Reproductive Regulation of Gene Expression in ... - Wiley Online Library

Journal of Neuroendocrinology, 2016, 28, 10.1111/jne.12350 © 2015 British Society for Neuroendocrinology

ORIGINAL ARTICLE

Reproductive Regulation of Gene Expression in the Hypothalamic Supraoptic and Paraventricular Nuclei R. A. Augustine*, G. T. Bouwer*, A. J. Seymour*, D. R. Grattan† and C. H. Brown* *Centre for Neuroendocrinology and Department of Physiology, University of Otago, Dunedin, New Zealand. †Centre for Neuroendocrinology and Department of Anatomy, University of Otago, Dunedin, New Zealand.

Journal of Neuroendocrinology

Correspondence to: C. H. Brown, Department of Physiology, Otago School of Medical Sciences, University of Otago, PO Box 56, Dunedin 9054, New Zealand (e-mail: colin.brown@ otago.ac.nz).

Oxytocin secretion is required for successful reproduction. Oxytocin is synthesised by magnocellular neurones of the hypothalamic supraoptic and paraventricular nuclei and the physiological demand for oxytocin synthesis and secretion is increased for birth and lactation. Therefore, we used a polymerase chain reaction (PCR) array screen to determine whether genes that might be important for synthesis and/or secretion of oxytocin are up- or down-regulated in the supraoptic and paraventricular nuclei of late-pregnant and lactating rats, compared to virgin rats. We then validated the genes that were most highly regulated using real time-quantitative PCR. Among the most highly regulated genes were those that encode for suppressors of cytokine signalling, which are intracellular inhibitors of prolactin signalling. Prolactin receptor activation changes gene expression via phosphorylation of signal transducer and activator of transcription 5 (STAT5). Using double-label immunohistochemistry, we found that phosphorylated STAT5 was expressed in almost all oxytocin neurones of late-pregnant and lactating rats but was almost absent from oxytocin neurones of virgin rats. We conclude that increased prolactin activation of oxytocin neurones might contribute to the changes in gene expression by oxytocin neurones required for normal birth and lactation. Key words: oxytocin, vasopressin, pregnancy, lactation, prolactin

Secretion of oxytocin from the posterior pituitary gland is required for successful reproduction, underpinning normal parturition and lactation (1). Although oxytocin knockout mice give birth (2), oxytocin secretion is nevertheless important for the timing of delivery (3) because oxytocin receptor antagonists delay the onset of delivery when administered prior to labour and increase the interval between the delivery of pups when administered after the start of parturition (4). Although oxytocin might not be essential for parturition, it is essential for lactation; oxytocin knockout mice do not deliver milk to their suckling young, despite normal milk production and mammary gland development (2). Birth and lactation are times of very high demand for oxytocin secretion (1). In preparation for the high secretory demands of birth and lactation, the pituitary stores of oxytocin increase during pregnancy by a combination of increased synthesis by magnocellular neurones of the hypothalamic supraoptic and paraventricular nuclei (5,6) and restraint of secretion at the posterior pituitary gland (7). In late pregnancy and lactation, restraint of secretion is relaxed, whereas elevated synthesis is sustained to maintain the secretory stores in the face of increased demand. Although increased expression of the oxytocin gene in late pregnancy and lactation is well-established (5,6), we hypothesised that

doi: 10.1111/jne.12350

the expression of other genes modulating oxytocin gene expression and oxytocin neurone excitability would be altered in late pregnancy and lactation to promote the synthesis and secretion of oxytocin. To test this hypothesis, we completed a polymerase chain reaction (PCR) array screen on the supraoptic and paraventricular nuclei of virgin, late-pregnant and lactating rats, followed by quantitative real timePCR (qRT-PCR) validation of selected genes. Amongst others, a cluster of genes that modulate prolactin signalling was differentially regulated by reproductive status. Prolactin is required for successful pregnancy and lactation (8,9) and our findings suggest that one of the functions of prolactin might be the modulatation of gene expression in oxytocin neurones to support increased synthesis and secretion of oxytocin for birth and lactation.

Materials and methods Animals Female Sprague–Dawley rats (10 weeks old) were obtained from the University of Otago Animal Facility and housed under a 12 : 12 h light/dark cycle at 22 1 °C. Rats were fed standard rat chow and

2 of 12

R. A. Augustine et al.

water ad lib. All experimental procedures were approved by the University of Otago Animal Ethics Committee and were carried out in accordance with the New Zealand Animal Welfare Act (1999) and associated guidelines. The oestrous cycle was monitored daily using vaginal cytology to examine the appearance of the epithelial cells. On pro-oestrus, females were placed overnight in a cage with a male and, the next morning, the presence of sperm indicated that mating had occurred (day 0 of pregnancy). Rats assigned to the lactating group gave birth on days 21 or 22 of pregnancy and pup numbers were adjusted to 10 pups per dam on day 2 of lactation. Virgin rats were used on di-oestrus, late-pregnant rats on day 21 of pregnancy and lactating rats on day 7 of lactation, and independent groups of rats were used for each of the experiments.

PCR arrays Tissue preparation and RNA isolation Virgin (n = 4), late-pregnant (n = 3) and lactating (n = 4) rats were killed by decapitation when conscious. The brains were rapidly removed, frozen on dry ice and stored at 80 °C until sectioning. Coronal slices were cut through the hypothalamus at a thickness of 300 lm on a cryostat and thaw-mounted onto slides. The supraoptic and paraventricular nuclei were dissected using a blunt-ended needle (21-gauge) and the isolated tissue was placed into lysis buffer (Buffer RLT; Qiagen, Valencia, CA, USA), with each individual sample being bilateral nuclei from a single rat. Samples were sonicated for 3 min and stored at 80 °C. Total RNA isolation was carried out using a Qiagen RNeasy Mini Kit. Once samples were thawed, 75 ll of 70% ethanol was added to the homogenised sample, mixed well by pipetting and then the whole mixture was transferred to an RNeasy MinElute Spin Column in a 2-ml collection tube. Samples were isolated manually in accordance with the manufacturer’s instructions. An on-column DNAse treatment (RNase-Free DNase Set; Qiagen) was carried out for 15 min. The resulting 20 ll of total RNA was frozen at 80 °C until further processing.

including genes involved in intracellular signalling pathways, as well as ion channels and transporters. Five reference genes were also included: ribosomal protein, large, P1 (Rplp1), hypoxanthine phosphoribosyltransferase 1 (Hprt1), ribosomal protein L13A (Rpl13A), lactate dehydrogenase A, (Ldha) and b-actin (Actb). The expression of the reference genes was not significantly different between virgin, late-pregnant and lactating rats. A mix was made from the reagents: 2 9 RT2 qPCR master mix (1350 ll), the dilute firststrand cDNA synthesis reaction (102 ll) and water (1248 ll). Next, 25 ll of this mix was added to each well on the 96-well plate. The plate was covered with optical adhesive film and centrifuged to remove bubbles from the wells. PCR plates were run on a Roche LightCycler 480 (Roche, Basel, Switzerland) using the cycling parameters: 95 °C for 10 min, and 45 cycles at 95 °C for 15 s and 60 °C for 1 min. The point where the amount of product exceeded the detection limit was defined as the crossing point (Cq), and these points were analysed using the online RT2 Profiler PCR array data analysis software, version 3.4 (http://pcrdataanalysis.sabios ciences.com/pcr/arrayanalysis.php). The online software calculated fold-changes of gene expression in the late-pregnant and lactating groups compared to the virgin group.

