Regulation of cell proliferation of human induced pluripotent stem cell ...

Am J Physiol Cell Physiol 303: C115–C125, 2012. First published February 22, 2012; doi:10.1152/ajpcell.00326.2011.

Regulation of cell proliferation of human induced pluripotent stem cell-derived mesenchymal stem cells via ether-a`-go-go 1 (hEAG1) potassium channel Jiao Zhang,1* Yau-Chi Chan,1* Jenny Chung-Yee Ho,1,2 Chung-Wah Siu,1,2 Qizhou Lian,1,2,3 and Hung-Fat Tse1,2 1

Cardiology Division, Department of Medicine, University of Hong Kong, Hong Kong; 2Research Centre of Heart, Brain, Hormone, and Healthy Aging, Li Ka Shing Faculty of Medicine, University of Hong Kong, Hong Kong; and 3Eye Institute, Li Ka Shing Faculty of Medicine, University of Hong Kong, Hong Kong

Submitted 31 August 2011; accepted in final form 21 February 2012

Zhang J, Chan YC, Ho JC, Siu CW, Lian Q, Tse HF. Regulation of cell proliferation of human induced pluripotent stem cell-derived mesenchymal stem cells via ether-à-go-go 1 (hEAG1) potassium channel. Am J Physiol Cell Physiol 303: C115–C125, 2012. First published February 22, 2012; doi:10.1152/ajpcell.00326.2011.—The successful generation of a high yield of mesenchymal stem cells (MSCs) from human induced pluripotent stem cells (iPSCs) may represent an unlimited cell source with superior therapeutic benefits for tissue regeneration to bone marrow (BM)-derived MSCs. We investigated whether the differential expression of ion channels in iPSC-MSCs was responsible for their higher proliferation capacity than BM-MSCs. The expression of ion channels for K⫹, Na⫹, Ca2⫹, and Cl⫺ was examined by RT-PCR. The electrophysiological properties of iPSC-MSCs and BM-MSCs were then compared by patchclamp experiments to verify their functional roles. Significant mRNA expression of ion channel genes including KCa1.1, KCa3.1, KCNH1, Kir2.1, SCN9A, CACNA1C, and Clcn3 was observed in both human iPSC-MSCs and BM-MSCs, whereas Kir2.2 and Kir2.3 were only detected in human iPSC-MSCs. Five types of currents [big-conductance Ca2⫹-activated K⫹ current (BKCa), delayed rectifier K⫹ current (IKDR), inwardly rectifying K⫹ current (IKir), Ca2⫹-activated K⫹ current (IKCa), and chloride current (ICl)] were found in iPSC-MSCs (83%, 47%, 11%, 5%, and 4%, respectively) but only four of them (BKCa, IKDR, IKir, and IKCa) were identified in BM-MSCs (76%, 25%, 22%, and 11%, respectively). Cell proliferation was examined with MTT or bromodeoxyuridine assay, and doubling times were 2.66 and 3.72 days for iPSC-MSCs and BM-MSCs, respectively, showing a 1.4-fold discrepancy. Blockade of IKDR with short hairpin RNA or human ether-a`-go-go 1 (hEAG1) channel blockers, 4-AP and astemizole, significantly reduced the rate of proliferation of human iPSCMSCs. These treatments also decreased the rate of proliferation of human BM-MSCs albeit to a lesser extent. These findings demonstrate that the hEAG1 channel plays a crucial role in controlling the proliferation rate of human iPSC-MSCs and to a lesser extent in BM-MSCs. patch clamp; bromodeoxyuridine; 3-(4,5-dimethyl-thiazol-2-yl)-2,5dephenyltetrazolium bromide

(MSCs) derived from different somatic tissues, such as bone marrow (BM), adipose tissue, and umbilical cord blood, have been increasingly used as a potential cell source for tissue engineering and regenerative medicine owing to their proliferative potential and multilineage differentiation capacity (19, 27). Recently, our group (25) has

HUMAN MESENCHYMAL STEM CELLS

* J. Zhang and Y.-C. Chan contributed equally to this work and are co-first authors. Address for reprint requests and other correspondence: H.-Fat Tse, Cardiology Division, Dept. of Medicine, The Univ. of Hong Kong, Rm. 1928, Block K, Queen Mary Hospital, Hong Kong (e-mail: [email protected]). http://www.ajpcell.org

successfully differentiated functional MSCs from human induced pluripotent stem cells (iPSCs) that show greater therapeutic potential than those derived from BM. In a mouse model of severe hindlimb ischemia, iPSC-MSCs had superior survival and engraftment following transplantation to induce vascular and muscle regeneration than BM-MSCs (25). Nevertheless, the mechanisms for a higher survival and proliferative capacity of iPSC-MSCs remain unclear.1 Prior studies have reported that multiple functional ion channels, including the big-conductance Ca2⫹-activated outward K⫹ current (BKCa) (12, 18, 23), a slow K⫹ current (12), L-type Ca2⫹ current (ICa.L) (12, 23), a delayed rectifier K⫹ current (IKDR), a transient outward K⫹ current (Ito), and the tetrodotoxin-sensitive sodium current (INa.TTX) (23) are expressed in human BM-MSCs. Similarly, Park et al. (29) demonstrated that inward rectifier K⫹ current (IKir), BKCa, IKDR, Ito, and INa.TTX are expressed in human MSCs derived from umbilical cord vein. Interestingly, these ion channels have been implicated in the regulation of cell proliferation. For example, KCa1.1-encoded BKCa is involved in the proliferation of human breast cancer cells (5); KCa3.1-encoded IKCa regulates the proliferation of mouse BM-MSCs (35), human breast cancer cells (28), and human endothelial cells (11) and KCNH1-encoded IKDR affects the proliferation of both human colonic carcinoma cells (33) and human leukemia cells (1). On the other hand, IKDR encoded by KCNC4, KCNQ2, or KCNS3 but not KCNH1 has also been shown to regulate the proliferation of undifferentiated human iPSCs (16). Nevertheless, the ion channel expression pattern and their functional role on cell proliferation in iPSC-MSCs are unknown. In this study, we hypothesized that differential expression of ion channels in iPSC-MSCs contributes to their higher proliferation capacity compared with BM-MSCs. We utilized reverse transcription-polymerase chain reaction (RT-PCR) and whole cell patch-clamp techniques to identify the expression of various ion channels in mRNA and functional level in both human iPSC-MSCs and BM-MSCs. On the basis of patchclamp studies, we identified five functional ionic currents (i.e., BKCa, IKDR, IKir, IKCa, and ICl) in human iPSC-MSCs, and four in human BM-MSCs (i.e., BKCa, IKDR, IKir, and IKCa). Of these, IKCa and IKir were observed in human BM-MSCs for the first time. The functional role of the current-encoding ion channels in the proliferation of human iPSC-MSCs and BMMSCs was then estimated using 3-(4,5-dimethyl-thiazol-2-yl)2,5-dephenyltetrazolium bromide (MTT) assay and a nonra1 This article is the topic of an Editorial Focus by Amy L. Firth and Jason X.-J. Yuan (8a).

