved protocol. All tissues were obtained in compliance with NIH and institutional guidelines.

Live cells grown on chamber well slides were fixed for 10 minutes in 4% paraformaldehyde in 0.1 M phosphate-buffered saline (PBS) (Irvine Scientific). The fixed cells were washed with PBS containing 0.05% (wt/vol) sodium azide. A blocking solution consisting of Tris-buffered saline (TBS) ⫹ 0.3% Triton X-100 ⫹ 3% donkey serum (Jackson Immunoresearch Laboratories, West Grove, PA, http://www.jacksonimmuno.com) was then applied for 15 minutes. Cells were subsequently rinsed twice in 0.1 M TBS buffer. Primary antibodies were diluted in 250 ␮l of antibody buffer (TBS ⫹ 0.3% Triton X-100 ⫹ 1.0% donkey serum) at concentrations determined through usage in the laboratory (Table 1). Primary antibodies were applied to the samples and left at 5°C overnight and then rinsed twice with TBS the next day. Secondary antibodies were donkeyderived and diluted 1:100 in antibody buffer or goat-derived and diluted 1:800 (Jackson Immunoresearch Laboratories). Secondary antibodies were applied and left at 5°C overnight. The following day, samples were rinsed for 5 minutes with TBS three times. Slides were mounted with Prolong Antifade Kit (Molecular Probes Inc., Eugene, OR, http://probes.invitrogen.com). Digital images obtained with an Olympus Ix70 Microscope and Optronics Quantifire CCD camera (Tokyo, http://www.olympus-global.com). Electronic image files were managed using Image Pro Plus 4.0 software with AFA plugin 4.5 (Media Cybernetics, Bethesda, MD, http://www. mediacy.com).

Cell Isolation and Culture The techniques used for isolation of human RPCs were described previously [18]. The present isolation followed a similar protocol, in this case using fetal pigs collected at 60 days of gestation (typical gestational period in pig being 114 days). Briefly, the eyes were removed, the sclera and choroid were incised and reflected, the retinal pigment epithelium (RPE) was opened by tangential traction, and the neural retina was extruded from the globe and cut free from attachments along its periphery and at the optic nerve head. Pooled retinal tissue was minced and enzymatically digested, and the liberated cells were washed and cultured at high density in fibronectincoated flasks containing Dulbecco’s modified Eagle’s medium/ Ham’s F-12 medium with high glucose (Irvine Scientific, Irvine, CA, http://www.irvinesci.com), L-glutamine (200 mM), BIT9500 (10% by volume; Stem Cell Technologies, Vancouver, BC, Canada, http://www.stemcell.com), epidermal growth factor (EGF) (20 ng/ ml), basic fibroblast growth factor (bFGF) (40 ng/ml), and antibiotics. Fetal bovine serum (FBS) (10% by volume) was included overnight, and the medium was completely changed the next day with growth factors reduced to 20 ng/ml. Subsequently, cells were fed by 50% medium exchange every 2–3 days and passaged at confluence using Cell Dissociation Buffer (Gibco, Grand Island, NY, http://www.invitrogen.com), centrifugation, and gentle trituration.

Differentiation in Culture To differentiate cultured cells, growth medium was replaced with medium without mitogens but containing either FBS or ciliary neurotrophic factor. Specifically, neurospheres were grown for 24 hours in complete growth medium containing EGF and bFGF on tissue culture slides coated with either poly-D-lysine and laminin or fibronectin to generate adherent retinal progenitor cells. The complete cell culture medium was then removed, and the cells were

www.StemCells.com

Immunoblot Analysis Retinal progenitor cells or fetal porcine retinas (60 days gestation) were homogenized in lysis buffer (1% Triton X-100, 10 mM TrisHCl, pH 7.4, 5 mM EDTA, 50 mM NaCl, 50 mM NaF) containing protease inhibitor cocktail (1:100 dilution; Sigma-Aldrich) and phosphatase inhibitor (1:100 dilution; Sigma-Aldrich). Protein levels of total cell lysates were quantified with a protein assay kit (Bio-Rad, Hercules, CA, http://www.bio-rad.com). The protein samples (20 ␮g) were separated on polyacrylamide gels (NuPage; Invitrogen) for 40 minutes at 160 V and transferred to polyvinylidene difluoride membranes (Invitrolon; Invitrogen) for 60 minutes at 30 V. After transfer, the membranes were blocked in 5% nonfat dry milk in TBS-T (10 mM Tris HCl, pH 7.4, 150 mM NaCl, 0.1% Tween 20) for 30 minutes. The blots were incubated with the following primary antibodies: glial fibrillary acidic protein (GFAP)

Porcine Retinal Progenitor Cells

1224

Table 2. Reverse transcription-polymerase chain reaction primers and conditions Gene