Quantitative real time-PCR (qRT-PCR) Specific genes of interest and those novel genes that showed the highest change in expression in the PCR arrays were selected for validation using qRT-PCR. Virgin (n = 7–8), late-pregnant (n = 7) and lactating (n = 5–6) rats were killed by decapitation when conscious. Brains were rapidly removed and frozen on dry ice and stored at 80 °C until sectioning. Supraoptic and paraventricular nuclei Table 1. Oligonucleotide Sequences for Quantitative Real-Time Polymerase Chain Reaction Primers. Gene symbol AVP b-actin

Reverse transcription The quality and quantity of total RNA was measured on a Bioanalyzer 2100 (Agilent Technologies Inc., Waldbronn, Germany). A RNA 6000 Pico Kit was used and 11 total RNA samples (1 ll each) were run on each Pico-chip. Only samples with sufficient quantity (> 5 ng/ll) and high RNA integrity numbers (> 7; most were > 8.5) were used for subsequent steps in the PCR array analysis. Then, 40 ng of supraoptic and paraventricular nuclei total RNA was reverse transcribed into cDNA using a RT2 First Strand Kit (Qiagen) in accordance with the manufacturer’s instructions. RNase-free water (91 ll) was added to each 20 ll cDNA reaction and stored at 20 °C.

CISH Fos Junb Oxt PDyn SOCS1 SOCS3

PCR arrays STAT5b

SABiosciences Custom arrays (96-well, 96 genes, one sample per plate) (Qiagen) were designed to contain 84 genes of interest, © 2015 British Society for Neuroendocrinology

Primers

Oligonucleotide sequence (50 - to 30 )

Nucleotide number (Accession number)

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

CAGCGATGAGAGCTGCGTGGC GGGGCTTGGCAGAATCCACGG AGATGACCCAGATCATGTTTGAGA ACCAGAGGCATACAGGGACAA GACCTTCGCACCCCTGGCAC GCAAAGGACAAGATCCCTGTACGCA AGCATCGGCAGAAGGGGCAA TCTGTCTCCGCTTGGAGCGT CACAGCCGAGGACAGCTCGC AGACTGCCAGGGCTCCGACC GCATCTGCTGTAGCCCGGATGG ATGGGGAATGAAGGAAGCGCC GCGTGGTCCAGGCTGATGCTG CCAGGGAGCAAATCAGGGGGTTG ACTTCCGCACCTTCCGCTCC GAAGCAGTTCCGCTGGCGACT CAGCTCCAAGAGCGAGTACCA CGGTTACGGCACTCCAGTAGA GCTCTGGTGGGGCAGAACGA ATTGAGTCCCAGGCTTGACTTTCG

NM_016992.2 NM_031144.3 NM_031804.1 NM_022197.2 NM_021836.2 NM_012996.3 NM_018863.4 NM_145879 NM_053565.1 NM_022380.1

Journal of Neuroendocrinology, 2016, 28, 10.1111/jne.12350

SON and PVN gene expression in reproduction

Table 2. RT2 Profiler Polymerase Chain reaction Array Data for the Supraoptic Nucleus.

Table 2 (continued)

Pregnant Pregnant

Lactation

SON symbol

Refseq #

Fold regulation

P-value

Fold regulation

P-value

0.001*** 0.125 0.002** 0.203 0.085 0.122 0.109 0.174 0.047* 0.218 0.332 0.156 0.125 0.243 0.204 0.767 0.196 0.194 0.116 0.863 0.823 0.527 0.237 0.213 0.112 0.146 0.117 0.136 0.213 0.342 0.527 0.526 0.569 0.609 0.407 0.303 0.615 0.823 0.827 0.711 0.735 0.923 0.821 0.688 0.934 0.982 0.812 0.89 0.73 0.845

1.4748 1.596 1.0073 1.6638 1.5605 1.0996 1.1294 1.0567 1.2816 1.3561 1.7435 1.3751 1.0021 1.1835 1.1169 1.3291 1.1404 1.0901 1.11 1.5779 1.6853 1.4345 1.0958 1.2874 1.6667 1.0331 1.053 1.113 1.1929 1.113 1.0759 1.2785 1.3571 1.064 1.2075 1.0091 1.539 1.2697 1.064 1.089 1.1073 1.1471 1.1254 1.7617 1.0295 1.1325 1.0014 1.2706 1.2986 1.1023

0.09 0.361 0.885 0.985 0.153 0.869 0.773 0.665 0.424 0.279 0.201 0.44 0.821 0.445 0.461 0.847 0.515 0.646 0.465 0.585 0.372 0.387 0.499 0.498 0.043* 0.811 0.58 0.494 0.257 0.405 0.744 0.535 0.231 0.612 0.646 0.931 0.035* 0.274 0.684 0.745 0.427 0.536 0.379 0.161 0.749 0.51 0.9 0.435 0.268 0.48

Mapk1 Crebbp Nfkb1 Akt1 Mapk3 Stat3 Stat2 Pdyn Slc12a4 Slc12a2 Socs4 Kcnn2 Socs5 Junb Cacna1 h Mapk6 Stat1 Creb1 Slc12a5 Ptpn1 Aplnr Oprk1 Avpr1b Cacna1s Kcnn4 Kcnmb1 Kiss1 Mc3r Mc5r Mtnr1a Prl Stat4 Slc6a3 Slc6a12

NM_053842 NM_133381 XM_342346 NM_033230 NM_017347 NM_012747 NM_001011905 NM_019374 NM_019229 NM_031798 NM_001107256 NM_019314 NM_001109274 NM_021836 NM_153814 NM_031622 NM_032612 NM_031017 NM_134363 NM_012637 NM_031349 NM_017167 NM_017205 NM_053873 NM_023021 NM_019273 NM_181692 NM_001025270 NM_013182 NM_053676 NM_012629 NM_001012226 NM_012694 NM_017335

1.0524 1.0542 1.0542 1.0652 1.0689 1.0726 1.0782 1.1111 1.1208 1.1404 1.1516 1.1523 1.1677 1.1677 1.1833 1.1984 1.2515 1.2588 1.2793 1.3221 1.3259 1.3902 ND ND ND ND ND ND ND ND ND ND ND ND