0363-6143/12 Copyright © 2012 the American Physiological Society

C115

C116

hEAG1 POTASSIUM CHANNEL REGULATES iPSC-MSC PROLIFERATION

dioactive chemiluminescent bromodeoxyuridine (BrdU) kit. Our results demonstrated that KCNH1-encoded human ethera`-go-go 1 (hEAG1) potassium channel plays an important role in regulating the proliferation of iPSC-MSCs and BM-MSCs. MATERIALS AND METHODS

Cell culture. Human BM-MSCs were purchased from Lonza Walkersville (Walkersville, MD). Human iPSC-MSCs were derived from iPSC (iMR90)-4, which was acquired from WiCell Research Institute (Madison, WI) (25). In brief, iPSCs were allowed to differentiate in growth factor medium for 1 wk, then CD24-CD105⫹ cells were selected and enlarged from a single cell colony to yield iPSC-MSCs. Human BM-MSCs from passage 1 to 8 and human iPSC-MSCs from passage 4 to 13 were used in this study. The cells were cultured as monolayers in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, Hong Kong) supplemented with 10% fetal bovine serum (GIBCO), 5 ng/ml basic fibroblast growth factor (GIBCO), and 5 ng/ml epidermal growth factor (Peprotech). The cells were harvested for RT-PCR, electrophysiological recording determination, and cell proliferation assay via trypsinization. Reverse transcription and real-time PCR. Total RNA was extracted from human BM-MSCs or human iPSC-MSCs using Tri Reagent Solution (Applied Biosystems, Hong Kong). Single-stranded cDNA was synthesized from ⬃1 ␮g of total RNA using the QuantiTech Rev. Transcription Kit (QIAGEN, Hong Kong), followed by polymerase chain reactions with various ion channel-specific primers (Table 1). Equal aliquots of the PCR products were electrophoresed through 2% agarose gels and visualized by ethidium bromide staining or underwent real-time PCR using StepOne Real-Time PCR Kit (Applied Biosystems). Solutions and reagents. Tyrode’s solution for electrophysiological study contained (mM) 140 NaCl, 5.0 KCl, 1.0 MgCl2, 1.8 CaCl2, 10 glucose, and 10 HEPES; pH was adjusted to 7.3–7.4 with NaOH. The internal pipette solution contained (mM) 110 K-aspartate, 20 KCl, 1.0 MgCl2, 0.1 GTP, 5.0 Mg-ATP, 5.0 Na2-phosphocreatine, 0.05 EGTA, and 10 HEPES; pH was adjusted to 7.3 with KOH. Both solutions were filtered (0.22 ␮m) before use. Reagents including paxilline, 4-aminopyridine (4-AP), clotrimazole (CLT), 4,4=-diisothiocyanatostilbene-2,2=-disulfonic acid disodium salt hydrate (DIDS), and puromycin were purchased from Sigma-Aldrich (St. Louis, MO). Astemizole was purchased from Tocris Bioscience. MTT was the product of Roche (Penzberg, Germany). Paxilline, 4-AP, CLT, DIDS, and astemizole were first dissolved in dimethyl sulfoxide (DMSO) and diluted to the final concentrations in Tyrode’s solution or cell culture medium when in use. The final concentration of DMSO was ⬍0.5%. Electrophysiology. Trypsinized cells were first seeded onto glass coverslips in a medium-containing cell culture plate. After a 30-min recovery period in the incubator, the cells were transferred to a cell chamber containing Tyrode’s solution for patch-clamp experiments. Standard whole cell patch-clamp recordings were performed at room temperature using a HEKA EPC-10 patch-clamp amplifier and PULSE software (version 8.77; HEKA Instruments, Southboro, MA) (2 3, 25). Pipettes were prepared from 1.5-mm thin-walled borosilicate glass tubes (1.2 mm OD) using a P-97 Flaming/Brown micropipette puller (Sutter Instrument, Novato, CA) and had typical resistances of 3– 4 M⍀ when filled with the internal pipette solution. Upon membrane rupturing, the resting membrane potential was first recorded without current input. Measurements were corrected for the liquid junction potential of ⫹15.6 mV. Voltage-clamp recordings were then performed applying protocols indicated in RESULTS. Cell proliferation assay. Cell proliferation assay was used to estimate the effects of ion channel blockage on the proliferation of human iPSC-MSCs and BM-MSCs, as well as their doubling time. During MTT assay, cells were seeded onto a 96-well plate (353072, Becton, Dickinson and Company) at a density of 1,000 cells per well. After a 24-h recovery period, cells were incubated in a 300-␮l ion

channel blocker-containing or control culture medium for 0, 1, 3, or 5 days. When undergoing MTT assay, cells were incubated in medium containing 100 ␮l MTT (0.5 mg/ml) at 37°C for 3 h. To dissolve the violet crystals, 100 ␮l DMSO were added to each well for 10 min. The plates were then read (wavelength: 570 nm; reference: 630 nm) using a ␮Quant microplate spectrophotometer (NorthStar, Bedfordshire, UK). In BrdU assay, cells were seeded onto a 96-well plate (3610, Corning, NY) at a density of 2,000 cells per well. After a 24-h recovery period, cells were incubated in a 200-␮l ion channel blockercontaining or control culture medium for 3 days. Cell proliferation was then estimated using BrdU kit (Roche Diagnostics, Mannheim, Germany) following the manufacturer’s protocols. Briefly, BrdU labeling solution was added to each well to a final concentration of 10 ␮M. After incubation at 37°C for 2.5 h, medium was removed and cells were fixed with FixDenat at room temperature for half an hour. The fixed cells were then incubated with anti-BrdU-POD (1:100 diluted, 100 ␮l/well) at room temperature for 1.6 h, and washed with wash buffer for three times. Finally, substrate solution was added (100 ␮l/well), and luminescence was read at 403 nm by a Varioskan Flash Multimode Reader (Thermo Scientific). Results were standardized using control group values. Lentivirus production and transduction. KCNH1 short hairpin (sh)RNA, control shRNA plasmids, and shRNA support reagents for lentivirus production were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). KCNH1 shRNA and control shRNA lentiviruses were produced with 293 FT cells following the manufacturer’s protocol. Human iPSC-MSCs and BM-MSCs were seeded at a density of 0.8 ⫻ 105 cells per well in a six-well plate. On the next day, cells were divided into two groups respectively transduced with KCNH1 shRNA and control shRNA lentiviruses in fresh medium containing 3 ␮g/ml polybrene (Millipore, Billerica, MA). The medium was refreshed 24 h posttransduction. At 72 h posttransduction, 0.5 ␮g/ml puromycincontaining medium was added to select for positively transduced cells. Cells were then subcultured for BrdU assay. Statistical analysis. Results are presented as means ⫾ SE. The statistical significance of differences between two-group means was evaluated using unpaired or paired Student’s t-tests. Values of P ⬍ 0.05 represent statistical significance. RESULTS

