Receptors for Advanced Glycation End-Products Targeting Protect against Hyperoxia-Induced Lung Injury in Mice Paul R. Reynolds1,2, Robert E. Schmitt1, Stephen D. Kasteler1, Anne Sturrock1, Karl Sanders1, Angelika Bierhaus3, Peter P. Nawroth3, Robert Paine III1, and John R. Hoidal1 1
Department of Internal Medicine, Pulmonary Division, University of Utah Health Sciences Center, Salt Lake City, Utah; 2Department of Physiology and Developmental Biology, Brigham Young University, Provo, Utah; and 3Department of Medicine and Clinical Chemistry, University Clinics Heidelberg, Germany
Patients with acute lung injury almost always require supplemental oxygen during treatment; however, elevated oxygen itself is toxic. Receptors for advanced glycation end-products (RAGE) are multiligand cell surface receptors predominantly localized to alveolar type I cells that influence development and cigarette smoke–induced inflammation, but studies that address the role of RAGE in acute lung injury are insufficient. In the present investigation, we test the hypothesis that RAGE signaling functions in hyperoxia-induced inflammation. RAGE-null mice exposed to hyperoxia survived 3 days longer than age-matched wild-type mice. After 4 days in hyperoxia, RAGE-null mice had less total cell infiltration into the airway, decreased total protein leak, diminished alveolar damage in hematoxylin and eosin–stained lung sections, and a lower lung wet-to-dry weight ratio. An inflammatory cytokine antibody array revealed decreased secretion of several proinflammatory molecules in lavage fluid obtained from RAGE knockout mice when compared with wild-type control animals. Real-time RT-PCR and immunoblotting revealed that hyperoxia induced RAGE expression in primary alveolar epithelial cells, and immunohistochemistry identified increased RAGE expression in the lungs of mice after exposure to hyperoxia. These data reveal that RAGE targeting leads to a diminished hyperoxiainduced pulmonary inflammatory response. Further research into the role of RAGE signaling in the lung should identify novel targets likely to be important in the therapeutic alleviation of lung injury and associated persistent inflammation. Keywords: acute lung injury; inflammation; receptors for advanced glycation end-products; hyperoxia
Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) are common complications that are associated with significant morbidity and mortality. Nearly 200,000 Americans are affected each year, leading to 3.6 million hospital days and 75,000 deaths nationwide (1). Despite several decades of research, ALI and ARDS still have an unacceptably high mortality rate. One life-saving component in the treatment of ALI and ARDS is oxygen supplementation; however, exposure to high oxygen can lead to lung injury (2, 3). To increase therapeutic success, the molecular mechanisms of organ injury due to hyperoxic exposure must be better characterized. Receptors for advanced glycation end-products (RAGE) are members of an immunoglobin superfamily of cell-surface re(Received in original form July 16, 2008 and in final form May 28, 2009) This work was supported by a Parker B. Francis Fellowship in Pulmonary Research (P.R.R.), the Lautenschla¨ger Foundation for Diabetes (P.P.N.), Deutsche Forschungsgemeinschaft grant SFB405 (P.P.N.), and a Young Clinical Scientist Award provided by the Flight Attendants Medical Research Institute (P.R.R.). Correspondence and requests for reprints should be addressed to Paul Reynolds, Ph.D., Brigham Young University, Department of Physiology and Developmental Biology, Provo, UT 84602. E-mail:
[email protected] Am J Respir Cell Mol Biol Vol 42. pp 545–551, 2010 Originally Published in Press as DOI: 10.1165/rcmb.2008-0265OC on June 25, 2009 Internet address: www.atsjournals.org
ceptors expressed in many cell types (4). RAGE expression is most abundant in the lung from which it was initially isolated, and high levels of RAGE expression during periods of lung development and in adult pulmonary tissue suggest functionality in lung morphogenesis and homeostasis (5). RAGE is selectively localized to the basolateral membranes of well differentiated alveolar type (AT) I cells (6), a finding that implicates RAGE in vital developmental processes associated with the transition of ATII cells to ATI cells, including cellular spreading, thinning, and adherence (6). Furthermore, RAGE expression in ATI cells primarily responsible for gas exchange implicates it as a protein susceptible to regulation/dysregulation by changes in oxygen tension. RAGE was first described as a progression factor in cellular responses induced by advanced glycation end-products that accumulate in hyperglycemia and oxidant stress. However, subsequent studies have demonstrated RAGE as a pattern recognition receptor that also binds endogenous factors, such as S100/calgranulins, amyloid-b-peptide, high-mobility group box 1 (HMGB-1, amphoterin), to influence gene expression via activated signal transduction pathways (7–9). RAGE expression increases whenever its ligands accumulate (6), and RAGE–ligand interaction leads to pathological processes, including diabetic complications, neurodegenerative disorders, atherosclerosis, and inflammation (5, 7, 8). To date, the full extent of RAGE expression and the molecular mechanisms that control the receptor in the context of various stimuli have not been adequately evaluated. Understanding the role of RAGE signaling could provide insights into the reduction of lung injury and disease associated with abnormal expression of RAGE or its soluble form (sRAGE) (10–14). In the present study, we test the hypothesis that RAGE has a central role in hyperoxia-induced ALI. Through the use of RAGE knockout mice, we demonstrate that RAGE ablation prolongs survival in supraphysiologic oxygen. In comparison to wild-type control animals, characteristics of ALI are markedly decreased in RAGE knockout mice exposed to hyperoxia, including protein leak, lung wet-to-dry weight ratios, inflammatory cell infiltration into the airspaces, and proinflammatory molecule elaboration. We also report that RAGE expression is significantly elevated in wild-type mouse lung parenchyma and primary alveolar epithelial cells (AECs) after hyperoxia exposure. Collectively, these data offer novel insights into potential mechanisms whereby RAGE influences inflammation in acute respiratory failure. Further research may demonstrate that RAGE is an important target in the successful pharmacological treatment of ALI and ARDS.