SON symbol

Refseq #

Fold regulation

Socs3 Socs1 Cish Kcns1 Avpr1a Mchr1 Stat5a Mtnr1b Cartpt Ptprc Trpv1 Kcnh8 Bdnf Kiss1r Cacna1a Mc4r Socs2 Mapk7 Myc Prlr Pmch Oxt Pomc Pias3 Akt2 Atf2 Pten Pias1 Jun Akt3 Kcnn3 Slc1a1 Oxtr Slc6a9 Nucb2 Mapk9 Cacna1c Kcnn1 Sim1 Avp Stat6 Cacna1b Trpv6 Fos Mapk8 Cacna1 g Stat5b Trpv2 Apln Mapk10

NM_053565 NM_145879 NM_031804 NM_053954 NM_053019 NM_031758 NM_017064 NM_001100641 NM_017110 NM_001109887 NM_031982 NM_145095 NM_012513 NM_023992 NM_012918 NM_013099 NM_058208 NM_001191547 NM_012603 NM_012630 NM_012625 NM_012996 NM_139326 NM_031784 NM_017093 NM_031018 NM_031606 NM_001106829 NM_021835 NM_031575 NM_019315 NM_013032 NM_012871 NM_053818 NM_021663 NM_017322 NM_012517 NM_019313 NM_001107641 NM_016992 NM_001044250 NM_147141 NM_053686 NM_022197 XM_341399 NM_031601 NM_022380 NM_017207 NM_031612 NM_012806

4.232 3.4995 3.2165 2.711 2.6338 2.1667 2.0677 2.0239 1.8336 1.7227 1.7118 1.698 1.6563 1.6459 1.4739 1.4478 1.4229 1.4204 1.4155 1.38 1.3673 1.3626 1.3563 1.3461 1.2567 1.2921 1.1979 1.18 1.176 1.1739 1.1498 1.1484 1.1451 1.1241 1.117 1.1068 1.1036 1.1023 1.0991 1.0953 1.0452 1.0446 1.032 1.022 1.0002 1.0177 1.0218 1.0343 1.0385 1.0415

(continued)


3 of 12

Lactation

P-value 0.812 0.631 0.7 0.569 0.546 0.84 0.834 0.619 0.454 0.58 0.362 0.634 0.315 0.378 0.912 0.163 0.295 0.407 0.21 0.489 0.54 0.324

Fold regulation 1.2075 1.2075 1.0789 1.5231 1.0154 1.0242 1.1712 1.4444 1.1847 1.0826 1.7802 1.7315 1.0556 1.7106 1.0224 1.0826 1.3775 1.1583 1.0231 1.6352 1.2588 1.1888 ND ND ND ND ND ND ND ND ND ND ND ND

P-value 0.102 0.231 0.503 0.138 0.945 0.91 0.525 0.029* 0.774 0.551 0.19 0.26 0.513 0.033* 0.814 0.405 0.131 0.291 0.928 0.303 0.68 0.431

Fold changes in relative gene expression (symbol names shown in column 1) in late-pregnant and lactating rat supraoptic nuclei samples relative to virgin rats (n = 3–4 samples per group). Positive numbers represent up-regulation and negative numbers represent down-regulation. For clarity, changes that are greater than two-fold (either an up-regulation or down-regulation) are shown in bold, as are significant changes, with *P < 0.05, **P < 0.01 and ***P < 0.001. ND, not detected.

tissue samples were collected as described above. Samples were isolated using a Qiacube and then centrifuged in accordance with the manufacturer’s instructions. An on-column DNAse treatment (RNaseFree DNase Set; Qiagen) was carried out for 15 min. The resulting 20 ll of total RNA was frozen at 80 °C until processing. Total RNA (1.5 ll) was measured using a NanoDropâ (ND-1000) UV-Vis Spectrophotometer (NanoDrop, Wilmington, DE, USA). Then, 50 ng of supraoptic nucleus mRNA or 60 ng of paraventricular nucleus mRNA was reverse-transcribed using Tetro Reverse Transcriptase (Bioline Ltd, London, UK). The cDNA was diluted in 80 ll © 2015 British Society for Neuroendocrinology

4 of 12


Table 3. RT2 Profiler Polymerase Chain Reaction Array Data for the Paraventricular Nucleus.

Table 3 (continued)

Late pregnancy

Lactation

PVN symbol

P-value

Fold regulation

0.178 0.243 0.064 0.084 0.031* 0.267 0.191 0.723 0.464 0.801 0.75 0.578 0.792 0.988 0.962 0.908 0.737 0.999 0.906 0.868 0.815 0.749 0.719 0.661 0.601 0.757 0.656 0.567 0.601 0.678 0.535 0.56 0.488 0.474 0.483 0.382 0.54 0.481 0.508 0.445 0.413 0.381 0.436 0.36 0.297 0.346 0.372 0.244 0.306 0.276

8.1089 1.9697 ND 1.4661 1.8251 1.2719 1.8157 1.547 1.3679 2.0662 1.1611 1.6581 1.2265 1.5099 1.6958 1.4995 1.1119 1.1451 1.264 1.32 1.0126 1.5347 1.0161 1.5861 1.2973 1.7599 1.1773 1.9393 2.0569 1.8 3.043 1.2466 1.1551 1.1511 1.3454 2.0929 1.0295 1.5427 1.6279 1.1692 1.1216 1.2816 1.2033 1.1004 1.1917 1.2509 1.3594 1.1412 1.3736 1.2839

Kcnn2 Stat2 Mapk6 Prlr Cacna1 g Trpv6 Socs5 Mapk8 Bdnf Socs4 Pias3 Slc1a1 Cacna1c Cacna1b Cacna1 h Ptprc Slc12a5 Avpr1a Kcnn3 Junb Fos Ptpn1 Avpr1b Cacna1s Kcnmb1 Kcnn4 Kiss1 Mc5r Mtnr1a Mtnr1b Prl Slc6a12 Slc6a3 Socs1

Late pregnancy

Lactation

Refseq #

Fold regulation

Fold regulation

NM_019314 NM_001011905 NM_031622 NM_012630 NM_031601 NM_053686 NM_001109274 XM_341399 NM_012513 NM_001107256 NM_031784 NM_013032 NM_012517 NM_147141 NM_153814 NM_001109887 NM_134363 NM_053019 NM_019315 NM_021836 NM_022197 NM_012637 NM_017205 NM_053873 NM_019273 NM_023021 NM_181692 NM_013182 NM_053676 NM_001100641 NM_012629 NM_017335 NM_012694 NM_145879