Expression of ion channel mRNAs in human iPSC-MSCs and BM-MSCs. The expression of various common ion channels for sodium (Na⫹), potassium (K⫹), calcium (Ca2⫹), and chloride (Cl⫺) in human iPSC-MSCs and BM-MSCs was examined by RT-PCR as previously reported (12, 23, 29). The specific primers targeting these ion channel genes are listed in Table 1. Figure 1 shows the significant gene expression of KCa1.1 (responsible for BKCa), KCa3.1 (for IKCa), KCNH1 (for IKDR), Kir2.1 (for IKir), Clcn3 (for ICl), SCN9A (for INa.TTX), and CACNA1C (for ICa.L) in both human iPSC-MSCs and BM-MSCs. It is noticeable that the expression of KCNH1 in iPSC-MSCs was much higher than that in BM-MSCs. In addition, Kir2.2 and Kir2.3 (for IKir) were only detected in human iPSC-MSCs. The expression level of KCNH1 mRNA in both iPSC-MSCs and BM-MSCs was also examined via real-time PCR. It was a 2.95 ⫾ 0.85-fold change in iPSC-MSCs when compared with those in BM-MSCs using the 2⫺⌬⌬CT method (25a). Membrane ionic currents in human iPSC-MSCs and BM-MSCs. Membrane currents in human iPSC-MSCs and BM-MSCs were recorded using whole cell patch-clamp technique (Fig. 2). There were four types of membrane currents in human iPSCMSCs (in a total of 278 cells) and three types in BM-MSCs (n ⫽ 87). An outward current with noisy oscillation was activated

AJP-Cell Physiol • doi:10.1152/ajpcell.00326.2011 • www.ajpcell.org


C117

Table 1. Oligonucleotide sequences of primers used for RT-PCR Gene Name

Accession No.

Forward Primer (5=–3=)

Reverse Primer (5=–3=)

Product Size, bp

KCa1.1 KCa3.1 Kv1.2 Kv1.4 Kv1.5 Kv1.6 Kv2.1 Kv4.2 Kv4.3 KCNH1 (aka EAG1 or Kv10.1) Kir2.1 Kir2.2 Kir2.3 Clcn3 SCN9A CACNA1C GAPDH

U11058 NM_002250 NM_004974 NM_002233 NM_002234 NM_002235 NM_004975 NM_012281 NM_172198 NM_172362 NM_000891 NM_021012 NM_152868 NM_173872 NM_002977 NM_199460 NM_002046

ACAACATCTCCCCCAACC CGGGAACAAGTGAACTCCAT ATGAGAGAATTGGGCCTCCT ACGAGGGCTTTGTGAGAGAA GTAACGTCAAGGCCAAGAGC CTGGCTTGACCACAGTCTGA GTTGGCCATTCTGCCATACT GCTTGTCATCAATCCCCTTG ACGGAGACATGGTGCCTAAG TGGATTTTGCAAGCTGTCTG AACAGGGAGGTGTGGACAAG GAGGCTATCACAGGCTCAGG GCTTTGAGCCTGTGGTCTTC CATAGGTCAAGCAGAGGGTC GCTCCGAGTCTTCAAGTTGG AACATCAACAACGCCAACAA CCATCTTCCAGGAGCGAG

TCATCACCTTCTTTCCAATTC ACTGGGGAAAGTAGCCTGGT CCCACTATCTTTCCCCCAAT CACGATGAAGAAGGGGTCAT GGGAGGAAAGGAGTGAAAGG CTGGAGTTTGCCTGAGGAAG GCAAAGTGAAGCCCAGAGAC TCCAGTATCTGGGCTTTTCC CCCTGCGTTTATCAGCTCTC GAGTCTTTGGTGCCTCTTGC TAACCTGCTCTAGGGCTCCA CCCCAAGTTAAAAACCAGCA TTGGCTCTGTCCTGAGTGTG TATTTCCGCAGCAACAGG GGTTGTTTGCATCAGGGTCT AGGGCAGGACTGTCTTCTGA GCAGGAGGCATTGCTGAT

310 239 200 308 225 190 173 102 153 476 261 183 480 293 446 574 233

CACNA1C, voltage-dependent L-type calcium channel ␣-1C subunit; Clcn3, chloride channel 3; EAG, ether a` go-go; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; KCa, calcium-activated potassium channel; KCNH1, voltage-gated potassium channel subfamily H (eag-related) member 1; Kir, inwardly rectifying potassium channel; Kv, voltage-gated potassium channel; PCR, polymerase chain reaction; RT, reverse transcription; SCN9A, voltage-gated sodium channel type IX ␣ subunit.

at depolarization voltages between ⫺60 and ⫹60 mV from a holding potential of ⫺80 mV (Fig. 2, A and E), indicating that BKCa current (23) was recorded in most human iPSC-MSCs (83%, 231 of 278) and BM-MSCs (76%, 66 of 87). Another current, activated by the same protocol as BKCa, displayed a rapid activation at potentials between ⫺60 and ⫹10 mV and a weak inward rectification at ⫹20 to ⫹60 mV (Fig. 2, B and F). This suggests that IKCa (34) was observed in both human iPSC-MSCs (5%, 15 of 278) and BM-MSCs (11%, 10 of 87). A third current was an inward component activated by hyperpolarization voltage steps between ⫺120 and 0 mV from a holding potential of ⫺40 mV (Fig. 2, C and G). This inward component exhibited properties akin to IKir (7), which ap-

Fig. 1. RT-PCR for detecting ion channel genes expressed in human induced pluripotent stem cells (iPSC)-mesenchymal stem cells (MSCs) and bone marrow (BM)-MSCs. RT-PCR products show gene expression of KCa1.1 [big-conductance Ca2⫹-activated K⫹ current (BKCa)], KCa3.1 [Ca2⫹-activated K⫹ current (IKCa)], KCNH1 [delayed rectifier K⫹ current (IKDR)], Kir2.1 [inwardly rectifying K⫹ current (IKir)], SCN9A [tetrodotoxin-sensitive sodium current (INa.TTX)], and CACNA1C [L-type Ca2⫹ current (ICa.L)] in both iPSC-MSCs and BM-MSCs, with strong expression of Kir2.2 and Kir2.3 (IKir) in iPSC-MSCs.