Dach1 DCX GFAP Hes1 Lhx2 Nestin Pax6 Six3 Six6 Sox2 ␤-Actin

5ⴕ Primer

3ⴕ Primer

Annealing temperature (°C)

Size (base pairs)

AGGCTTTCG ACCTGTTCCTGAA AATCCCAACTGGTCTGTCAAC ACATCGAGATCGCCACCTAC CAGCCAGTGTCAACACGACAC CGGTGGACAAGCAGTGGCACAT GGCAGCGTTGGAACAGAGGTTGGA CCAGCCAGAGCCAGCATGCAGAACA AGCGGACTCGGAGCCTGTTG GGTGGGCAACTGGTTCAAAAACC GGCAGCTACAGCATGATGCAGGAGC CGTGCTGCTGACCGAGGCC

GCTGTCAGACCTGTTGGTGGAA GTTTCCCTTCATGACTCGGCA ACATCACATCCTTGTGCTCC TCGTTCATGCACTCGCTGA TCCTTCATGCCGAAG TGGTCGC CTCTAAACTGGAGTGGTCAGGGCT GGTTGGTAGACACTGGTGCTGAAACT AGCGCATGCCGCTCGGTCCA TGTCGCTGGACGTGATGGAGATG CTGGTCATGGAGTTGTACTGCAGG TTCGTGGATGCCACAGGAC

54 57 64 56 54 65 73 66 66 73 68

336 405 219 307 274 718 950 202 212 131 522

Primer designs were based on human gene sequence information. When possible, primers were chosen to flank at least 1 intron.

(1:1000 dilution; Chemicon), protein kinase C␣ (PKC␣) (1:200 dilution; Santa Cruz Biotechnology Inc.), and Recoverin (1:1,000 dilution; Chemicon). Subsequently, blots were incubated with horseradish peroxidase-conjugated species-specific secondary antibodies, and the signals were visualized with the enhanced chemiluminescence Western blotting detection system (Amersham Biosciences, Piscataway, NJ, http://www.amersham.com).

Reverse Transcription-Polymerase Chain Reaction Total RNA was extracted from progenitor cells at 3 weeks in culture (passage 4) using Purescript RNA Isolation Kit (Gentra, Valencia, CA, http://www.gentra.com), according to the manufacturer’s protocol. Residual genomic DNA was eliminated with DNase (DNAfree; Ambion, Austin, TX, http://www.ambion.com). Extracted RNA was then reverse transcribed using Moloney murine leukemia virus (M-MLV) reverse transcriptase (Invitrogen). Negative controls were performed that contained RNA, but no M-MLV reverse transcriptase, to further eliminate the possibility that polymerase chain reaction (PCR) product resulted from amplified genomic DNA. Automated PCR was carried out in a final volume of 50 ␮l with 3 ␮l of cDNA template, 0.75 ␮l of forward and reverse primers (0.5 ␮g/␮l) (Qiagen, Hilden, Germany, http://www1.qiagen.com) (Table 2), and 1.25 units of Taq DNA polymerase (Amersham Biosciences) in a Techne Genius thermocycler. Primer designs were based on human gene sequences. Initial denaturation for 4 minutes at 94°C was followed by 30 cycles of 1 minute at 94°C, 1 minute at the corresponding annealing temperature, and 1 minute at 72°C. The final step consisted of 7 minutes of extension at 72°C. Products were run on 2% agarose gels and visualized with ethidium bromide against a 100-base pair ladder.

Recipient Animals and Surgery Twelve female domestic pigs (Danish Landrace breed; age, 4 months; approximate weight, 30 kg) were used as recipients. Prior to surgery, animals were given intramuscular injections of 15 mg/ml midazolam (DormicumA; Roche, Hvidovre, Denmark, http://www. roche.com) and a 3-ml composition of 11.9 mg of zolazepam (Zoletin 50 Vet; Virbac SA, Carros, France, http://www.virbaccorp. com) and 11.9 mg of tiletamine (Zoletin) mixed with 12.38 mg/ml xylazine (Intervet, Skovlunde, Denmark, http://www.intervet.com), 14.29 mg/ml ketamine (Intervet), and 2.38 mg/ml methadone (Nycomed, Roskilde, Denmark, http://www.nycomed.com). Endotracheal intubation was performed, and the pigs were artificially ventilated and anesthetized with 2%–3% isoflurane (Abbott, Solna, Sweden, http://www.abbott.com) in combination with oxygen. Stroke volume (300 ml/stroke) and respiratory frequency (12 breaths per minutes) were held constant throughout the duration of the surgery. The left pupil was dilated, and the cornea was anesthetized with topical drops consisting of 0.4% oxybuprocain (SAD, Copenhagen, Denmark), 10% Metaoxedrin (SAD), 0.5% Mydriacyl (Alcon, Belgium, http://www.alconlabs.com), 1% atropine (SAD), and 5% povidone-iodine (SAD). Surgery was restricted to the left eye in all animals.