PVN symbol

Refseq #

Fold regulation

Avp Pmch Kcns1 Cish Mc3r Trpv1 Stat5a Cartpt Stat4 Pdyn Nucb2 Socs3 Myc Oxtr Oxt Sim1 Pomc Socs2 Mapk7 Mc4r Akt2 Kiss1r Stat1 Pten Akt1 Kcnn1 Cacna1a Atf2 Stat6 Mchr1 Stat5b Akt3 Stat3 Pias1 Mapk1 Slc6a9 Slc12a4 Kcnh8 Apln Oprk1 Mapk3 Jun Aplnr Nfkb1 Trpv2 Mapk9 Slc12a2 Mapk10 Crebbp Creb1

NM_016992 NM_012625 NM_053954 NM_031804 NM_001025270 NM_031982 NM_017064 NM_017110 NM_001012226 NM_019374 NM_021663 NM_053565 NM_012603 NM_012871 NM_012996 NM_001107641 NM_139326 NM_058208 NM_001191547 NM_013099 NM_017093 NM_023992 NM_032612 NM_031606 NM_033230 NM_019313 NM_012918 NM_031018 NM_001044250 NM_031758 NM_022380 NM_031575 NM_012747 NM_001106829 NM_053842 NM_053818 NM_019229 NM_145095 NM_031612 NM_017167 NM_017347 NM_021835 NM_031349 XM_342346 NM_017207 NM_017322 NM_031798 NM_012806 NM_133381 NM_031017

8.0315 5.1065 4.6396 2.2813 2.0394 1.8296 1.6604 1.5332 1.4305 1.3986 1.3494 1.3034 1.2693 1.2561 1.2475 1.2162 1.1472 1.142 1.0203 1.0182 1.0259 1.0426 1.0707 1.0856 1.0951 1.1001 1.1097 1.135 1.1363 1.1482 1.1508 1.1608 1.1811 1.1825 1.1845 1.188 1.188 1.2593 1.2615 1.2623 1.2644 1.2754 1.3136 1.3151 1.3373 1.342 1.3458 1.3552 1.4267 1.4275

P-value

P-value 0.131 0.759 0.437 0.086 0.325 0.314 0.646 0.479 0.214 0.589 0.24 0.804 0.593 0.476 0.445 0.658 0.537 0.31 0.856 0.826 0.318 0.879 0.265 0.298 0.106 0.452 0.158 0.16 0.035* 0.378 0.318 0.522 0.508 0.27 0.078 0.9 0.193 0.221 0.473 0.553 0.344 0.86 0.667 0.356 0.403 0.268 0.424 0.312 0.344

(continued)

© 2015 British Society for Neuroendocrinology

P-value 0.289 0.162 0.25 0.42 0.256 0.171 0.181 0.22 0.48 0.289 0.314 0.155 0.134 0.186 0.242 0.108 0.104 0.307 0.134 0.177 0.076 0.182


0.186 0.087 0.349 0.533 0.137 0.093 0.135 0.21 0.155 0.186 0.144 0.058 0.034* 0.277 0.355 0.173 0.16 0.247 0.261 0.057 0.013** 0.243

Fold changes in relative gene expression (symbol names shown in column 1) in late-pregnant and lactating rat paraventricular nuclei samples relative to virgin rats (n = 3–4 samples per group). Positive numbers represent up-regulation and negative numbers represent down-regulation. For clarity, changes that are greater than two-fold (either an up-regulation or downregulation) are shown in bold, as are significant changes, with *P < 0.05, **P < 0.01 and ***P < 0.001. ND, not detected.

of RNase-free water and then stored at 20 °C until PCR amplification.

Primer design Primer pairs (Table 1) were designed for use in quantitative PCR using Primer-BLAST on the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) and OligoAn alyzer on Integrated DNA Technologies websites (http://sg.idtdna.com/ calc/analyzer) or primer assays were purchased from SABiosciences. Journal of Neuroendocrinology, 2016, 28, 10.1111/jne.12350


The qPCR master mix contained primer pairs at optimal concentrations (which were determined in a separate assay trialling three different starting concentrations of each primer), SensiFAST SYBR No-ROX mix (included SYBR Green I dye; Bioline, Eveleigh NSW, Australia) and water. Then, 9 ll of this master mix was pipetted into a 96-well qPCR plate followed by cDNA template (1 ll) in triplicate. A LightCycler 480 was used to run each plate with the parameters: 10 min at 95 °C, and 45 cycles of 15 s at 95 °C followed by 1 min at 60 °C. Dissociation curves were carried out at the end of each PCR run for PCR product identification. The dissociation steps were 60 °C for 15 s, and ramping up of 0.03 °C every 1 s until 95 °C was reached with continuous acquisition of data. Standard curves (10-fold dilutions) were also run for each set of

(A) (SON) 6

RT-PCR analysis The Cq of each individual reaction was characterised as the PCR cycle at which fluorescence rises above the background fluorescence and analysed using the second derivate maximum method available with the LightCycler 480 software. The mean Cq between the triplicate reactions was calculated and values entered into EXCEL (Microsoft Corp., Redmond, WA, USA). The relative quantification of gene expression was calculated using the comparative Cq method, with normalisation of the target gene to the endogenous reference

6

Oxytocin

4

4

2

2

0

primers to ensure each PCR assay was running efficiently (data not shown).

(B) (PVN)

Oxytocin

5 of 12

NP

P21

L7

0

NP

25

P21

L7

Vasopressin

20 Vasopressin

15

Relative gene expression

6 6 4

4

2

0

2

NP

P21

L7

Pro-dynorphin

6

0

NP

L7

Pro-dynorphin

6

4

P21

4 *

2

2

0

0 NP

P21

L7

NP

P21

L7

Fig. 1. Neuropeptide gene expression in the supraoptic and paraventricular nuclei of late-pregnant (P21) and lactating (L7) rats. Oxytocin, vasopressin and prodynorphin mRNA expression in the supraoptic nuclei (SON) (A) and paraventricular nuclei (PVN) (B) of late-pregnant and lactating rats relative to virgin (NP) rats (n = 6–8 samples per group). *P < 0.05 compared to virgin rats; Dunnett’s multiple comparison test. Journal of Neuroendocrinology, 2016, 28, 10.1111/jne.12350


6 of 12


(A)

(B) (SON)


3

(PVN) 3

Fos

2

2

1

1

Fos

* ***

0

NP

P21

L7

Junb

3

NP

3

P21

L7

Junb

2

2

1

0

0

*

NP

P21

L7

†

1

0

NP

P21

L7

Fig. 2. Immediate early gene expression in the supraoptic nuclei (SON) and paraventricular nuclei (PVN) of late-pregnant (P21) and lactating (L7) rats. Fos and junb mRNA expression in the supraoptic nucleus (A) and paraventricular nucleus (B) of late-pregnant and lactating rats relative to virgin (NP) rats (n = 6–8 samples per group). *P < 0.05 and ***P < 0.001 compared to virgin rats and †P < 0.01 compared to late-pregnant rats; Dunnett’s multiple comparison test.

gene, b-actin. The expression of the reference gene was not significantly different between virgin, late-pregnant and lactating rats (supraoptic nucleus: P = 0.25; paraventricular nucleus: P = 0.39, one-way ANOVA). The relative expression of each gene in each experimental group was normalised to the expression in the virgin control group using an induction factor = 2DDCq, where DDCq = [(Cq gene of interest (experimental group) Cq reference gene (experimental group)) (Cq gene of interest (control) Cq reference gene (control))] and assuming that the efficiency of the PCR reaction was close to two.