peared in both human iPSC-MSCs (11%, 28 of 247) and BM-MSCs (22%, 19 of 87). The fourth current, elicited by voltage steps between ⫺120 and ⫹60 mV from a holding potential of ⫺40 mV, displayed a very small inward component and a large outward current with outward rectification (Fig. 2D). These properties indicate that this current is likely ICl (34) and was recorded in a small population of human iPSC-MSCs (4%, 12 of 278) but not human BM-MSCs. The recorded human iPSC-MSCs had a resting membrane potential (RMP) of ⫺25.5 ⫾ 1.1 mV, more depolarizing than that of BM-MSCs (⫺37.8 ⫾ 2.3 mV) (P ⬍ 0.001). In addition, the cell size of the human iPSC-MSCs studied was much smaller than human BM-MSCs (P ⬍0.001) as reflected by their respective average membrane capacitance (17.9 ⫾ 0.9 pF vs. 54.1 ⫾ 5.2 pF). Noisy oscillatory current. The noisy oscillatory current BKCa was determined by exposing cells to the BKCa-specific blocker paxilline (1 ␮M), as shown in the current tracing of a representative iPSC-MSC (Fig. 3A) and BM-MSC (Fig. 3C). The outward-rectifying current was remarkably reduced by paxilline. When treated with paxilline, the current at ⫹60 mV, was significantly reduced from 35.6 ⫾ 11.0 pA/pF to 1.7 ⫾ 0.6 pA/pF in human iPSC-MSCs (n ⫽ 10, P ⬍ 0.05), and from 32.9 ⫾ 5.7 pA/pF to 4.9 ⫾ 1.5 pA/pF in human BM-MSCs (n ⫽ 12, P ⬍ 0.001). The current-voltage (I-V) relationship of BKCa (i.e., paxilline-sensitive currents) was obtained by subtracting current recorded after paxilline treatment from the control currents accordingly. The reversal potential of BKCa is about ⫺50 mV in both iPSC-MSCs (n ⫽ 10, Fig. 3B) and BM-MSCs (n ⫽ 12, Fig. 3D). Delayed rectifier K⫹ current through hEAG1 potassium channel. There were some paxilline-resistant current components in both human iPSC-MSCs and BM-MSCs that can be further suppressed by IKDR blockers, 4-AP or astemizole. As shown in Fig. 4A, in iPSC-MSCs, paxilline (1 ␮M) partially suppressed the membrane current at ⫹60 mV from 61.3 ⫾ 18.3 pA/pF to 8.4 ⫾ 1.2 pA/pF; the remaining current was inhibited


C118


Fig. 2. Families of membrane currents in human iPSCMSCs and BM-MSCs. Typical membrane currents in iPSC-MSCs (A–D) and BM-MSCs (E–G) were elicited by the protocol shown in the inset. A, B, E, and F: noisy (A and E) and weak inwardly rectifying (B and F) currents activated at positive potentials. C and G: inwardly rectifying currents activated by hyperpolarized potentials. D: voltage-dependent currents with outward rectification.

by 4-AP (5 mM) to 3.4 ⫾ 1.1 pA/pF (n ⫽ 9, P ⬍ 0.001). In BM-MSCs (Fig. 4E), the membrane current at ⫹60 mV was inhibited by paxilline (1 ␮M) from 37.0 ⫾ 3.1 pA/pF to 3.3 ⫾ 0.6 pA/pF, and was further suppressed to 1.3 ⫾ 0.1 pA/pF by 4-AP (5 mM) (n ⫽ 4, P ⬍ 0.05). The I-V relationship of 4-AP-sensitive currents was depicted in both human iPSCMSCs (n ⫽ 9, Fig. 4B) and BM-MSCs (n ⫽ 4, Fig. 4F). To further confirm the existence of functional hEAG1 potassium channel, astemizole, a more specific hEAG1 channel blocker, was used to suppress the non-inactive current IKDR (9, 23). As shown in two representative iPSC-MSCs (Fig. 4, C and D) and one representative BM-MSC (Fig. 4G), a clear decay of IKDR was observed with astemizole (1 ␮M) treatment during a 2-s depolarization step when hEAG1 potassium channel almost achieves its maximal open probability (9). These results demonstrate that there are functional hEAG1 potassium channels in both human iPSC-MSCs and BM-MSCs.

Intermediate-conductance Ca2⫹-activated K⫹ current. Figure 5A shows that in a representative human iPSC-MSC, the outward current activated at depolarization voltages between ⫺60 and ⫹60 mV from a holding potential of ⫺80 mV was not inhibited by the BKCa blocker paxilline (1 ␮M) but by the IKCa blocker CLT (1 ␮M). In Fig. 5C, the outward current in a representative human BM-MSC was partially inhibited by paxilline (1 ␮M), with the remaining current completely suppressed by CLT (1 ␮M). The I-V relationship of IKCa in both human iPSC-MSCs (n ⫽ 12, Fig. 5B) and BM-MSCs (n ⫽ 5, Fig. 5D) is depicted with a reversal potential of around ⫺60 mV. These results indicate the presence of functional IKCa channels in both human iPSC-MSCs and BM-MSCs. Ba2⫹-sensitive IKir. The existence of IKir in cells was determined by using 0.5 mM Ba2⫹ as reported previously (7). The inward rectifying K⫹ current IKir was reversibly suppressed by 0.5 mM BaCl2 in both human iPSC-MSCs (Fig. 6A) and



C119

Fig. 3. BKCa in human iPSC-MSCs and BM-MSCs. Noisy currents were completely inhibited by paxilline (1 ␮M) in a representative iPSC-MSC (A) or BM-MSC (C). Currents were elicited by the protocol shown in the inset. Current-voltage (I-V) relationship of paxillinesensitive currents was obtained by subtracting the currents before and after paxilline treatment accordingly in iPSC-MSCs (n ⫽ 10) (B) and BM-MSCs (n ⫽ 12) (D).