Table 3. Parameters of the laser lesions Laser parameters Pig no.

93 94 95 96 97 98 101 102 103 104 105 106

Spot size a (mm)

Duration (seconds)

Power (W)

Spot no.

0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3

0.1 0.1 0.1 0.1 Not recorded 0.1 0.5 0.5 0.5 0.5 0.5 0.5

0.09 0.09 0.09 0.09 Not recorded 0.09 1.2 1.2 1.2 1.2 1.2 0.3

9 9 9 9 9 10 10 10 9 9 9 9

a

Spot size was estimated by comparison with optic disc diameter using fundus photography.

Using a localized three-port pars plana vitrectomy, the central and posterior vitreous was removed, together with the posterior hyaloid membrane. To promote integration of grafted pRPCs into the host retina, focal damage was induced in all 12 animals via application of green argon laser burns to the area centralis, as described previously [19]. Laser parameters and number of burns applied are shown for each animal in Table 3. A bleb was then elevated in the area of laser burns by subretinal injection of 0.25– 0.5 ml of 0.9% NaCl through a 41-gauge needle. Endodiathermy was applied to the detached retina prior to enlargement of the retinotomy for transplantation. To prelabel the cells prior to transplantation, cultured pRPCs were incubated for 5 minutes with one or more vital dyes, followed by three washes in HBSS with gentle centrifugation. These included a non-nuclear vital dye used to visualize donor cell morphology; a lipophilic dye, either PKH26 (red fluorochrome; 2 ⫻ 106 M; SigmaAldrich) or PKH67 (green fluorochrome; 2 ⫻ 106 M; SigmaAldrich); and, in some cases, the nuclear dye 4⬘,6-diamidino-2phenylindole (DAPI) (10 ␮g/ml; Sigma-Aldrich) as well. Prelabeled pRPCs were injected as a single cell suspension containing approximately 2 ⫻ 107 cells into the retinal bleb using a 20-, 25-, or 27-gauge metal cannula, with or without silicon tip. Immediate reflux of some cells into the vitreous cavity was frequently observed. An air bubble was placed under the retinotomy to prevent additional reflux after withdrawal of the cannula. Chloramphenicol (SAD) was applied to the conjunctiva and ocular surface after completion of surgery. The pigs were examined weekly by ophthalmoscopy to clinically evaluate all operated eyes, with particular attention to the vitreous, retina, and transplantation site. The research protocol used here was approved by the Danish Animal Experiment Inspectorate and is also in accordance with the


1225

Table 4. Transplantation of porcine retinal progenitor cells to the subretinal space of allogeneic recipients Pig no.

97 94 98 101 102 93 95 103 104 96 105 106

Fluorochrome prelabeling

PKH67 PKH67 PKH67 PKH67 PKH26 PKH67 PKH67 PKH67 PKH26 PKH67 PKH67 PKH26

Survival time

(green) 30 Minutes (green) 1 Week (green) 1 Week (green) ⫹ DAPI 1 Week (red) ⫹ DAPI 1 Week (green) 2 Weeks (green) 2 Weeks (green) ⫹ DAPI 2 Weeks (red) ⫹ DAPI 2 Weeks (green) 5 Weeks (green) ⫹ DAPI 5 Weeks (red) ⫹ DAPI 5 Weeks

Retinal treatment

Cells

Laser Laser Laser Laser Laser Laser Laser Laser Laser Laser Laser Laser

⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹ ⫹⫹ ⫺

Figure 1. Cell cultures from the fetal porcine neural retina. Cells grew as suspended aggregates (spheres) in uncoated tissue culture flasks (A) or as an adherent monolayer on substrates such as fibronectin (B) or laminin. Magnification, ⫻100 (A), ⫻200 (B).

Abbreviation: DAPI, 4⬘,6-diamidino-2-phenylindole.

Association for Research in Vision and Ophthalmology statement for the Use of Animals in Ophthalmic and Vision Research.

Tissue Processing Eyes were enucleated under anesthesia at 30 minutes (n ⫽ 1), 1 week (n ⫽ 4), 2 weeks (n ⫽ 4), and 5 weeks (n ⫽ 3) posttransplantation (Table 4). Following removal of globes, pigs were sacrificed by i.v. injection of 2– 4 g of pentobarbital (200 mg/ml; KVL, Copenhagen, Denmark, http://www.kvl.dk). Intact globes were placed in 4% paraformaldehyde (PFA) for 10 –20 minutes. For each eye, the anterior segment, with lens, was then removed, and the posterior segment was postfixed for 2 hours in 4% PFA, followed by rinsing in increasing concentrations of sucrose containing So¨rensen’s phosphate buffer. A horizontal slice was made from the temporal retinal margin to 2–3 mm nasal to the optic disc, thus comprising the temporal ciliary margin, the area centralis, and the optic disc. These tissues were embedded in a gelatin medium, and a series of 12-␮m sections were cut on a cryostat. Every 10th slide was stained with H&E.