Oxytocin and phosphorylated signal transducer and activator of transcription 5 (STAT5) dual-label immunohistochemistry Virgin (n = 8), late-pregnant (n = 8) and lactating (n = 6) rats were deeply anaesthetised with sodium pentobarbital (60 mg/kg) and transcardially perfused with 50 ml of heparinised saline followed by 200 ml 4% paraformaldehyde in 0.1 M phosphate buffer. Brains were removed, post-fixed for 1 h in fixative and transferred to 30% sucrose solution in 0.1 M PB and stored at 4 °C until brains had been infiltrated with sucrose. Brains were then frozen on dry ice and sliced at 30-lm thick on a sliding microtome in four series through the supraoptic and paraventricular nuclei. Within netwells, tissue was washed in Tris-buffered saline (TBS) and then subjected to an antigen retrieval step in Tris-HCl (pH 10) at 90 °C for 5 min, allowed to cool on the bench for 5 min and © 2015 British Society for Neuroendocrinology

then the tissues were blocked in incubation solution (TBS-Triton, 2% normal goat serum, 0.25% bovine serum albumin) for 1 h. Tissues were incubated in 3% hydrogen peroxide in 40% methanol for 10 min and then incubated in polyclonal rabbit anti-phosphorylated STAT5 (pSTAT5) antibody (dilution 1 : 1300; Cell Signaling Technology, Beverly, MA, USA) followed by goat anti- rabbit IgG (dilution 1 : 333; Vector Laboratories, Inc., Burlingame, CA, USA) and reacted with nickel-enhanced 3,30 -diaminobenzidine to produce blue/black staining in the nucleus representative of endogenous pSTAT5. Sections were then subjected to another hydrogen peroxide step followed by incubation in mouse monoclonal anti-oxytocin antibody (dilution 1 : 25 000; Millipore, Billerica, MA, USA) and finally by goat anti-mouse horseradish peroxidase and reacted with diaminobenzidine to produce brown cytoplasmic staining in oxytocin neurones. Sections were mounted onto gelatin-coated slides and coverslipped with DPX after going through an alcohol and xylene series. Sections were photographed under a light microscope and numbers of pSTAT5 alone, oxytocin alone and pSTAT5 + oxytocin were counted in the supraoptic and paraventricular nuclei.

Statistical analysis Data are expressed as the mean SEM. Statistical analysis was carried out using one-way ANOVA and, where the F-ratio was significant, post-hoc analysis using Dunnett’s multiple comparison tests. P ≤ 0.05 was considered statistically significant. Journal of Neuroendocrinology, 2016, 28, 10.1111/jne.12350


(A)

(B)

(SON)

3

(PVN) 3

STAT5b

7 of 12

STAT5b *

2

2

1

1

0

0 NP

L7

NP

P21

3

CISH

4

2

*

2

1

CISH

6


P21

0 NP

P21

L7

SOCS1

3

L7

SOCS1

1

0 NP

P21

L7

3

2

2

1

1

NP

P21

NP

P21

L7

SOCS3

SOCS3

3

0

P21

2

1

0

NP

3

*

2

0

L7

L7

0

*

NP

P21

L7

Fig. 3. Signal transducer and activator of transcription 5b (STAT5b) and suppressors of cytokine signalling (SOCS) gene expression in the supraoptic nuclei (SON) and paraventricular nuclei (PVN) of late-pregnant (P21) and lactating (L7) rats. STAT5b, CISH, SOCS1 and SOCS3 mRNA expression in the supraoptic nucleus (A) and paraventricular nucleus (B) of late-pregnant and lactating rats relative to virgin (NP) rats (n = 6–8 samples per group). *P < 0.05 compared to virgin rats; Dunnett’s multiple comparison test.

Results PCR arrays for gene expression in the supraoptic and paraventricular nuclei of virgin, late-pregnant and lactating rats PCR arrays were carried out to identify changes in expression levels of genes of interest in the supraoptic and paraventricular nuclei of lateJournal of Neuroendocrinology, 2016, 28, 10.1111/jne.12350

pregnant and lactating rats relative to virgin rats. In the supraoptic and paraventricular nuclei, seven and four of 84 genes were significantly changed in either late-pregnancy or lactation, respectively. Although there were several genes that were up- or down-regulated, there were two notable groups of genes that appeared to be differentially regulated by reproductive status: the immediate early genes, Fos and Junb, were generally down-regulated, whereas suppressors of cytokine signalling (SOCS) were generally up-regulated. © 2015 British Society for Neuroendocrinology

8 of 12


In addition to the groups of genes that appeared to be differentially regulated, the following significant changes were evident: cocaine and amphetamine-regulated transcript (Cartpt) mRNA was significantly up-regulated in the supraoptic nucleus in pregnancy but not in lactation, as was melanocortin 3 receptor (Mc3r) mRNA in the paraventricular nucleus; V-Akt murine thymoma viral oncogene homolog 2 (Akt2) mRNA was significantly down-regulated in the supraoptic nucleus in lactation but not in pregnancy, as was melanin-concentrating hormone receptor 1 (Mchr1) in the paraventricular nucleus; calcium channel, voltage-dependent, L-type, alpha 1C subunit (Cacna1c) was significantly down-regulated in the supraoptic and paraventricular nuclei in lactation but not in pregnancy. The full results of the PCR arrays are listed in Table 2 for the supraoptic nucleus and in Table 3 for the paraventricular nucleus.

qRT-PCR for gene expression in the supraoptic and paraventricular nuclei of virgin, late-pregnant and lactating rats To validate our PCR array findings, we used qRT-PCR to quantify the expression levels of the genes that were shown to be signifi-

cantly regulated in the supraoptic or paraventricular nuclei, or that had the greatest up- or down-regulation in late pregnancy and lactation. Of the PCR array results that we validated, two of the seven significant changes in the supraoptic nucleus were found to be significantly different using qRT-PCR, and one of four significant changes in the paraventricular nucleus was found to be significantly different using qRT-PCR. Hence, the false discovery rate of the PCR array was 73%. Although not identical to the PCR array, the same general pattern appeared to hold for the groups of genes that appeared to be differentially regulated by reproductive status: there were large apparent changes in oxytocin and vasopressin gene expression (that were not significant), and a significant upregulation of prodynorphin gene expression (Fig. 1); the immediate early genes, Fos and Junb, were generally down-regulated (Fig. 2); SOCS (and STAT5b) gene expression was generally up-regulated (Fig. 3). The full results of the qRT-PCR are listed in Table 4 for the supraoptic nucleus and in Table 5 for the paraventricular nucleus; of note, but not investigated further in the pressent study, transient receptor potential cation channel, subfamily V, member 6 (Trpv6) mRNA was down-regulated in the supraoptic nucleus in pregnancy but not in lactation, as was Trpv1 mRNA in the paraventricular nucleus.