BM-MSCs (Fig. 6C). The I-V relationship of IKir, with or without 0.5 mM BaCl2, elicited via a 1.2-s ramp protocol, was recorded in a representative iPSC-MSC (Fig. 6B) or BM-MSC (Fig. 6D). Similar results were observed in 6 human iPSCMSCs and 10 human BM-MSCs. Chloride current in human iPSC-MSCs. The chloride channel blocker 4,4=-diisothiocyanatostilbene-2,2=-disulfonic acid (DIDS) was used to determine whether the current shown in Fig. 2D was carried by Cl⫺ ions. Figure 7A illustrates that DIDS (150 ␮M) reversibly inhibited this current in a representative iPSC-MSC. Similar results were obtained in five cells. The I-V relationship curve of the DIDS-sensitive current was obtained by subtracting currents recorded after DIDS administration from the control currents accordingly (Fig. 7B). The DIDS-sensitive current had a reversal potential of approximately ⫺25 mV. hEAG1 potassium channel regulated the proliferation of human iPSC-MSCs and BM-MSCs. The doubling time of human iPSC-MSCs and BM-MSCs was estimated via MTT assay in which cells were allowed to seed for 1, 3, and 5 days. The doubling times were calculated to be 2.66 and 3.72 days for iPSC-MSCs and BM-MSCs, respectively. Various ionic currents in human iPSC-MSCs and BM-MSCs were identified by the specific ion channel blockers (i.e.,

paxilline, CLT, 4-AP, astemizole, Ba2⫹, and DIDS) (Figs. 3–7). Thereafter, effects of the corresponding ion channels on the proliferation of human iPSC-MSCs and BM-MSCs were assessed via MTT and BrdU assay. As shown in Fig. 8, A and B, while paxilline (1 ␮M), CLT (1 ␮M), and Ba2⫹ (0.5 mM) had no significant effect on the proliferation of either human iPSC-MSCs or BM-MSCs, 4-AP (5 mM) (P ⬍ 0.001) significantly inhibited the proliferation of both human iPSC-MSCs and BM-MSCs. DIDS (150 ␮M) inhibited the proliferation of both human iPSC-MSCs and BM-MSCs when estimated with MTT assay (P ⬍ 0.05), whereas DIDS affected BM-MSCs only when tested via BrdU assay (P ⬍0.001). Noting that 4-AP is a nonselective inhibitor of voltage-gated K⫹ (Kv) channels (39) and the expression of several Kv channel genes, Kv1.2, Kv1.5, Kv1.6, and Kv2.1, in human iPSC-MSCs and BM-MSCs was much less than that of KCNH1 (Fig. 1), we thus hypothesized that it was through the hEAG1 channel that 4-AP inhibited the proliferation of human iPSC-MSCs and BM-MSCs. Thereafter, KCNH1 shRNA and a more specific hEAG1 potassium channel blocker, astemizole, were applied to assess the involvement of the hEAG1 channel in the proliferation of human iPSC-MSCs and BM-MSCs. Results showed that not only astemizole greatly inhibited the


C120


Fig. 4. IKDR in human iPSC-MSCs and BM-MSCs. Paxilline-resistant currents were suppressed either by 5 mM 4-aminopyridine (4-AP) in a representative iPSCMSC (A) or BM-MSC (E) or by 1 ␮M astemizole in two iPSC-MSCs (C and D) or BM-MSCs (G). Currents were elicited by the protocol shown in the inset. I-V relationship of 4-AP-sensitive currents was obtained by subtracting the currents before and after 4-AP treatment accordingly in iPSC-MSCs (n ⫽ 9) (B) and BM-MSCs (n ⫽ 4) (F).



C121

Fig. 5. IKCa in human iPSC-MSCs and BM-MSCs. A: voltage-dependent currents in iPSC-MSCs were not affected by paxilline (1 ␮M) but were completely inhibited by clotrimazole (1 ␮M). C: currents in BMMSCs were partially inhibited by paxilline (1 ␮M) and completely abolished by clotrimazole (1 ␮M). Currents were elicited by the protocol shown in the inset. B and D: I-V relationship of clotrimazole-sensitive currents was obtained by subtracting the currents before and after clotrimazole treatment accordingly in iPSC-MSCs (n ⫽ 12) (B) and BM-MSCs (n ⫽ 5) (D).

proliferation of both iPSC-MSCs and BM-MSCs in a dosedependent manner (Fig. 8, C and E), KCNH1 shRNA also significantly inhibited the proliferation of both cell lines (Fig. 8E, P ⬍ 0.05) when compared with their respective scramble shRNA-transduced counterparts, which is echoed by the reduced mRNA expression level of KCNH1 under shRNA treatment (Fig. 8D). We therefore concluded that the hEAG1 channel plays an important role in the proliferation of human iPSC-MSCs, and, to a lesser extent, BM-MSCs. DISCUSSION

Therapeutic application of BM-MSCs for tissue regeneration is hampered by several factors, including their limited capacity to proliferate, loss of differentiation potential, and reduced expression of protective factors during ex vivo expansion. Our recent studies (25) have shown that use of human iPSC-MSCs may overcome these limitations and be superior to BM-MSCs for tissue regeneration in ischemic tissue. The mechanisms for the superior therapeutic potential of human iPSC-MSCs nonetheless remain unclear. The results of this study demonstrate differential functional ionic channel profiles between MSCs derived from human BM and iPSCs. In particular, the higher level of expression of KCNH1 in iPSC-MSCs may explain their greater in vitro proliferative capacity than BM-MSCs. In this study, the reverse transcription-PCR results showed similar and distinct mRNA expression of ion channel genes in

human iPSC-MSCs and BM-MSCs. In human iPSC-MSCs, KCa1.1 (responsible for BKCa), KCa3.1 (for IKCa), KCNH1 (for IKDR), Clcn3 (for ICl), Kir2.1, Kir2.2, and Kir2.3 (for IKir), SCN9A (for INa.TTX) and CACNA1C (for ICa.L) were expressed, whereas KCa1.1, KCa3.1, KCNH1, Clcn3, Kir2.1, SCN9A, and CACNA1C were expressed in human BM-MSCs. Besides reverse transcription-PCR results, our data on real-time PCR confirmed that the expression level of KCNH1 mRNA in iPSC-MSCs was much higher than those in BM-MSCs. The functional expression of these ion channel genes was then identified by standard whole cell patch-clamp technique. While five types of currents (BKCa, IKDR, IKir, IKCa, and ICl) were found in human iPSC-MSCs (83%, 47%, 11%, 5%, and 4%, respectively), only four (BKCa, IKDR, IKir, and IKCa) were present in human BM-MSCs (76%, 25%, 22%, and 11%, respectively). The diversity of expression of these ion channels in MSCs might reflect the existence of different subtypes of cells. As compared with immortalized cell lines, it is so far impossible to separate a pure population of MSCs. Indeed, the characterization of human MSCs is mainly based on their plastic-adherence in standard culture conditions; expression of the surface molecules CD73, CD90, and C105 in the absence of CD11b, CD14, CD19, CD34, CD45, CD79␣, and HLA-DR; and capability of differentiating into osteoblasts, adipocytes, and chondroblasts in vitro (8, 25). In this study, iPSC-MSCs were derived from a single cell clone (25). However, different


C122


Fig. 6. IKir in human iPSC-MSCs and BMMSCs. Voltage-dependent currents, elicited with protocol shown in the inset, were reversibly inhibited by BaCl2 (0.5 mM) in a representative iPSC-MSC (A) or BM-MSC (C), or with a 1.2-s ramp protocol (⫺120 to 0 mV from a holding potential of ⫺40 mV) in another representative iPSC-MSC (B) or BM-MSC (D).

subtypes or subpopulations of MSCs will develop during culturing passaging of the MSCs. Similarly, different subtypes of MSCs may also develop in the culturing of BM-derived MSCs. In addition, the expression and activity of these ion channels might be correlated with the cell cycle of these

proliferating MSCs, as ion channels are found to have different expression levels and activity during the cell cycle (6, 31). On the other hand, regulation of cell proliferation through ion channels was widely investigated (14, 22, 37, 38). Here, the involvement of these ion channels in the proliferation of human

Fig. 7. ICl in human iPSC-MSCs. A: voltage-dependent current was reversibly inhibited by the Cl⫺ channel blocker DIDS (150 ␮M). Current was elicited by the protocol shown in the inset. B: I-V relationship of DIDS-sensitive current was obtained by subtracting the currents recorded before and after DIDS application (n ⫽ 5).