MATERIALS AND METHODS Animals and Hyperoxia Treatment Female C57BL/6 wild-type mice (10 wk old) were obtained from Jackson Laboratories (Bar Harbor, ME), and RAGE knockout mice
546
AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL 42 2010
that lack membrane and sRAGE were generated on a C57BL/6 background (15). Animal use and husbandry followed protocols that were approved by the Institutional Animal Care and Use Committee at the University of Utah. Mice had unlimited access to food and water throughout the studies. Preliminary experiments demonstrated that 75% O2 was sufficient for comparison of lung injury in wild-type and RAGE knockout mice. Wild-type and age-matched RAGE knockout mice were placed in a Plexiglas chamber attached to a compressed oxygen source, and an oxygen sensor was placed inside the chamber to continuously monitor O2 tension (Proox Model 110; Biospherix, Lacona, NY). A survival study was initially conducted by exposing mice (n 5 10/group) to hyperoxia for up to 14 days. Surviving animals were counted at 12-hour intervals. In follow-up experiments, wild-type and RAGE knockout mice (n 5 8/group) were exposed to hyperoxia for 4 days (the day before mortality was observed in wild-type mice) before bronchoalveolar lavage fluid (BALF) was taken or lungs harvested for histological evaluation. Wild-type mice exposed to hyperoxia for 4 days experienced no mortality or observable disease symptoms, including weight loss, and were indistinguishable from agematched RAGE knockout mice.
Histology Lungs from animals exposed to hyperoxia for 4 days were inflation fixed at 25 cm of water pressure with 4% paraformaldehyde in PBS for 1 minute, processed, and sectioned as previously described (16). Slides were stained with hematoxylin and eosin according to standard techniques. Occurrences of alveolar wall and/or vascular damage were counted in a blinded fashion in hematoxylin and eosin–stained sections from wild-type and RAGE knockout mice after hyperoxia exposure (six mice per group, six random 2003 fields per mouse) and averaged. Immunohistochemistry of RAGE in mouse lung sections was performed using standard techniques and employing a goat polyclonal antibody generated on site against a specific peptide, PKKPPQRLEWKLNTGRTE (amino acids 42–59), and was used at a dilution of 1:500.
Lung Wet-to-Dry Weight Ratio Determination Wld-type and RAGE knockout mice (10 wk old; n 5 8 for each group) were exposed to 75% O2 for 4 days, killed, and both lungs were removed. After blotting the lungs briefly on a paper towel, they were weighed (wet lung weight), weighed again after 72 hours of drying at 808C in an oven (dry lung weight), and the ratios between wet and dry lung weights were determined.
BALF Analysis BALF was obtained with a 20-gauge surgical catheter intubated into the trachea. A syringe was used to instill and remove four sequential 1.0-ml aliquots of PBS in the lungs, and the resulting fluid was pooled for each animal. BALF was centrifuged at 800 3 g for 10 minutes at 48C, and supernatants were assayed for total protein with a bicinchoninic acid (BCA) total protein kit (ThermoScientific, Rockford, IL). Total numbers of cells in the remaining pellets were counted with a hemocytometer with Trypan blue exclusion. A 200-ml aliquot of the resuspended cell pellets was placed in a cytospin, centrifuged at 1,200 rpm for 5 minutes, and stained with a modified Wright-Giemsa stain (Diff-Quik; Baxter, McGaw Park, IL). Slides were subjected to a blinded manual differential cell count in which 200 cells were counted per slide, and the percent of total cells was determined. Counting was performed in triplicate and the average determined.
Measurement of Cytokine Levels The ChemiArray Mouse Inflammatory Antibody Array (Chemicon, Billerica, MA) was used to assess secreted cytokines in cell-free BALF isolated from RAGE knockout and wild-type mice after 4 days in hyperoxia. Protein concentrations in cell-free BALF samples from RAGE knockout and wild-type mice (n 5 8/group) were determined using the bicinchoninic acid assay. The array was conducted following the manufacturer’s instructions, and was performed using a normalized concentration of total protein (20 mg) in the BALF pooled from eight wild-type and eight RAGE knockout mice. The resulting blots were then densitometrically evaluated for differences in the relative amounts of each proinflammatory molecule with NIH ImageJ software
(National Institutes of Health, Bethesda, MD). Fold differences in the amount detected in BALF from the pooled wild-type mice were determined after assigning the concentration of the same molecule in the RAGE knockout BALF to a value of 1. Because the total amount of protein was significantly reduced in BALF from RAGE knockout mice, fold differences between the proinflammatory molecules included in the antibody array were also established based on normalized BALF volume obtained from each group. Determining the product of the blot density and 4.238 (the fold increase in total protein concentration in wild-type BALF compared with RAGE knockout BALF), mathematically derived fold differences observed when equal volumes of BALF from each group were assessed.