Table 4. Relative Gene Expression in the Supraoptic Nucleus. SON symbol

Gene name

ANOVA

Socs3 Socs1 Cish Mchr1 Trpv1 Mc4r Pmch Oxt Akt2 Slc1a1 Slc6a9 Cacna1c Avp Trpv6 Fos Stat5b Trpv2 Pdyn Kcnn2 Socs5 Junb Ptpn1 Mc3r GPR54

Suppressor of cytokine signalling 3 Suppressor of cytokine signalling 1 Cytokine inducible SH2-containing protein Melanin-concentrating hormone receptor 1 Transient receptor potential cation channel, subfamily V, member 1 Melanocortin 4 receptor Pro-melanin-concentrating hormone Oxytocin, prepropeptide V-akt murine thymoma viral oncogene homolog 2 Solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter) member 1 Solute carrier family 6 (neurotransmitter transporter, glycine) member 9 Calcium channel, voltage-dependent, L-type, alpha 1C subunit Arginine vasopressin Transient receptor potential cation channel, subfamily V, member 6 FBJ osteosarcoma oncogene Signal transducer and activator of transcription 5B Transient receptor potential cation channel, subfamily V, member 2 Prodynorphin Potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 Suppressor of cytokine signalling 5 Jun B proto-oncogene Protein tyrosine phosphatase, nonreceptor type 1 Melanocortin 3 receptor G-protein coupled receptor-54

F2,16 F2,17 F2,18 F2,18 F2,16 F2,17 F2,17 F2,17 F2,18 F2,17 F2,17 F2,17 F2,18 F2,18 F2,17 F2,18 F2,17 F2,17 F2,18 F2,18 F2,17 F2,16 F2,17 F2,17

Relative expression Pregnancy Lactation = = = = = = = = = = = = = = = = = = = = = = = =

0.72, P = 0.5 6.04, P = 0.01 2.86, P = 0.08 2.48, P = 0.11 1.42, P = 0.27 0.7, P = 0.51 1.18, P = 0.33 1.91, P = 0.18 0.7, P = 0.51 1.46, P = 0.26 2.4, P = 0.12 1.24, P = 0.32 3.11, P = 0.07 4.15, P = 0.03 0.7, P = 0.51 0.32, P = 0.73 2.66, P = 0.1 3.69, P = 0.047 0.18, P = 0.84 2.66, P = 0.1 2.96, P = 0.079 3.2, P = 0.07 1.41, P = 0.27 1.32, P = 0.29

1.25 1.66** 1.66 1.61 1.04 0.75 1.02 1.28 0.92 1.1 1.52 1.16 2.27 0.47 1.08 1.08 0.83 1.51 1.16 0.66 0.8 1.59 1.59 1.36

1.08 1.06 3.87 0.98 3.01 0.56 0.17 0.56 0.79 0.72 0.98 0.72 1.17 1.12 0.68 0.88 1.98 2.35* 1.17 0.86 0.58* 1.69 0.78 0.84

Gene expression measured by quantitative polymerase chain reaction in late-pregnant and lactating rat supraoptic nuclei samples relative to virgin rats (n = 6 –8 samples per group). Symbol names are shown in column 1 and full gene names are shown in column 2. Numbers greater than one represent up-regulation, and numbers smaller than one represent down-regulation in expression relative to virgin rats. For clarity, significant changes (one-way ANOVA, followed by Dunnett’s multiple comparison test) are shown in bold, with *P < 0.05, **P < 0.01 and ***P < 0.001. © 2015 British Society for Neuroendocrinology



9 of 12

Table 5. Relative Gene Expression in the Paraventricular Nucleus. PVN symbol

Gene name

ANOVA

Avp Pmch Cish Mc3r Trpv1 Pdyn Socs3 Oxt Mc4r Akt2 Mchr1 Stat5b Slc6a9 Trpv2 Kcnn2 Socs5 Slc1a1 Cacna1c Junb Fos Ptpn1 Socs1 GPR54

Arginine vasopressin Pro-melanin-concentrating hormone Cytokine inducible SH2-containing protein Melanocortin 3 receptor Transient receptor potential cation channel, subfamily V, member 1 Prodynorphin Suppressor of cytokine signalling 3 Oxytocin, prepropeptide Melanocortin 4 receptor V-akt murine thymoma viral oncogene homolog 2 Melanin-concentrating hormone receptor 1 Signal transducer and activator of transcription 5B Solute carrier family 6 (neurotransmitter transporter, glycine) member 9 Transient receptor potential cation channel, subfamily V, member 2 Potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 Suppressor of cytokine signalling 5 Solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter) member 1 Calcium channel, voltage-dependent, L type, alpha 1C subunit 1 Jun B proto-oncogene 4 FBJ osteosarcoma oncogene Protein tyrosine phosphatase, nonreceptor type 1 Suppressor of cytokine signalling 1 G-protein coupled receptor-54

F2,16 F2,15 F2,17 F2,16 F2,17 F2,16 F2,16 F2,17 F2,17 F2,16 F2,15 F2,17 F2,17 F2,17 F2,17 F2,16 F2,17 F2,17 F2,16 F2,16 F2,15 F2,17 F2,17

Relative expression Pregnancy Lactation = = = = = = = = = = = = = = = = = = = = = = =

2.68, P = 0.099 0.05, P = 0.96 3.57, P = 0.05 0.82, P = 0.46 3.8, P = 0.04 2.52, P = 0.11 6.92, P = 0.007 2.19, P = 0.14 0.31, P = 0.74 0.07, P = 0.93 0.16, P = 0.85 4.88, P = 0.02 0.04, P = 0.96 0.6, P = 0.56 0.98, P = 0.4 0.34, P = 0.72 1.85, P = 0.19 1.94, P = 0.17 5.34, P = 0.017 12.63, P = 0.0005 0.85, P = 0.45 1.41, P = 0.27 2.65, P = 0.099