Immunohistochemistry Ocular tissue sections were exposed to primary anti-sera (Table 1) for 16 –18 hours in a moist chamber at 4°C, followed by rinsing in 0.1 M PBS with 0.25% Triton X-100. Tissue sections were then incubated with secondary fluorescein isothiocyanate (FITC) or Texas Red-conjugated antibodies (1:200; Jackson Immunoresearch Laboratories) for 1–2 hours in the dark at room temperature. The nonoperated contralateral eyes served as normal controls. There were additional negative controls from the operated eyes in which the primary antisera were omitted. Specimens were examined using an epifluorescence microscope. Colocalization of FITC or Texas Red-labeled primary antibodies and DAPI⫹ cells was assessed by superimposition of separate digital images of each fluorochrome.

RESULTS Cell Isolation and Culture With short-term exposure to serum, isolated fetal porcine retinal cells quickly adhered to fibronectin or laminin substrates and remained adherent after FBS was removed. Adherent cultures showed high short-term viability, as evidenced by a relative paucity of suspended cells or debris. There was morphological evidence of active proliferation, seen as numerous dividing profiles and rapid increase in the density of the monolayer. Cellular morphologies were similar to those observed in other neural progenitor cultures (Fig. 1A, 1B) and showed features in common with cultured progenitors from immature porcine forebrain [16] and human www.StemCells.com

Figure 2. Marker expression by cultured porcine retinal progenitor cells (pRPCs). (A): Cultured pRPCs showed widespread expression of the surface marker NCAM (green) and more restricted expression of the surface marker CD15 (red). (B): Expression of the neuroblast marker doublecortin (red) was restricted to a subset of small round cells, seen here against low-level labeling for glial fibrillary acidic protein (GFAP) (green). (C): Other markers showing restricted expression included the early neuronal marker ␤-III tubulin (red) and the retinal marker recoverin (green). There was widespread nuclear expression of the transcription factor Sox2 (red), as well as widespread cytoplasmic expression the intermediate filament vimentin (blue), whereas the intermediate filament GFAP (green) (D) showed limited expression. (E): The bipolar cell marker protein kinase C␣ (green) was also expressed by a subset of cells that differed from those expressing the photoreceptor marker recoverin (red). (F): The intermediate filament nestin (red) showed cytoplasmic localization in cells counterstained with the nuclear marker 4⬘,6-diamidino-2-phenylindole (green). Magnification, ⫻400 (A–E), ⫻200 (F).

retina [18]. In the absence of substrate, many cells remained suspended and via proliferation quickly generated the classic cellular clusters commonly referred to as neurospheres (Fig. 1A). Qualitative comparison of porcine retinal cultures suggested similar short-term survival when grown in growth media containing EGF, bFGF, or both.

1226


Figure 4. Immunoblot analysis of E60 fetal porcine retina versus cultured porcine RPCs. GFAP was clearly expressed in developing retinal tissue but only faintly detected in RPCs, whereas recoverin and PKC␣ were expressed in both. Abbreviations: GFAP, glial fibrillary acidic protein; PKC, protein kinase C; RPC, retinal progenitor cell. Figure 3. Colocalization of rhodopsin and recoverin in porcine retinal progenitor cells (pRPCs). Differentiating pRPCs expressed the photoreceptor markers recoverin (green) (A) and rhodopsin (red) (B), with co-expression of the two markers seen in a subset of cells (C). Cells co-expressing rhodopsin and recoverin frequently exhibited morphologies suggestive of rod photoreceptors.

Marker Expression in Culture Porcine RPC cultures exhibited widespread expression of a number of immature markers by immunocytochemistry (Fig. 2), including the nuclear transcription factor Sox2 (Fig. 2D), as well as the proliferation marker Ki67 (data not shown), along with subpopulations of cells expressing the surface carbohydrate moiety CD15 (LeX) (Fig. 2A) and the cytoskeletal-associated proteins doublecortin (DCX) (Fig. 2A), GFAP (Fig. 2B), ␤-III tubulin (Fig. 2C), and vimentin (Fig. 2D). We previously reported difficulties demonstrating nestin expression in porcine forebrain progenitors using a number of antibodies [16]. We now demonstrate widespread nestin labeling using a different anti-nestin antibody (BD 611658; Fig. 2F). Cells within the cultures were broadly positive for more mature markers of neural lineage, particularly the adhesion molecule NCAM (Fig. 2A), and many cells were positive for the cytoskeletal protein GFAP (Fig. 2B), as we have seen previously in progenitor cultures from human forebrain [20], human retina [18], and porcine forebrain [16]. Distinct clusters of cells expressed the retinal markers recoverin, as seen previously with human RPCs [18]. Furthermore, although some cells expressed PKC␣, consistent with bipolar cell differentiation, there was no evidence of double labeling for recoverin and PKC␣, as would be expected if the recoverin labeling was from bipolar cells (Fig. 2E). Estimated marker expression as a percentage of cells in culture was as follows: CD15, 20%; NCAM, 90%; DCX, 11%; GFAP, 27%; ␤-III tubulin, 9%; recoverin, 36%; Sox2, ⬎95%; vimentin, ⬎95%; PKC␣, 12%; nestin, ⬎95%. Although recoverin is known to be expressed in vivo by a subset of rod bipolar cells, the double labeling for recoverin and