Isolation and Culture of AECs Murine AECs were isolated as described previously (17). Briefly, the pulmonary vasculature was perfused free of blood with PBS, and AECs were freed by enzymatic digestion with dispase (BD Biosciences, San Jose, CA) and filtered to derive a single-cell suspension. Leukocytes were removed with a magnetic cell separator (Magnasphere; Promega, Madison, WI) that contained streptavidin-coated magnetic particles after binding with biotinylated anti-CD32 and anti-CD45 (BD Pharmingen, San Jose, CA). Because fibroblasts, endothelial cells, and bone marrow–derived cells express the intermediate filament, vimentin, the discovery that adherent cells remaining after overnight culture were greater than 95% vimentin negative produced confidence that an epithelial cell origin was achieved. AECs were subsequently placed in a normobaric cell culture chamber and subjected to 5% CO2 and normoxia or 80% O2 for 48 hours commencing on the fourth day after isolation.
RNA/Protein Isolation and Assessment by Real-Time RT-PCR and Immunoblotting Total RNA was isolated from primary AECs maintained in culture with the Absolutely RNA RT-PCR Miniprep kit (Stratagene, La Jolla, CA). After total RNA was spectrophotometrically quantified, reverse transcription and PCR amplification with a One-Step Brilliant SYBR Green qRT-PCR Master Mix kit (Stratagene) were performed in a single reaction, per the manufacturer’s instructions. cDNA conversion, amplification, and data analysis were performed with an Mx3000P real-time PCR system computerized cycler from Stratagene. The following primers, available through Primer Bank (ID 6671525a3), were synthesized and HPLC purified by Invitrogen Life Technologies (Carlsbad, CA): RAGE (forward, ACTACCGAGTCCGAGTCTACC; reverse, GTAGCTTC CCTCAGACACACA); and glyceraldehyde 3-phosphate dehydrogenase (forward, TATGTCGTGGAGTCTACTGGT; reverse, GAGTTGTCA TATTTCTCGTGG). Primers for surfactant protein C (SPC), T1a, and aquaporin-5 were designed by using the Universal Probe Library Program (Roche): SPC (forward, GGTCCTGATGGAGAGTCCAC; reverse, GATGAGAAGGCGTTTGAGGT); T1a (forward, CAGTG TTGTTCTGGGTTTTGG; reverse, ACCTGGGGTCACAATATCA TCT); and aquaporin-5 (forward, TAACCTGGCCGTCAATGC; reverse, GCCAGCTGGAAAGTCAAGAT). Primers were used at a concentration of 75 nM each in 25-ml reactions. Cycle parameters were as follows: 40 minutes at 558C for reverse transcription, followed by 10 minutes at 958C, and 40 cycles composed of 30 seconds at 958C, 1 minute at 588C (glyceraldehyde 3-phosphate dehydrogenase and RAGE) or 608C (SPC, T1a, and aquaporin-5), and 30 seconds at 728C. Control wells lacking template or RT were included to identify primer–dimer products and to exclude possible contaminants. Total protein was isolated from primary AECs after 48 hours in 80% oxygen or from mouse lung homogenates after exposure to 75% oxygen for 4 days with RIPA and associated protease inhibitors (Santa Cruz Biotechnology, Santa Cruz, CA). Protein concentrations were determined by BCA assay to ensure equal loading and assessment by SDS-PAGE, as previously described here. RAGE immunoblotting was performed as previously cited (5).
Statistical Analysis Values are expressed as means (6SD). Data were assessed by one-way ANOVA. When ANOVA indicated significant differences, the Student’s t test was used with Bonferroni’s correction for multiple
Reynolds, Schmitt, Kasteler, et al.: RAGE Ablation Diminishes Hyperoxia-Induced ALI Figure 1. Receptors for advanced glycation end-products (RAGE) knockout mice were protected from hyperoxia-induced mortality. RAGE knockout (dotted line) and wild-type (solid line) mice (n 5 10/group) were continuously exposed to 75% O2 and followed for survival. Mice were evaluated at 12-hour intervals, and the percentage of surviving animals was determined. Kaplan-Meier plot reveals that the average survival rate was 6.2 (60.8) days for wild-type mice versus 9.3 (61.3) days for the RAGE knockout mice. P 5 0.04.
comparisons. Figure 1 presents Kaplan-Meier survival distributions. The log-rank test was used to compare both wild-type and RAGE knockout survival distributions with the statistical software package, R (version 2.1; Vienna, Austria). In vitro experiments were performed in triplicate. All results presented are representative, and those with P values less than 0.05 were considered significant.
RESULTS RAGE Knockout Mice Are Protected against Hyperoxia-Induced Mortality
Female RAGE knockout mice (10 wk of age) and age-/sexmatched wild-type mice were housed in a continuous-flow oxygen chamber and followed for survival. RAGE knockout mice survived significantly longer in 75% O2, or, on average, an additional 3 days compared with similarly exposed wild-type mice (9.3 6 1.3 versus 6.2 6 0.8 d; Figure 1). RAGE Knockout Mice Are Protected from Characteristics of Hyperoxia-Induced ALI
Exposing RAGE knockout mice to 4 days of 75% O2 revealed diminished characteristics of hyperoxia-induced ALI. Histology of lungs from wild-type C57BL/6 mice revealed subtle morphological alterations, including modest damage to the alveolar wall and/or hemorrhage (2.05 6 0.63 occurrences per 2003 field; Figure 2A). Conversely, an analysis of RAGE knockout lung sections revealed significantly less (0.67 6 0.71) occurrences of parenchymal cell or vascular damage (Figure 2B). After exposure to hyperoxia, RAGE knockout mice contained substantially less protein in BALF, suggesting reduced vascular permeability compared with wild-type mice (Figure 3A). Lung wet-to-dry weight ratios were determined to evaluate potential edema, and it was discovered that RAGE knockout mice had a significantly lower wet-to-dry weight ratio after hyperoxia exposure when compared with wild-type mice (Figure 3B). There was no difference in BALF protein or lung wetto-dry weight ratios in wild-type or RAGE knockout mice exposed to normoxia (Figure 3).