2.31 0.83 1.61* 1.14 0.38* 1.48 2.25* 2.11 0.91 0.88 1.17 1.42 1.08 1.05 1.14 1.17 1.82 0.7 1.11 0.61* 1.32 1.03 0.91

14.76 0.98 1.51 1.41 0.71 3.77 0.95 3.55 1.16 0.92 0.9 2.00* 1.03 1.37 0.87 1.09 1.63 0.89 0.62 0.25*** 0.99 0.64 0.52

Gene expression measured by quantitative polymerase chain reaction in late-pregnant and lactating rat paraventricular nuclei samples relative to virgin rats (n = 6–8 samples per group). Symbol names are shown in column 1 and full gene names are shown in column 2. Numbers greater than one represent upregulation, and numbers smaller than one represent down-regulation in expression relative to virgin rats. For clarity, significant changes (one-way ANOVA, followed by Dunnett’s multiple comparison test) are shown bold, with *P < 0.05, **P < 0.01 and ***P < 0.001.

pSTAT5 expression in oxytocin neurones of virgin, latepregnant and lactating rats Endogenous pSTAT5 expression was low in the supraoptic and paraventricular nuclei of virgin rats, with very few oxytocin-positive neurones co-expressing pSTAT5. By contrast, in late-pregnant and lactating rats, almost all oxytocin-positive neurones co-expressed pSTAT5 and most pSTAT5-positive neurones co-expressed oxytocin (Fig. 4). Nevertheless, some pSTAT5 was evident in non-oxytocin neurones, particularly in the paraventricular nucleus.

Discussion In the present study, we used PCR arrays and qRT-PCR validation to identify genes that are possible modulators of oxytocin neurone excitability in pregnancy and lactation, focussing on genes for ion channels that directly modulate excitability of magnocellular neurones, including calcium, potassium and TRPV channels (10–12); neurotransmitter transporters that modulate excitability by regulating access to extracellular receptors on magnocellular neurones, such as glutamate and GABA transporters (13,14); peptides and their cognate receptors, including peptides that are co-localised with oxytocin or vasopressin and might modulate activity such as apelin, brain-derived neurotrophic factor and dynorphin (15–17), as well as peptide horJournal of Neuroendocrinology, 2016, 28, 10.1111/jne.12350

mones that might be involved in reproductive regulation of magnocellular neurone function, including kisspeptin and prolactin (18–20); and common intracellular signalling pathways that might directly modulate channel/transporter/receptor expression or function, including the erk extracellular signal regulated kinase, Akt and Janus kinase-STAT pathways (21–24). Although a comprehensive microarray analysis for gene expression in the supraoptic nucleus of lactating rats has been reported previously (25), to the best of our knowledge, this is the first report of changes in mRNA expression the supraoptic and paraventricular nuclei of pregnant and lactating rats. These observations provide a database to help formulate hypotheses regarding the physiological regulation of supraoptic and paraventricular nuclei neurone activity during changes in reproductive state. Although changes in mRNA expression were not identical in the supraoptic and paraventricular nuclei, the overall trends in up- and down-regulation of mRNA expression were broadly similar. The differences found between the two nuclei might result from the greater heterogeneity of neuronal phenotype in the paraventricular nucleus compared to the supraoptic nucleus; the supraoptic nucleus comprises magnocellular oxytocin and vasopressin neurones that project to the posterior pituitary gland, whereas the paraventricular nucleus comprises magnocellular neurones and parvocellular neurones that project to the median eminence of the hypothalamus to control anterior pituitary function, as well as to other areas of the © 2015 British Society for Neuroendocrinology


(D)

80 60 40 20 0 NP

P21

L7

200

100

(E)

*

*

80 60 40 20 0 NP

P21

L7

(H)

(J)

150 100 50 0 NP

P21

L7

Proportion of oxytocin neurones expressing pSTAT5 (%)

Number of oxytocin-positive neurones

(G)

(C)

Proportion of pSTAT5 -positive cells expressing oxytocin (%)

100

(B)

Proportion of oxytocin neurones expressing pSTAT5 (%)

Number of oxytocin-positive neurones

(A)

100

100

(F)

*

*

P21

L7

*

*

P21

L7

80 60 40 20 0 NP

(I)

( K)

80

*

*

60 40 20 0 NP

P21

L7

Proportion of pSTAT5 -positive cells expressing oxytocin (%)

10 of 12

100

(L)

80 60 40 20 0 NP

Fig. 4. Phosphorylated signal transducer and activator of transcription 5 (STAT5) and oxytocin double-labelling in the supraoptic and paraventricular nuclei of late-pregnant and lactating rats. (A–C) Example photomicrographs of pSTAT5 and oxytocin double-labelling in the supraoptic nucleus of virgin (A), late-pregnant (B) and lactating (C) rats (scale bar = 50 lm). (D–F) Number of oxytocin neurones (D), proportion of oxytocin neurones expressing pSTAT5 (E) and proportion of pSTAT5-positive neurones expressing oxytocin (F) in the supraoptic nucleus of virgin, late-pregnant and lactating rats. (G–I) Example photomicrographs of pSTAT5 and oxytocin double-labelling in the paraventricular nucleus of virgin (G), late-pregnant (H) and lactating (I) rats (scale bar = 100 lm). (J–L) Number of oxytocin neurones (J), proportion of oxytocin neurones expressing pSTAT5 (K) and proportion of pSTAT5-positive neurones expressing oxytocin (L) in the paraventricular nucleus of virgin, late-pregnant and lactating rats. *P < 0.05 compared to virgin rats; Dunnett’s multiple comparison test.

brain to modulate behaviour and the autonomic nervous system (26).

Reproductive regulation of oxytocin neurones The most highly up-regulated genes in the supraoptic nucleus of late-pregnant and lactating rats were those that encode for various © 2015 British Society for Neuroendocrinology

SOCS, which are intracellular inhibitors of signalling through the type-1 cytokine family of receptors, including the prolactin receptor (27). Circulating prolactin and placental lactogen are elevated in pregnancy and lactation (8,9), and oxytocin neurones express mRNA for the long form of the prolactin receptor in virgin, pregnant and lactating rats (20). Prolactin administration increases oxytocin mRNA expression (28,29), as well as oxytocin secretion (30). Journal of Neuroendocrinology, 2016, 28, 10.1111/jne.12350