C123

Fig. 8. Effects of ion channel blockage on the proliferation of human iPSC-MSCs and BM-MSCs. A and B: treatment with paxilline, clotrimazole (CLT), 4-AP, Ba2⫹, or DIDS for 72 h. BrdU, bromodeoxyuridine. C and E: treatment with astemizole (Ast) (C and E) or transduction with KCNH1 short hairpin (sh)RNA (E). Cell proliferation was estimated via MTT (A and C) or BrdU (B and E) assay. D: RT-PCR results showing expression of KCa1.1, KCNH1, and GAPDH in nontreated (⫺), control shRNA-transduced (control), and KCNH1 shRNA-transduced (heag1) iPSC-MSCs or BM-MSCs. *P ⬍ 0.05, ***P ⬍ 0.001 vs. control or control shRNA group.

iPSC-MSCs and BM-MSCs was studied using different ion channel blockers via MTT and BrdU assay. Previous studies have shown that the hEAG1 channel mainly expresses in the central nervous system and contributes to neuronal signaling (30, 32, 39). Increased and abnormal expression of the hEAG1 channel is also frequently observed in different cancer cells and regulates cellular proliferation, namely, activating the hEAG1 channel increases cell proliferation (10), while blocking the hEAG1 channel inhibits cell proliferation (1, 33). Li et al. (23) and Park et al. (29) reported that expression of the hEAG1 channel in human MSCs derived from both bone marrow and umbilical cord vein, respectively. The functional role of hEAG1 in human MSCs nevertheless remains unclear. In the present study, we recorded functional IKDR in both human iPSC-MSCs (47%) and BM-MSCs (25%). In this study, the average RMPs of ⫺25 mV and ⫺37.8 mV

recorded in human iPSC-MSCs and BM-MSCs, respectively, are consistent with the usual voltage range of between ⫺50 mV and ⫹60 mV for opening of the hEAG1 channels as reported in previous studies (26). With MTT and BrdU assay, the involvement of IKDR in their proliferation was further investigated by KCNH1 shRNA and the hEAG1 channel blockers. Compared with control shRNA, KCNH1 shRNA lentivirus transduction decreased the proliferation rate of both human iPSC-MSCs and BM-MSCs. Treatment with 4-AP and astemizole also significantly reduced the proliferation rate of human iPSC-MSCs. These treatments also decreased the rate of proliferation of human BM-MSCs though to a lesser extent. These findings demonstrate that the hEAG1 channel plays a crucial role in controlling the proliferation of human iPSC-MSCs and to a lesser extent BM-MSCs. Although the mechanisms remain unclear, hEAG1 channels regulating the proliferation of MSCs


C124


should at least mediate via ion flow, since both KCNH1 shRNA and hEAG1 channel blockers (i.e., 4-AP and astemizole) inhibited the proliferation of MSCs. However, the potential impact of conformational change of the hEAG1 channel on the control of cell proliferation requires further study. The higher expression level of the hEAG1 channel in human iPSC-MSCs may account for their better proliferation rate (i.e., shorter doubling time) than BM-MSCs. Conversely though, the increased expression level of the hEAG1 channel in human iPSC-MSCs and thus a high rate of cell proliferation may potentially increase the risk of tumorigenicity with iPSC-MSCs as in different cancer cells. Our previous study (25) showed that transplantation of iPSC-MSCs in immunodeficient mice did not induce any tumor formation after 4 mo of observation. Although the reason remains unclear, it is possible that aberrant or a much higher level of hEAG1 expression is required for tumorigenicity in cancer cells. Although the hEAG1 channel appears to play a crucial role in the cell proliferation of human BM-MSCs and iPSC-MSCs, further study is needed to determine whether the hEAG1 channel also contributes to the cell proliferation in other stem cells. In addition, whether increased expression of the hEAG1 channel in other pluripotent stem cells can contribute to tumor formation due to marked increase of cell proliferation rate merits further investigation. In this study, the potential functional roles of other ion channels on cell proliferation were also investigated. Previous studies have recorded functional BKCa channels in MSCs derived from BM of rabbit (7), rat (24), and human (12, 18, 23), as well as in those derived from human umbilical cord vein (29). These studies also confirmed the molecular identity of BKCa as the KCa1.1 gene of their species. We demonstrated that most human iPSC-MSCs and BM-MSCs (83% and 76%, separately) exhibit BKCa currents and express KCa1.1 mRNA. BKCa has also been shown to be required for stimulating the proliferation of human endothelial cells (21) and human breast cancer cells (5). We showed that blockade of BKCa with the specific blocker paxilline (1 ␮M) nonetheless had no significant effects on the proliferation of either human iPSC-MSCs or BM-MSCs. Consistent with previous findings in mouse BM-MSCs (34), we observed mRNA expression of the ion channel gene KCa3.1 and the presence of functional IKCa channel expression in human iPSC-MSCs and BM-MSCs. IKCa has also been reported to regulate the proliferation of mouse BM-MSCs (35), as well as several types of human cells, including T lymphocytes (15), pancreatic cancer cells (13), breast cancer cells (28), and endothelial cells (11). However, treatment with the IKCa blocker CLT (1 ␮M) did not inhibit the proliferation of either human iPSC-MSCs or BM-MSCs in this study. This might be due to the relative low expression level of functional IKCa channels in iPSC-MSCs (5%) and BM-MSCs (11%), or because IKCa itself is not involved in the proliferation of these cell types. IKir currents were expressed in rabbit and mouse BM-MSCs (7, 34) and human umbilical cord vein-derived MSCs (29) with the mRNA expression of Kir2.1. Similarly, we demonstrated the presence of functional IKir channel in both human iPSCMSCs and BM-MSCs. The IKir channels expressed in iPSCMSCs were probably encoded by Kir2.1, Kir2.2, and Kir2.3, whereas those in BM-MSCs were solely encoded by Kir2.1. Previous studies have demonstrated the regulation of prolifer-