547
After hyperoxic exposure, RAGE knockout mice also had a significantly decreased number of total cells in BALF when compared with BALF sampled from wild-type mice (Figure 4). Cell differentials revealed no significant difference in the percentage of mononuclear cells or polymorphonuclear neutrophils (PMNs) in mice from both groups after exposure to hyperoxia (Table 1), despite the fact that the absolute numbers of these cell types were significantly diminished in BALF from RAGE knockout mice (Figure 4). There was also an expected significant increase in the percentage of PMNs observed in both groups exposed to hyperoxia when compared with normoxic control animals of the same genotype (Table 1). Cell-free BALF from RAGE knockout and wild-type mice after 4 days of hyperoxia was pooled and subjected to an inflammatory cytokine array. Five specific markers were noticeably increased in BALF sampled from wild-type mice and diminished in RAGE knockout mice, including LPS-Induced CXC chemokine (LIX), soluble TNF receptor 1 (sTNF-R1), macrophage inflammatory factor (MIP)–1g, IL-6, and monocyte chemotactic protein (MCP)–1 (Figure 5). LIX (chemokine ligand 5, or CXCL5) was detected at a level 6.25-fold higher in BALF obtained from wild-type mice when compared with RAGE knockout animals. Two additional markers of inflammation, sTNF-R1 and MIP-1g, were observed to be roughly threefold greater in wild-type BALF. Smaller yet notable increases in the expression of IL-6 and MCP-1 in BALF from wild-type mice were also detected. When the volume of BALF was normalized for each group of mice, regardless of protein concentration, differences in the secretion of LIX, sTNF-R1, MIP-1g, IL-6, and MCP-1 were 26.48-, 14.49-, 13.73-, 5.85-, and 5.47-fold higher in wild-type mice when compared with RAGE knockout mice, respectively (Figure 5). Hyperoxia Induces RAGE Expression in Mouse Lung Parenchyma and Primary AECs
Because the absence of RAGE appeared to influence vascular permeability to both fluid and cells, we assessed the expression of RAGE in both normoxic and hyperoxic conditions in vivo. We discovered that RAGE expression was notably induced in the lungs of wild-type C57BL/6 mice exposed to hyperoxia for 4 days when compared with normoxic control littermates (Figures 6A and 6B). Antibody specificity was determined by immunostaining for RAGE in lungs from RAGE knockout mice exposed to normoxia or hyperoxia. Although not completely devoid of positive RAGE staining, RAGE knockout lung sections were easily differentiated from the prominent staining observed in sections from wild-type mice (Figures 6C and 6D). When negative control lung sections from normoxic or hyperoxic wild-type mice were incubated without primary antibody, no detectible RAGE immunoreactivity resulted (data not shown). Furthermore, immunoblotting identified detectible increases in both membrane-bound RAGE and sRAGE isoforms in lung homogenates after hyperoxia exposure (Figure 6E).
Figure 2. Parenchymal histology in wild-type and RAGE knockout mice exposed to hyperoxia. RAGE knockout and wild-type mice were exposed to 75% O2 for 4 days. Mice were immediately killed and their lungs were inflation fixed and processed for histology by standard techniques. Wild-type mice had modest evidence (2.05 6 0.63 occurrences per 2003 field) of alveolar damage and hemorrhage (A, arrows), whereas RAGE knockout mice had significantly less (0.67 6 0.71) instances of adverse histology in the respiratory region of the lung (B). Images are representative; original magnification, 2003.
548
AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL 42 2010 TABLE 1. BRONCHOALVEOLAR LAVAGE CELL DIFFERENTIAL IN WILD-TYPE AND RECEPTORS FOR ADVANCED GLYCATION END-PRODUCTS–NULL MICE Mononuclear Cells Wild type RAGE null
Normoxia Hyperoxia Normoxia Hyperoxia
97.8 88.2 98.4 86.7
6 6 6 6
0.9 1.6 0.7 1.4
PMNs 0.0 5.2 0.4 4.9
6 6 6 6
0.0 0.9* 0.2 1.1*
Other 1.8 7.3 1.1 7.9
6 6 6 6
0.6 0.8 0.5 1.2
Definition of abbreviations: PMNs, polymorphonuclear neutrophils; RAGE, receptors for advanced glycation end-products. * P < 0.05 versus normoxia.