Figure 5. RT-PCR analysis of gene expression by retinal progenitor cells (RPCs). Primers designed for human genes were used to probe RNA extracted from cultured porcine RPCs. Evidence was found for expression of nestin (faint), GFAP, Lhx2, Hes1, Dach1, DCX, Six3, Six6, Sox2, and Pax6 (faint). Alternating lanes contain sample with (⫹) and without (⫺) reverse transcriptase, the latter serving as negative control. Ladders (100 base pairs) provided for reference. Abbreviations: DCX, doublecortin; GFAP, glial fibrillary acidic protein; RT-PCR, reverse transcription-polymerase chain reaction.

rhodopsin shown here under differentiation conditions is consistent with rod photoreceptors, and the morphology of these cells is suggestive of photoreceptors as well (Fig. 3). Immunoblot data comparing porcine retinal tissue to cultured porcine RPCs confirmed the expression of recoverin and PKC␣ by cells from both populations, (Fig. 4). GFAP was clearly expressed in retinal tissue but only faintly detected in RPCs.


1227

Figure 6. Transplantation of porcine retinal progenitor cells (pRPCs) to the subretinal space of allogeneic recipients. Cultured pRPCs were prelabeled with 4⬘,6-diamidino-2-phenylindole (DAPI) (blue) prior to transplantation. DAPI is seen in the left panel of each row. The middle panel in each row shows immunoreactivity for a particular marker. The right panel in each row is a merged image of the two panels to the left. Following transplantation, donor cells (blue) co-expressed the photoreceptor marker transducin (red) ([A]; higher power, [B]). Similarly, donor cells co-expressed the rod photoreceptor marker rhodopsin (red) ([C]; higher power, [D]), as well as recoverin (green) ([E]; higher power, [F]). A subset of cells expressed the intermediate filament GFAP (green) ([G]; higher power, [H]). Superficial as well as deep, radially oriented GFAP⫹ host profiles were evident (G), and colocalization of DAPI and GFAP was also seen (arrows) (H). Scale bars ⫽ 100 ␮m. Abbreviations: GCL, ganglion cell layer; INL, inner nuclear layer; IPL, inner plexiform layer; ONL, outer nuclear layer; RPE, retinal pigment epithelium.

To further characterize porcine RPCs, extracted RNA was analyzed using reverse transcription-PCR (Fig. 5). The product for the human nestin transcript was faint, as previously reported www.StemCells.com

for porcine forebrain progenitors using these primers [16]. Other genes associated with the developing retina were also examined, with particular emphasis on nuclear transcription factors


1228

Figure 6. (Continued)

(NTFs). The finding of Sox2 expression, seen above using immunocytochemistry (ICC), was replicated at the transcript level. Hes1, another NTF expressed during neural development, was also present. In addition, a number of NTFs previously associated with eye specification and retinal development in vertebrates were identified in porcine RPCs. These include Lhx2, Six3, Six6, Dach1, and Pax6, with the signal for Pax6 being the weakest among these (Fig. 5). In terms of non-NTF genes, transcripts for the intermediate filament GFAP and the neuroblast-associated protein DCX were evident as well (Fig. 4), again replicating findings seen by ICC.

Transplantation Prelabeled donor cells were identified in 11 of 12 allograft recipients (Table 4). There was evidence of graft survival at all time points from 30 minutes to 5 weeks. Survival was quite substantial in all animals at 1 and 2 weeks but variable at 5 weeks. These cells were frequently located in the subretinal space (Fig. 6A– 6H), although there was also evidence of labeled cells and processes within the neural retina (supplemental online Fig. 7). In terms of evidence for migration, the lateral limit for labeled cells was 4 mm from the injection bleb. Despite evidence of some diffusion of DAPI and uptake by host retinal cells, the bulk of cells in the subretinal space exhibited brighter DAPI labeling and could be readily distinguished from the well-organized cells of the host. Many of these subretinal (presumed donor) cells double-labeled for DAPI and photoreceptorassociated markers, including transducin (Fig. 6A, 6B), rhodopsin (Fig. 6C, 6D), and recoverin (Fig. 6E, 6F). A subset of cells were found to express GFAP (Fig. 6G, 6H). No evidence of perivascular cuffing or other signs of PMN or mononuclear cell infiltration were observed in H&E-stained sections (data not shown).