ation by Kir2.1-encoded IKir channel in rat ventricular fibroblasts and myofibroblasts (4) and human smooth muscle cells (17). However, in this study, Ba2⫹ treatment (IKir blockage) did not significantly affect the proliferation of iPSC-MSCs or BM-MSCs. Like IKCa, the reason that IKir is unrelated to the proliferation of iPSC-MSCs and BM-MSCs is unclear. Clcn3-encoded ICl had been reported to play a role in the proliferation of mouse BM-MSCs (34, 35), rat aortic smooth muscle cells (36), and NIH3T3 cells (40). In our present study, although Clcn3 mRNA was expressed in both human iPSCMSCs and BM-MSCs, functional chloride channel was only recorded in human iPSC-MSCs (5%) not BM-MSCs. In this study, DIDS treatment completely blocked all the current in iPSC-MSCs that expressed ICl, suggesting that this subgroup of iPSC-MSCs might only express ICl. On the other hand, it is quite surprising that inhibition of the chloride channels with DIDS treatment suppressed the proliferation of BM-MSCs as estimated by both MTT and BrdU assay, and a significant suppression in iPSC-MSCs was recorded via MTT assay. Such observation might be attributed to the side effects of DIDS at a high concentration (150 ␮M) as it has been previously reported to cause reduction of nitric oxide release in microglial cells at cytotoxic concentrations (20). In conclusion, the results of this study extend our previous findings (25) and demonstrate that multiple functional ion channels are expressed in BM-MSCs and iPSC-MSCs. More importantly, some of them were involved in regulation of cell proliferation. Interestingly, the differential expression profile of these ion channels in BM-MSCs and iPSC-MSCs was associated with their different functional role in cell proliferation of human MSCs. Among these different ion channels, the results of this study reveal that increased expression of functional hEAG1 channels in iPSC-MSCs was responsible for their higher cell proliferative rate than BM-MSCs. Whether the hEAG1 channel also plays a crucial role in the cell proliferation of other stem cells requires further examination. GRANTS This research was supported by the University of Hong Kong (HKU) Strategic Research Theme on Healthy Ageing (to Q. Lian and H.-F. Tse), Collaborative Research Fund of Hong Kong Research Grant Council (HKU 8/CRF/09 to C.-W. Siu, Q. Lian, and H.-F. Tse), HKU Outstanding Researcher Award (to H.-F. Tse), and Mr. Philip Wong Foundation Fund for Cardiac Stem Cell Research (to H.-F. Tse). DISCLOSURES No conflicts of interest, financial or otherwise, are declared by the author(s). AUTHOR CONTRIBUTIONS J.Z. and Y.-C.C. performed the experiments; J.Z. analyzed the data; J.Z., Y.-C.C., J.C.-Y.H., and C.-W.S. interpreted the results of the experiments; J.Z. prepared the figures; J.Z. drafted the manuscript; Y.-C.C. and H.-F.T. edited and revised the manuscript; J.C.-Y.H., C.-W.S., and Q.L. conception and design of the research; H.-F.T. approved the final version of the manuscript. REFERENCES 1. Agarwal JR, Griesinger F, Stuhmer W, Pardo LA. The potassium channel ether a` go-go is a novel prognostic factor with functional relevance in acute myeloid leukemia. Mol Cancer 9: 18, 2010. 2. Chan YC, Siu CW, Lau YM, Lau CP, Li RA, Tse HF. Synergistic effects of inward rectifier (IK1) and pacemaker (If) currents on the induction of bioengineered cardiac automaticity. J Cardiovasc Electrophysiol 20: 1048 –1054, 2009.


hEAG1 POTASSIUM CHANNEL REGULATES iPSC-MSC PROLIFERATION 3. Chan YC, Wang K, Au KW, Lau CP, Tse HF, Li RA. Probing the bradycardic drug binding receptor of hcn-encoded pacemaker channels. Pflügers Arch 459: 25–38, 2009. 4. Chilton L, Ohya S, Freed D, George E, Drobic V, Shibukawa Y, Maccannell KA, Imaizumi Y, Clark RB, Dixon IM, Giles WR. K⫹ currents regulate the resting membrane potential, proliferation, and contractile responses in ventricular fibroblasts and myofibroblasts. Am J Physiol Heart Circ Physiol 288: H2931–H2939, 2005. 5. Coiret G, Borowiec AS, Mariot P, Ouadid-Ahidouch H, Matifat F. The antiestrogen tamoxifen activates BK channels and stimulates proliferation of MCF-7 breast cancer cells. Mol Pharmacol 71: 843–851, 2007. 6. Day ML, Pickering SJ, Johnson MH, Cook DI. Cell-cycle control of a large-conductance K⫹ channel in mouse early embryos. Nature 365: 560 –562, 1993. 7. Deng XL, Sun HY, Lau CP, Li GR. Properties of ion channels in rabbit mesenchymal stem cells from bone marrow. Biochem Biophys Res Commun 348: 301–309, 2006. 8. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans R, Keating A, Prockop D, Horwitz E. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 8: 315–317, 2006. 8a.Firth AL, Yuan JX. “Ether-a`-go-go” proliferation of iPSC-derived mesenchymal stem cells. Focus on “Regulation of cell proliferation of human induced pluripotent stem cell-derived mesenchymal stem cells via ether-a`-go-go 1 (hEAG1) potassium channel.” Am J Physiol Cell Physiol (May 9, 2012). doi:10.1152/ajpcell.00160.2012. 9. Garcia-Ferreiro RE, Kerschensteiner D, Major F, Monje F, Stuhmer W, Pardo LA. Mechanism of block of hEag1 K⫹ channels by imipramine and astemizole. J Gen Physiol 124: 301–317, 2004. 10. Gavrilova-Ruch O, Schonherr R, Heinemann SH. Activation of hEAG1 potassium channels by arachidonic acid. Pflügers Arch 453: 891–903, 2007. 11. Grgic I, Eichler I, Heinau P, Si H, Brakemeier S, Hoyer J, Kohler R. Selective blockade of the intermediate-conductance Ca2⫹-activated K⫹ channel suppresses proliferation of microvascular and macrovascular endothelial cells and angiogenesis in vivo. Arterioscler Thromb Vasc Biol 25: 704 –709, 2005. 12. Heubach JF, Graf EM, Leutheuser J, Bock M, Balana B, Zahanich I, Christ T, Boxberger S, Wettwer E, Ravens U. Electrophysiological properties of human mesenchymal stem cells. J Physiol 554: 659 –672, 2004. 13. Jager H, Dreker T, Buck A, Giehl K, Gress T, Grissmer S. Blockage of intermediate-conductance Ca2⫹-activated K⫹ channels inhibit human pancreatic cancer cell growth in vitro. Mol Pharmacol 65: 630 –638, 2004. 14. Jehle J, Schweizer PA, Katus HA, Thomas D. Novel roles for hERG K⫹ channels in cell proliferation and apoptosis. Cell Death Dis 2: e193, 2011. 15. Jensen BS, Odum N, Jorgensen NK, Christophersen P, Olesen SP. Inhibition of T cell proliferation by selective block of Ca2⫹-activated K⫹ channels. Proc Natl Acad Sci USA 96: 10917–10921, 1999. 16. Jiang P, Rushing SN, Kong CW, Fu J, Lieu DK, Chan CW, Deng W, Li RA. Electrophysiological properties of human induced pluripotent stem cells. Am J Physiol Cell Physiol 298: C486 –C495, 2010. 17. Karkanis T, Li S, Pickering JG, Sims SM. Plasticity of Kir channels in human smooth muscle cells from internal thoracic artery. Am J Physiol Heart Circ Physiol 284: H2325–H2334, 2003. 18. Kawano S, Otsu K, Shoji S, Yamagata K, Hiraoka M. Ca2⫹ oscillations regulated by Na⫹-Ca2⫹ exchanger and plasma membrane Ca2⫹ pump induce fluctuations of membrane currents and potentials in human mesenchymal stem cells. Cell Calcium 34: 145–156, 2003. 19. Kim SW, Han H, Chae GT, Lee SH, Bo S, Yoon JH, Lee YS, Lee KS, Park HK, Kang KS. Successful stem cell therapy using umbilical cord blood-derived multipotent stem cells for Buerger’s disease and ischemic limb disease animal model. Stem Cells 24: 1620 –1626, 2006. 20. Kjaer K, Strobaek D, Christophersen P, Ronn LC. Chloride channel blockers inhibit iNOS expression and no production in IFNgammastimulated microglial BV2 cells. Brain Res 1281: 15–24, 2009.