Figure 3. RAGE knockout mice had less total protein in bronchoalveolar lavage fluid (BALF) and diminished lung fluid after hyperoxia exposure. BALF was sampled from RAGE knockout and wild-type mice (n 5 8/group) after 4 days in hyperoxia (H) (75% O2) and compared with age-matched normoxic control animals (N). (A) Total protein in pooled lavage fluid was significantly decreased in RAGE knockout mice after hyperoxia, indirectly demonstrating protection against vascular permeability. (B) Lung wet-to-dry weight ratios from wild-type and RAGE knockout mice exposed to normoxia or hyperoxia for 4 days (n 5 8 mice/group) revealed protection of RAGE knockout mice from hyperoxia-induced elevated lung water content and permeability. *P < 0.05.
To further characterize the observation that hyperoxia induces RAGE expression in vivo, we evaluated epithelial cell contribution to RAGE up-regulation after hyperoxia. Primary AECs were isolated from wild-type C57BL/6 mice following procedures outlined in MATERIALS AND METHODS. RAGE expression was assessed in AECs after 48 hours of 80% oxygen exposure commencing on the fourth day after isolation. Compared with cells maintained in normoxic conditions, AECs exposed to hyperoxia demonstrated a significant 46% increase in RAGE mRNA expression (Figure 6F). AECs were also assessed by immunoblotting to demonstrate hyperoxia-induced RAGE protein expression compared with normoxic control animals (Figure 6G). An additional set of experiments were completed in which AECs isolated from RAGE knockout mice were compared with wild-type AECs after either normoxic or hyperoxic exposure for 48 hours. As demonstrated in Figure 6F, RAGE induction was again confirmed in wild-type AECs exposed to hyperoxia, whereas no RAGE was detected in cells isolated from RAGE knockout mice, regardless of oxygen tension (data not shown). Experiments aimed at characterizing AEC phenotype were also conducted. On the third day after isolation, SPC and T1a, markers for ATII and ATI cells, respectively, were detectible by quantitative RT-PCR, and assigned a normalized quantity of 100% (Figure 6H). As cells persisted in normoxic culture, T1a steadily increased to 275% on the sixth day, whereas SPC
Figure 4. RAGE knockout mice had fewer total BALF cells after hyperoxia exposure. Cell counting revealed a statistically significant decrease in total cell numbers in BALF isolated from RAGE knockout mice exposed to hyperoxia when compared with wild-type control animals (n 5 8/group). *P < 0.05.
precipitously decreased to almost undetectable levels (Figure 6H), demonstrating a transition from an ATII phenotype toward an ATI-like phenotype over time in culture.
DISCUSSION Characteristics of Hyperoxia-Induced ALI Are Diminished in RAGE Knockout Mice
The lungs are one of the first organs exposed to elevated oxygen tension. They are therefore endowed with a variety of pro-
Figure 5. RAGE knockout mice had diminished secretion of proinflammatory molecules after hyperoxia exposure. Pooled lavage fluid from RAGE knockout and wild-type mice (n 5 8/group) after 4 days in 75% O2 were assayed with a ChemiArray Mouse Inflammatory Antibody Array to determine relative quantities of secreted markers of inflammation. Blots were assigned numerical values based on densitometry. When an equal 20 mg of BALF protein was assayed, increased secretion of LPS-Induced CXC chemokine (LIX), IL-6, monocyte chemotactic protein (MCP)–1, soluble TNF receptor 1 (sTNF-R1), and macrophage inflammatory factor (MIP)–1g was observed in wild-type mice when compared with RAGE knockout mice (normalized to protein). Because RAGE knockout mice had, on average, 4.238-fold more protein per milliliter BALF when compared with wild-type mice (Figure 3A), this multiple was used to determine the quantity of secreted molecules when equal volumes of BALF were considered (normalized to volume). Four positive control animals and four negative control animals were included (rectangles).
Reynolds, Schmitt, Kasteler, et al.: RAGE Ablation Diminishes Hyperoxia-Induced ALI
549
Figure 6. RAGE expression increased in lung parenchyma and alveolar type I (ATI)–like primary alveolar epithelial cells (AECs) after exposure to hyperoxia. (A–D ) Immunostaining revealed detectible basal RAGE expression in wildtype lung parenchymal cells exposed to normoxia (A), and significantly increased RAGE expression in lungs after 4 days of 75% oxygen exposure (B). Staining for RAGE in RAGE knockout mice revealed minimal to no RAGE detection (C and D). (E ) Immunoblotting for RAGE in mouse lung homogenates identified hyperoxia-induced increases in both membrane-bound RAGE (mRAGE) and soluble RAGE (sRAGE). (F ) Primary AECs were isolated and plated as described in MATERIALS AND METHODS. Quantitative real-time PCR revealed a significant 46% increase in RAGE mRNA in cells exposed to 48 hours of 80% oxygen commencing on the fourth day after isolation when compared with cells in normoxia. (G) Immunoblotting revealed markedly increased RAGE protein expression in AECs after hyperoxia exposure when compared with normoxic control animals. (H ) Primary AECs were plated and maintained in normoxia. Commencing on the third day after initial isolation, quantitative real-time PCR revealed consistent up-regulation of T1a, whereas surfactant protein C (SPC) expression was almost completely ablated, demonstrating that the AECs used in our studies have a distinct ATI-like phenotype. In vitro experiments were performed in triplicate, and significant differences are noted (*P < 0.05).