DISCUSSION In this study, we show that progenitor cells can be cultured from the retina of the pig, the first demonstration of ex vivo cultivation of retinal progenitor cells from a nonhuman large animal. The pRPCs proliferate in vitro and express NTFs implicated in retinal specification, as well as other markers generally associated with CNS development. In the presence of serum, a subset of pRPCs co-express recoverin and rhodopsin, evidence of differentiation into cells of retinal lineage, namely, rod photoreceptors. The availability of porcine RPCs allows us to compare the characteristic of these cells to RPCs from rodents and

Figure 7. Donor cells prelabeled with both 4⬘,6-diamidino-2-phenylindole (DAPI, blue) and PKH26 (red) showed extension of donor-derived processes into the inner retina (arrows). Abbreviations: INL, inner nuclear layer; IPL, inner plexiform layer.

humans. Potential points of comparison include isolation and culture techniques, cellular morphology, and gene expression. The paucity of porcine-specific reagents currently limits our ability to evaluate gene expression in cells from this species. A gene not well detected here, but of interest to the current study, is the intermediate filament nestin, a marker highly expressed by neuroepithelial cells during development. Nevertheless, the expression of many porcine genes can be detected with available reagents, presumably as a result of sufficient homology with other mammalian species, particularly human, as we have shown previously [16] and both confirm and extend here. Therefore, despite difficulties with detection of nestin in porcine cells, we have been able to collect a range of markers that highlight the similarity of these cells to retinal progenitors from other species. The porcine RPCs exhibit a number of similarities to forebrain progenitors from the pig, as well as forebrain and retinal progenitors from other species. The proliferation marker Ki-67 and adhesion molecule NCAM are heavily expressed across species by a broad range of CNS progenitors, as well as other cell types. The surface carbohydrate epitope CD15 (LeX) and highly conserved transcription factors Hes1 and Sox2 have been more specifically associated with immature CNS progenitors in

Klassen, Kiilgaard, Zahir et al. a number of mammalian species, including mice, humans, and pigs [16, 21–24]. Markers of neuronal development were expressed by subpopulations of porcine progenitor cells, including DCX and ␤-III tubulin. We have previously identified both of these cytoplasmic markers in subpopulations of cultured CNS progenitors from mouse [10], human [18, 20], and pig [16]. Here, we also find that subpopulations of pRPCs also express the glial-associated markers vimentin and GFAP. Although we have not seen substantial GFAP expression in mouse retinal progenitor cultures maintained under proliferation conditions [10], the present data are consistent with our previous findings of GFAP and vimentin in human forebrain [20] and retinal [18] progenitors, as well as progenitors from the pig forebrain [16]. Hence, although there is considerable overlap in the genes expressed by CNS progenitor cells, the evidence to date supports the concept that the expression profiles of porcine CNS progenitors more closely resemble those of the human than of mouse. Compared with cells from the developing pig forebrain [16], progenitor cells from the pig retina differ by way of their expression of the photoreceptor-associated gene recoverin. After differentiation or transplantation, the additional photoreceptor markers rhodopsin and transducin are upregulated as well. Furthermore, pRPCs express highly conserved genes associated with specification of the eye and retina in a wide range of metazoan species, from fly to human. Here, these were found to include Dach1, Lhx2, Pax6, Six3, and Six6, both confirming and extending our previous findings with respect to these genes in analogous cells from human forebrain and retina [18]. New to the present study is the identification of Lhx2 transcripts in cultured RPCs. Lhx2 is a transcription factor of the Lim family that has been implicated in eye specification in Xenopus [25, 26] and is expressed in the forebrain, optic vesicle, and developing neural retina of the mouse [27, 28]. Here, we show the expression of this gene by cultured RPCs from a large mammal. Although Lhx2-deficient mouse embryos are anophthalmic, the role played by this gene later in retinal development remains to be determined. Since this gene might be involved in the phenotypic specification of retinal cells, it would be of interest to know the relative co-expression of Lhx2 and other NTFs, as well as non-nuclear genes, within cultured RPC populations. In previous work in porcine recipients, we showed that cultured murine RPCs can be transplanted to the subretinal space and that these cells show evidence of morphological integration into the neural retina and RPE layers [19], before being destroyed by a vigorous immune response, characterized by dense choroidal infiltrates localized to the region of the xenogeneic grafts [29]. These findings serve as a point of comparison with respect to the present study, in which we again observed integration of grafted RPCs into the retina, but also evidence of photoreceptor differentiation and improved graft survival. Here, characterization of donor cell morphology demonstrated extension of processes into the host retina but was limited by the use of vital dyes, which yielded notably inferior results compared with endogenous green fluorescent protein (GFP) expression. The development of a GFP-transgenic pig provides a potential solution to this problem [30] and we are currently developing GFP⫹ donor cells from this source (H. Klassen, M. Young, R. Prather, unpublished data). Our current finding of widespread expression of recoverin, rhodopsin, and transducin by grafted cells suggests a relatively advanced stage of photoreceptor development. Whether these cells possess outer segments or are capable of responding to light remains to be determined. www.StemCells.com