C125

21. Kuhlmann CR, Most AK, Li F, Munz BM, Schaefer CA, Walther S, Raedle-Hurst T, Waldecker B, Piper HM, Tillmanns H, Wiecha J. Endothelin-1-induced proliferation of human endothelial cells depends on activation of K⫹ channels and Ca⫹ influx. Acta Physiol Scand 183: 161–169, 2005. 22. Lang F, Foller M, Lang KS, Lang PA, Ritter M, Gulbins E, Vereninov A, Huber SM. Ion channels in cell proliferation and apoptotic cell death. J Membr Biol 205: 147–157, 2005. 23. Li GR, Sun H, Deng X, Lau CP. Characterization of ionic currents in human mesenchymal stem cells from bone marrow. Stem Cells 23: 371–382, 2005. 24. Li GR, Deng XL, Sun H, Chung SS, Tse HF, Lau CP. Ion channels in mesenchymal stem cells from rat bone marrow. Stem Cells 24: 1519 – 1528, 2006. 25. Lian Q, Zhang Y, Zhang J, Zhang HK, Wu X, Lam FF, Kang S, Xia JC, Lai WH, Au KW, Chow YY, Siu CW, Lee CN, Tse HF. Functional mesenchymal stem cells derived from human induced pluripotent stem cells attenuate limb ischemia in mice. Circulation 121: 1113–1123, 2010. 25a.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402–408, 2001. 26. Lorinczi E, Napp J, Contreras-Jurado C, Pardo LA, Stuhmer W. The voltage dependence of hEag currents is not determined solely by membrane-spanning domains. Eur Biophys J 38: 279 –284, 2009. 27. Minguell JJ, Erices A. Mesenchymal stem cells and the treatment of cardiac disease. Exp Biol Med (Maywood) 231: 39 –49, 2006. 28. Ouadid-Ahidouch H, Roudbaraki M, Delcourt P, Ahidouch A, Joury N, Prevarskaya N. Functional and molecular identification of intermediate-conductance Ca2⫹-activated K⫹ channels in breast cancer cells: association with cell cycle progression. Am J Physiol Cell Physiol 287: C125–C134, 2004. 29. Park KS, Jung KH, Kim SH, Kim KS, Choi MR, Kim Y, Chai YG. Functional expression of ion channels in mesenchymal stem cells derived from umbilical cord vein. Stem Cells 25: 2044 –2052, 2007. 30. Pillozzi S, Arcangeli A. Physical and functional interaction between integrins and herg1 channels in cancer cells. Adv Exp Med Biol 674: 55–67, 2010. 31. Rodriguez-Gomez JA, Levitsky KL, Lopez-Barneo J. T-type Ca2⫹ channels in mouse embryonic stem cells: modulation during cell cycle and contribution to self-renewal. Am J Physiol Cell Physiol 302: C494 –C504, 2012. 32. Sahoo N, Troger J, Heinemann SH, Schonherr R. Current inhibition of human EAG1 potassium channels by the Ca2⫹ binding protein s100b. FEBS Lett 584: 3896 –3900, 2010. 33. Spitzner M, Ousingsawat J, Scheidt K, Kunzelmann K, Schreiber R. Voltage-gated K⫹ channels support proliferation of colonic carcinoma cells. FASEB J 21: 35–44, 2007. 34. Tao R, Lau CP, Tse HF, Li GR. Functional ion channels in mouse bone marrow mesenchymal stem cells. Am J Physiol Cell Physiol 293: C1561– C1567, 2007. 35. Tao R, Lau CP, Tse HF, Li GR. Regulation of cell proliferation by intermediate-conductance Ca2⫹-activated potassium and volume-sensitive chloride channels in mouse mesenchymal stem cells. Am J Physiol Cell Physiol 295: C1409 –C1416, 2008. 36. Wang GL, Wang XR, Lin MJ, He H, Lan XJ, Guan YY. Deficiency in ClC-3 chloride channels prevents rat aortic smooth muscle cell proliferation. Circ Res 91: E28 –E32, 2002. 37. Wang S, Melkoumian Z, Woodfork KA, Cather C, Davidson AG, Wonderlin WF, Strobl JS. Evidence for an early G1 ionic event necessary for cell cycle progression and survival in the MCF-7 human breast carcinoma cell line. J Cell Physiol 176: 456 –464, 1998. 38. Wonderlin WF, Strobl JS. Potassium channels, proliferation and G1 progression. J Membr Biol 154: 91–107, 1996. 39. Wulff H, Castle NA, Pardo LA. Voltage-gated potassium channels as therapeutic targets. Nat Rev Drug Discov 8: 982–1001, 2009. 40. Zheng YJ, Furukawa T, Tajimi K, Inagaki N. Cl⫺ channel blockers inhibit transition of quiescent (G0) fibroblasts into the cell cycle. J Cell Physiol 194: 376 –383, 2003.