tective mechanisms. Despite these mechanisms, inspiration of high concentrations of oxygen for extended periods of time may still result in ALI (18, 19). Because the features of hyperoxia are predictable and quite similar to those found in other forms of ALI, hyperoxic exposure of mice has become a well-established model of ALI. Data presented in the current article show that characteristics of hyperoxia-induced lung injury, including damage to the pulmonary vasculature and cellular infiltration into the airspaces, are reduced when RAGE signaling is inhibited through gene targeting (Figures 2–4,). Although only modest histological manifestations of ALI were observed, such as altered leukocyte infiltration and sporadic hemorrhage in respiratory airspaces, significant differences in lung wet-to-dry weight ratios and BAL protein concentrations reveal important characteristics likely central to the delay in mortality observed in RAGE knockout mice. Diminished vascular permeability and fluid accumulation in RAGE knockout mice elicited by hyperoxia exposure may contribute to less noncardiogenic pulmonary edema, and therefore influence the observed delay in death. Combined, these data suggest that there is a prominent role for RAGE in modulating the inflammatory response involved in the orchestration of lung injury. Molecules involved in signaling pathways associated with the inflammatory response were also differentially regulated in RAGE knockout mice compared with wild-type control animals. Although additional, more quantitative research is necessary, our initial array revealed an interesting number of proinflammatory factors potentially downstream from RAGE that may participate in an inflammatory response to hyperoxia. LIX, sTNF-R1, and MIP-1g were all markedly diminished in BALF isolated from RAGE knockout mice after hyperoxia exposure compared with wild-type control animals. LIX was the most differentially expressed factor. LIX, or chemokine ligand 5 (CXCL5), is the mouse homolog of two human chemokines, epithelial cell– derived neutrophil activating peptide 78 and granulocyte chemo-
tactic protein 2 (20–22). LIX is secreted by AECs stimulated by IL-1 or TNF-a, and it has been implicated in the attraction and accumulation of neutrophils (23). These functions attributed to LIX are intriguing given that there was no measurable difference in IL-1 or TNF-a secretion in the array. It is possible that the stimulated expression of LIX and the resulting persistent inflammation occurs after the immediate effects of IL-1 and TNF-a have transpired. sTNF-R1 is a circulating form of the receptor that can be secreted by AECs (24). sTNF-R1 is often used as an effective inflammatory marker in identifying risk to several types of inflammatory diseases, because of its long half-life compared with TNF-a (25). MIP-1g is a CCL chemokine known to induce the migration of macrophages (26). IL-6 and MCP-1 were two factors that were also diminished in BALF obtained from RAGE knockout mice when compared with wild-type animals. IL-6 is classically characterized as a proinflammatory cytokine acutely secreted by macrophages and T lymphocytes, and as an acutephase reactant from liver, whereas MCP-1 is involved in the recruitment of monocytes, T lymphocytes, eosinophils, and basophils (27). It is clear that elevated levels of these and other inflammatory molecules in wild-type mice would lead to a more rapid, enhanced inflammatory state. Our finding that hyperoxiainduced lung injury is delayed in RAGE knockout mice demonstrates an inflammatory role for RAGE signaling related to the recruitment of activated leukocytes and their associated effects, including additional cytokine elaboration, alveolar wall damage, and vascular perturbation. It is noteworthy that the interpretation of the data related to cytokine levels may be limited due to the pooling of samples from several mice in each group evaluated. For this reason, confirmatory studies that statistically evaluate quantitative changes in cytokine expression are necessary and underway. In addition to the several proinflammatory molecules detected in this study, further research that evaluates RAGE ligands, including HMGB-1, in the context of hyperoxia is also warranted.
550
AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL 42 2010
HMGB-1 was initially characterized as a nonhistone DNAbinding protein important in gene transcription (28). It is released from necrotic cells, but not apoptotic cells, and it is actively secreted by macrophages and monocytes via a nonclassical, vesicle-mediated pathway in response to proinflammatory stimuli, such as bacterial LPS and TNF-a (28). Extracellular HMGB-1 functions both as a proinflammatory cytokine and as a migration factor that leads to secretion of TNF-a and IL-1b (29), and upregulation of cell adhesion molecules, including intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and E-selectin (30). Abraham and colleagues (31) discovered that HMGB-1 caused acute inflammation and edema when insufflated into the lungs of wild-type mice. What remains unanswered is whether insufflated HMGB-1 activates RAGE signaling to elicit the observed inflamed/edematous phenotype. In our study, decreases in inflammatory markers and diminished lung fluid were observed in RAGE knockout mice exposed to hyperoxia, suggesting a potential hindrance in inflammation mediated by RAGE signaling. A complete characterization of HMGB-1 in the context of hyperoxia exposure is underway so that its specific contributions to cytokine elaboration and changes in vascular permeability mediated by RAGE and other redundant receptors can be elucidated. RAGE Is Induced in Lung Parenchymal Cells and Primary AECs after Exposure to Hyperoxia