1229

The rod-like morphology seen in the present study, but not in previous work by Banin et al. [31], could relate to the use of embryonic stem (ES) cells by the latter investigators. ES cells require greater epigenetic specification than RPCs to differentiate into mature photoreceptors. In addition, those investigators used a xenogeneic transplantation model (human to rat) that likely provides fewer instructive cues compared with the allogeneic porcine model used here. In terms of donor cell survival, the porcine RPCs used here proved much superior to the murine cells used previously. This can in large part be attributed to the improved immunological compatibility of the allogeneic pRPCs over the xenogeneic murine cells. Yet even in the absence of an obvious immune response, survival of grafted cells can be low following progenitor cell transplantation [32], and therefore the degree of survival seen here is encouraging. The reason for the variable survival seen at 5 weeks, the longest time point examined, is not clear, and the possibility of immunological attack has not been ruled out.

CONCLUSION Further development of the porcine RPC allograft model will benefit from the use of cells constitutively expressing a reporter gene to positively identify cells of donor origin and to better evaluate the morphology of cells following engraftment. Also of interest is the application of such cells in porcine models of retinal disease, such as the pig that develops photoreceptor degeneration secondary to expression of a mutant human rhodopsin transgene [33]. It has been proposed that porcine cells might provide a source of xenograft material for human application; however, it is evident that substantial biological challenges, including immunological incompatibility, would first need to be overcome to make this a realistic option. Nevertheless, the porcine RPC allograft model represents a useful tool for evaluating issues likely to be faced if intraocular progenitor transplantation is to find application in humans.

ACKNOWLEDGMENTS We thank Dr. Marie Shatos, Jaqueline Doherty, Caijui Zhang, and Hubert Nethercott for technical assistance; Prof. Robert Molday for the kind gift of anti-rhodopsin antibody; and Prof. Berndt Ehinger, Dr. Morten la Cour, and Dr. Phil Schwartz for intellectual input related to this project. This work was supported by the Gail and Richard Siegal Foundation, National Institute of Neurological Disorders and Stroke NS044060 (H.K.), National Eye Institute EY09595 (M.J.Y.), Larry Hoag Foundation (H.K.), BMRC Grant 05/1/35/19/421 (H.K.), the Crown Princess Margareta’s Committee for the Blind (K.W.), the Swedish Association of the Visually Impaired (K.W.), the Swedish Science Council (Medicine) (K.W.), and the Minda de Gunzburg Research Center for Retinal Transplantation (M.J.Y.).

DISCLOSURES

OF OF

POTENTIAL CONFLICTS INTEREST

The authors indicate no potential conflicts of interest.