The biology of epithelial cells exposed to high oxygen tension involves several coordinated mechanisms that most often culminate in cell injury and death (32). The finding that both membrane and sRAGE were up-regulated in the lungs after exposure to hyperoxia suggests intriguing RAGE functions in vivo. It is clear that further research is needed to compare sRAGE-mediated mechanisms that may compensate for increased proinflammatory cytokine expression and membrane-bound RAGE–mediated mechanisms that enhance proinflammatory signaling. After 2 days in culture, AECs continue to precipitously lose ATII markers, such as surfactant protein C, and consistently upregulate ATI markers, including T1a. Previous studies by Lizotte and colleagues (33) suggested that RAGE expression increased in the lungs of mice from Embryonic Day 19 to 8 days of age. It is therefore possible that oxygen may serve as a factor that enhances the differentiation of ATII cells into ATI cells. Further work will be required to elucidate interesting questions relating to the biology of RAGE and the role of oxygen in ATII–ATI cell differentiation. However, in light of our in vivo data demonstrating a role for RAGE in hyperoxia-induced lung injury, the finding that RAGE was significantly induced in ATI-like AECs suggests that RAGE may be important in mechanisms related to persistent inflammation near the respiratory membrane during hyperoxia exposure. As an early response to hyperoxia, up-regulation of RAGE expression in AECs may impact proinflammatory pathways, thereby eventually contributing to impaired pulmonary gas exchange and cellular death. This research also supports previous findings relating to the discovery that RAGE is a marker of ATI cell injury in both animal models and clinical cases of ALI (34, 35). Understanding the role of RAGE in hyperoxia-induced signaling pathways is therefore critical in clarifying the pathogenesis of acute lung inflammation and injury from exposure to elevated oxygen tensions. Conclusions
Hyperoxia-induced mortality and ALI are delayed in mice that lack RAGE expression. The protection from ALI conferred by RAGE abrogation involves altered expression and/or secretion of important proinflammatory molecules that, in addition to other
prominent factors, influence mortality, alveolar integrity, vascular permeability, and leukocyte recruitment. We further conclude that lung parenchyma and primary AECs induce RAGE expression during hyperoxia. High concentrations of inspired oxygen can be life saving in individuals with respiratory failure, but can also result in lung injury. Further research into the important role of RAGE signaling during hyperoxia-induced inflammation may lead to strategies for blocking this proinflammatory axis, and for making high concentrations of oxygen a better tolerated and safer modality of therapy. Conflict of Interest Statement: None of the authors has a financial relationship with a commercial entity that has an interest in the subject of this manuscript.
References 1. Rubenfeld GD, Caldwell E, Peabody E, Weaver J, Martin DP, Neff M, Stern EJ, Hudson LD. Incidence and outcomes of acute lung injury. N Engl J Med 2005;353:1685–1693. 2. Dos Santos CC. Hyperoxic acute lung injury and ventilator-induced/ associated lung injury: new insights into intracellular signaling pathways. Crit Care 2007;11:126. 3. Mantell LL, Horowitz S, Davis JM, Kazzaz JA. Hyperoxia-induced cell death in the lung—the correlation of apoptosis, necrosis, and inflammation. Ann N Y Acad Sci 1999;887:171–180. 4. Thornally PJ. Cell activation by glycated proteins: AGE receptors, receptor recognition factors and functional classsification of AGEs. Cell Mol Biol (Noisy-le-grand) 1998;44:1013–1023. 5. Reynolds PR, Ksteler SD, Cosio MG, Sturrock A, Huecksteadt TP, Hoidal RAGE Jr. developmental expression and positive feedback regulation by Egr-1 during cigarette smoke exposure in pulmonary epithelial cells. Am J Physiol Lung Cell Mol Physiol 2008;294:L1094– L1101. 6. Schmidt AM, Yan SD, Yan SF, Stern DM. The multiligand receptor RAGE as a progression factor amplifying immune and inflammatory responses. J Clin Invest 2001;108:949–955. 7. Hofmann MA, Drury S, Fu C, Qu W, Taguchi A, Lu Y, Avila C, Kambham N, Bierhaus A, Nawroth P. RAGE mediates a novel proinflammatory axis: a central cell surface receptor for S100/calgranulin polypeptides. Cell 1999;97:889–901. 8. Taguchi A, Blood DC, del Toro G, Canet A, Lee DC, Qu W, Tanji N, Lu Y, Lalla E, Fu C. Blockade of amphoterin/RAGE signalling suppresses tumor growth and metastases. Nature 2000;405:354–360. 9. Yan SD, Chen X, Fu J, Chen M, Zhu H, Roher A, Slattery T, Nagashima M, Morser J, Migheli A. RAGE and amyloid beta peptide neurotoxicity in Alzheimer’s disease. Nature 1996;382:685–691. 10. Sternberg DI, Gowda R, Mehra D, Qu W, Weinberg A, Twaddell W, Sarkar J, Wallace A, Hudson B, D’Ovidio F, et al. Blockade of receptor fir advanced glycation end product attenuates pulmonary reperfusion injury in mice. J Thorac Cardiovasc Surg 2008;136:1576–1585. 11. Calfee CS, Ware LB, Eisner MD, Pasrons PE Thompson BT, Wickersham N, Matthay MA; NHLBI ARDS Network. Plasma receptor for advanced glycation end products and clinical outcomes in acute lung injury. Thorax 2008;63:1083–1089. 12. Zhang H, Tasaka S, Shiraishi Y, Fukunaga K, Yamada W, Seki H, Ogawa Y, Miyamoto K, Nakano Y, Hasegawa N, et al. Role of soluble receptor for advanced glycation end products on endotoxininduced lung injury. Am J Respir Crit Care Med 2008;178:356–362. 13. Queisser MA, Kouri FM, Konigshoff M, Wygrecka M, Schubert U, Eickelberg O, Preissner KT. Loss of RAGE in pulmonary fibrosis: molecular relations to functional changes in pulmonary cell types. Am J Respir Cell Mol Biol 2008;39:337–345. 14. Englert JM, Hanford LE, Kaminski N, Tobolewski JM, Tan RJ, Fattman CL, Ramsgaard L, Richards TJ, Loutaev I, Nawroth PP, et al. A role for the receptor for advanced glycation end products in idiopathic pulmonary fibrosis. Am J Pathol 2008;172:583–591. 15. Wendt TM, Tanji N, Guo J, Kislinger TR, Qu W, Lu Y, Bucciarelli LG, Rong LL, Moser B, Markowitz GS, et al. RAGE drives the development of glomerulosclerosis and implicates podocyte activation in the pathogenesis of diabetic neuropathy. Am J Pathol 2003;162:1123–1137. 16. Reynolds PR, Mucenski ML, Le Cras TD, Nichols WC, Whitsett JA. Midkine is regulated by hypoxia and causes pulmonary vascular remodeling. J Biol Chem 2004;279:37124–37132. 17. Paine R III, Wilcoxen SE, Morris SB, Sartori C, Baleeiro CE, Matthay MA, Christensen PJ. Transgenic overexpression of granulocyte macrophage-
Reynolds, Schmitt, Kasteler, et al.: RAGE Ablation Diminishes Hyperoxia-Induced ALI
18. 19.
20.
21.
22.
23.
24.
25.
26.
colony stimulating factor in the lung prevents hyperoxia lung injury. Am J Pathol 2003;163:2397–2406. Heffner JE, Repine JE. Pulmonary strategies of antioxidant defense. Am Rev Respir Dis 1989;140:531. Watkins RH, D’Angio CT, Ryan RM, Patel A, Maniscalco WM. Differential expression of VEGF mRAN splice variants in newborn and adult hyperoxic lung injury. Am J Physiol 1999;276:L858. Rovai LE, Herschman HR, Smith JB. Cloning and characterization of the human granulocyte chemotactic protein–2 gene. J Immunol 1997; 158:5257–5266. Smith JB, Rovai LE, Herschman HR. Sequence similarities of a subgroup of CXC chemokines related to murine LIX: implications for the interpretation of evolutionary relationships among chemokines. J Leukoc Biol 1997;62:598–603. Smith JB, Wadleigh DJ, Xia YR, Mar RA, Herschman HR, Lusis AJ. Cloning and genomic localization of the murine LPS-induced CXC chemokine (LIX) gene, Scyb5. Immunogenetics 2002;54:599–603. Jeyaseelans S, Chu HW, Young SK, Worthen GS. Transcriptional profiling of lipopolysaccharide-induced acute lung injury. Infect Immun 2004;72:7247–7256. Parsons PE, Matthay MA, Ware LB, and Eisner MD. Elevated plasma levels of soluble TNF receptors are associated with morbidity and mortality in patients with acute lung injury. Am J Physiol Lung Cell Mol Physiol 2005;288:L426–L431. Moreau E, Phillipe J, Couvent S, Leroux-Roels G. Interference of sTNFalpha receptors in immunological detection of tumor necrosis factoralpha. Clin Chem 1996;42:1450–1453. Wang W, Bacon KB, Oldham ER, Schall TJ. Molecular cloning and functional characterization of human MIP-1g, a new C-C chemokine related to mouse CCF-18 and C10. J Clin Immunol 1998;18:214–224.
551
27. Matsushima K, Larsen CG, DuBois GC, Oppenheim JJ. Purification and characterization of a novel monocyte chemotactic and activating factor produced by a human myelomonocytic cell line. J Exp Med 1989;169:1485–1490. 28. Wang H, Bloom O, Zhang M, Vishnubhakat JM, Ombrellino M, Che J, Frazier A, Yang H, Ivanova S, Borovikova L, et al. HMG-1 as a late mediator of endotoxin lethality in mice. Science 1999;285:248–251. 29. Anderson KV. Toll signaling pathways in the innate immune response. Curr Opin Immunol 2000;12:13–19. 30. Fiuza C, Bustin M, Talwar S, Tropea M, Gerstenberger E, Shelhamer JH, Suffredini AF. Inflammation-promoting activity of HMGB1 on human microvascular endothelial cells. Blood 2003;101:2652–2660. 31. Abraham E, Arcaroli J, Carmody A, Wang H, Tracey KJ. HMG-1 as a mediator of acute lung inflammation. J Immunol 2000;165:2950–2954. 32. Fox RB, Hoidal JR, Brown DM, Repine JE. Pulmonary inflammation due to oxygen toxicity: involvement of chemotactic factors and polymorphonuclear leukocytes. Am Rev Respir Dis 1981;123:521–523. 33. Lizotte PP, Hanford LE, Enghild JJ, Nozik-Grayck E, Giles B, Oury TD. Developmental expression of the receptor for advanced glycation end products (RAGE) and its response to hyperoxia in the neonatal rat lung. BMC Dev Biol 2007;7:15. 34. Uchida T, Shirasawa M, Ware LB, Kojima K, Hata Y, Mikata K, Mednick G, Matthay ZA, Matthay MA. Receptor for advanced glycation end products is a marker of type I cell injury in acute lung injury. Am J Respir Crit Care Med 2006;173:1008–1015. 35. Briot R, Frank JA, Uchida T, Lee JW, Calfee CS, Matthay MA. Elevated levels of the receptor for advanced glycation end products, a marker of alveolar epithelial type I cell injury, predict impaired alveolar fluid clearance in isolated perfused human lungs. Chest 2009; 135:269–275.