1230

REFERENCES 18 1 2 3 4 5 6 7 8 9

10

11 12 13 14 15 16 17

Alvarez-Buylla A, Herrera D, Wichterle H. The subventricular zone: Source of neuronal precursors for brain repair. Prog Brain Res 2000;127: 1–11. Anthony TE. Radial glia serve as neuronal progenitors in all regions of the central nervous system. Neuron 2004;41:881– 890. Yoon K, Nery S, Rutlin M et al. Fibroblast growth factor receptor signaling promotes radial glial identity and interacts with Notch1 signaling in telencephalic progenitors. J Neurosci 2004;24:9497–9506. Bru¨stle O, Jones K, Learish R et al. Embryonic stem cell-derived glial precursors: A source of myelinating transplants. Science 1999;285: 754 –756. Lie D, Song J, Colamarino S et al. Neurogenesis in the adult brain: New strategies for central nervous system diseases. Annu Rev Pharmacol Toxicol 2004;44:399 – 421. McDonald J, Becker D, Holekamp T et al. Repair of the injured spinal cord and the potential of embryonic stem cell transplantation. J Neurotrauma 2004;21:383–393. Davies J, Huang C, Proschel C et al. Astrocytes derived from glialrestricted precursors promote spinal cord repair. J Biol 2006;5:7. Kim J, Wu H, Lander A et al. GDF11 controls the timing of progenitor cell competence in developing retina. Science 2005;308:1927–1930. Young M, Ray J, Whiteley S et al. Neuronal differentiation and morphological integration of hippocampal progenitor cells transplanted to the retina of immature and mature dystrophic rats. Mol Cell Neurosci 2000; 16:197–205. Klassen H, Ng T, Kurimoto Y et al. Multipotent retinal progenitors express developmental markers, differentiate into retinal neurons, and preserve light-mediated behavior. Invest Ophthalmol Vis Sci 2004;45: 4167– 4173. Wojciechowski A, Englund U, Lundberg C et al. Survival and long distance migration of brain-derived precursor cells transplanted to adult rat retina. STEM CELLS 2004;22:23–38. Lavik E, Klassen H, Warfvinge K et al. Fabrication of degradable polymer scaffolds to direct the integration and differentiation of retinal progenitors. Biomaterials 2005;26:3187–3196. Del Priore L, Kaplan H, Hornbeck R et al. Retinal pigment epithelial debridement as a model for the pathogenesis and treatment of macular degeneration. Am J Ophthalmol 1996;122:629 – 643. Nicolini J, Kiilgaard J, Wiencke A et al. The anterior lens capsule used as support material in RPE cell-transplantation. Acta Ophthalmol Scand 2000;78:527–531. Ghosh F, Wong F, Johansson K et al. Transplantation of full-thickness retina in the rhodopsin transgenic pig. Retina 2004;24:98 –109. Schwartz P, Nethercott H, Kirov I et al. Expression of neurodevelopmental markers by cultured porcine neural precursor cells. STEM CELLS 2005;23:1286 –1294. Kelley M, Turner J, Reh T. Regulation of proliferation and photoreceptor

19 20 21

22 23 24 25 26 27 28 29 30

31 32 33

differentiation in fetal human retinal cell cultures. Invest Ophthalmol Vis Sci 1995;36:1280 –1289. Klassen H, Ziaeian B, Kirov I et al. Isolation of retinal progenitor cells from post-mortem human tissue and comparison with autologous brain progenitors. J Neurosci Res 2004;77:334 –343. Warfvinge K, Kiilgaard J, Lavik E et al. Retinal progenitor cell xenografts to the pig retina: Morphologic integration and cytochemical differentiation. Arch Ophthalmol 2005;123:1385–1393. Schwartz P, Bryant P, Fuja T et al. Isolation and characterization of neural progenitor cells from post-mortem human cortex. J Neurosci Res 2003;74:838 – 851. Allendoerfer K, Durairaj A, Matthews G et al. Morphological domains of Lewis-X/FORSE-1 immunolabeling in the embryonic neural tube are due to developmental regulation of cell surface carbohydrate expression. Dev Biol 1999;211:208 –219. Klassen H, Schwartz M, Bailey A et al. Surface markers expressed by multipotent human and mouse neural progenitor cells include tetraspanins and non-protein epitopes. Neurosci Lett 2001;312:180 –182. Cai J, Wu Y, Mirua T et al. Properties of a fetal multipotent neural stem cell (NEP cell). Dev Biol 2002;251:221–240. Capela A, Temple S. LeX is expressed by principle progenitor cells in the embryonic nervous system, is secreted into their environment and binds Wnt-1. Dev Biol 2006;291:300 –313. Zuber M, Gestri G, Viczian A et al. Specification of the vertebrate eye by a network of eye field transcription factors. Development 2003;130: 5155–5167. Viczian A, Bang A, Harris W et al. Expression of Xenopus laevis Lhx2 during eye development and evidence for divergent expression among vertebrates. Dev Dyn 2006;235:1133–1141. Porter F, Drago J, Xu Y et al. Lhx2, a LIM homeobox gene, is required for eye, forebrain, and definitive erythrocyte development. Development 1997;124:2935–2944. Bernier G, Vukovich W, Neidhardt L et al. Isolation and characterization of a downstream target of Pax6 in the mammalian retinal primordium. Development 2001;128:3987–3994. Warfvinge K, Kiilgaard J, Klassen H et al. Retinal progenitor cell xenografts to the pig retina: immunological reactions. Cell Transplant 2006;15:603– 612. Lai L, Park K, Cheong H et al. Transgenic pig expressing the enhanced green fluorescent protein produced by nuclear transfer using colchicine-treated fibroblasts as donor cells. Mol Reprod Dev 2002;62: 300 –306. Banin E, Obolensky A, Idelson M et al. Retinal incorporation and differentiation of neural precursors derived from human embryonic stem cells. STEM CELLS 2006;24:246 –257. Tomita M, Lavik E, Klassen H et al. Biodegradable polymer composite grafts promote the survival and differentiation of retinal progenitor cells. STEM CELLS 2005;23:1579 –1588. Petters R, Alexander C, Wells K et al. Genetically engineered large animal model for studying cone photoreceptor survival and degeneration in retinitis pigmentosa. Nat Biotechnol 1997;15:965–970.

See www.StemCells.com for supplemental material available online.