Similarly, oxytocin mRNA expression is increased in rats primed with steroids to mimic the steroid hormone milieu of pregnancy, although only in the presence of prolactin (31). Activation of prolactin receptors modulates gene expression via phosphorylation of STAT5 (32). We have previously shown that prolactin administration phosphorylates STAT5 in oxytocin neurones in virgin female rats (24). In the present study, pSTAT5 was expressed in almost all oxytocin neurones of late-pregnant and lactating rats but was almost absent from oxytocin neurones of virgin rats. Hence, activation of prolactin receptors on oxytocin neurones might be increased in pregnancy and lactation to drive oxytocin synthesis, as well as activation of other genes in oxytocin neurones. The increased activation of SOCS mRNA in pregnancy and lactation likely reflects a greater engagement of intracellular feedback inhibition of prolactin signalling, a process typical of this family of cytokine receptors. We have previously reported that the expression of SOCS1 and SOCS3 mRNA is increased in the arcuate nucleus in late pregnancy and lactation, suggesting that increased activation of SOCS might be widespread in the hypothalamus (33). Oxytocin secretion is driven by action potential activity in oxytocin neurones (1). The immediate early gene, Fos, is reliable marker of activation of oxytocin neurones (34). The major synaptic inputs to oxytocin neurones (and neighbouring vasopressin neurones) are glutamatergic and GABAergic (35,36); GABA input activity is reduced just before parturition (37) but glutamate input activity is increased in lactation (38). The reduced expression of mRNA for Fos and its dimerisation partner, Junb, is difficult to reconcile with the increased excitatory synaptic drive to oxytocin neurones in lactation. However, Fos expression in other paraventricular nucleus neurones is less robust after manipulations of glutamate than other neurotransmitters, such as noradrenaline (39). Hence, the reduced Fos expression might reflect changes in regulation by other neurotransmitters (e.g. we have recently found reduced a-melanocytestimulating hormone-induced Fos expression in the supraoptic and paraventricular nuclei during pregnancy) (40).

11 of 12

as an autocrine feedback inhibitor of vasopressin neurones (17). Prodynorphin mRNA is also up-regulated in the supraoptic nucleus of dehydrated rats (43) to limit over-activation of vasopressin neurones (44). Hence, the up-regulation of prodynorphin mRNA in the supraoptic nucleus of lactating rats might reflect feedback inhibition of vasopressin neurone activity. Although most oxytocin neurones expressed pSTAT5 in pregnant and lactating rats, there were some non-oxytocin neurones that expressed pSTAT5; at least in the supraoptic nucleus, these are likely to be magnocellular vasopressin neurones. However, almost no vasopressin neurones express mRNA for the long form of the prolactin receptor, even in lactation (20), and so the induction of pSTAT5 in presumptive vasopressin neurones might involve other mechanisms.

Concluding remarks In the present study, we used PCR arrays and qRT-PCR to generate a database of reproductive regulation of gene expression in the supraoptic and paraventricular nuclei. From our PCR array and qRTPCR validation results, we predicted that STAT5 would be activated (presumably by prolactin/placental lactogen) in oxytocin neurones of late-pregnant and lactating rats, and this was found to be the case using immunohistochemistry for pSTAT5. Further work will be required to determine whether STAT5 signalling drives reproduction-induced expression of other genes in oxytocin neurones, as well as the contribution of the changes in the expression of other genes to the functioning of oxytocin neurones in pregnancy and lactation.

Acknowledgements This work was supported by the Marsden Fund of the Royal Society of New Zealand (Contract UOO0905).

Received 21 October 2015, revised 8 December 2015, accepted 9 December 2015

Reproductive regulation of vasopressin neurones Although pregnancy and lactation are most often associated with plasticity in oxytocin neurones, the homeostatic set-point for plasma osmolality is reset to a lower value in lactation, with circulating vasopressin levels being increased in lactating rats in the face of reduced plasma osmolality (41). Intrinsic osmosensitivity of vasopressin (and oxytocin) neurones is conferred by the expression of a splice variant of TRPV1 that functions as a stretch-inactivated cation channel to induce a depolarisation when vasopressin (and oxytocin) neurones shrink as osmolality increases (42). Although the three-fold up-regulation of TRPV1 mRNA in the supraoptic nucleus of lactating rats was not statistically significant, it might be sufficient to drive a change in TRPV1 protein expression that would increase the intrinsic osmosensitivity of vasopressin and oxytocin neurones; further studies will be required to determine whether this is the case. Prodynorphin mRNA was up-regulated in the supraoptic nucleus of lactating rats and dynorphin is best characterised in this system Journal of Neuroendocrinology, 2016, 28, 10.1111/jne.12350

References 1 Brown CH, Bains JS, Ludwig M, Stern JE. Physiological regulation of magnocellular neurosecretory cell activity: integration of intrinsic, local and afferent mechanisms. J Neuroendocrinol 2013; 25: 678–710. 2 Nishimori K, Young LJ, Guo Q, Wang Z, Insel TR, Matzuk MM. Oxytocin is required for nursing but is not essential for parturition or reproductive behavior. Proc Natl Acad Sci USA 1996; 93: 11699–11704. 3 Russell JA, Leng G. Sex, parturition and motherhood without oxytocin? J Endocrinol 1998; 157: 343–359. 4 Antonijevic IA, Douglas AJ, Dye S, Bicknell RJ, Leng G, Russell JA. Oxytocin antagonists delay the initiation of parturition and prolong its active phase in rats. J Endocrinol 1995; 145: 97–103. 5 Van Tol HH, Bolwerk EL, Liu B, Burbach JP. Oxytocin and vasopressin gene expression in the hypothalamo-neurohypophyseal system of the rat during the estrous cycle, pregnancy, and lactation. Endocrinology 1988; 122: 945–951. 6 Zingg HH, Lefebvre DL. Oxytocin and vasopressin gene expression during gestation and lactation. Brain Res 1988; 464: 1–6.


12 of 12


7 Leng G, Dye S, Bicknell RJ. Kappa-opioid restraint of oxytocin secretion: plasticity through pregnancy. Neuroendocrinology 1997; 66: 378– 383. 8 Grattan DR, Kokay IC. Prolactin: a pleiotropic neuroendocrine hormone. J Neuroendocrinol 2008; 20: 752–763. 9 Grattan DR, Steyn FJ, Kokay IC, Anderson GM, Bunn SJ. Pregnancyinduced adaptation in the neuroendocrine control of prolactin secretion. J Neuroendocrinol 2008; 20: 497–507. 10 Zhang W, Star B, Rajapaksha WR, Fisher TE. Dehydration increases L-type Ca2+ current in rat supraoptic neurons. J Physiol 2007; 580: 181–193. 11 Fisher TE, Voisin DL, Bourque CW. Density of transient K+ current influences excitability in acutely isolated vasopressin and oxytocin neurones of rat hypothalamus. J Physiol 1998; 511: 423–432. 12 Naeini RS, Witty MF, Seguela P, Bourque CW. An N-terminal variant of Trpv1 channel is required for osmosensory transduction. Nat Neurosci 2006; 9: 93–98. 13 Joe N, Scott V, Brown CH. Glial regulation of extrasynaptic NMDA receptor-mediated excitation of supraoptic nucleus neurons during dehydration. J Neuroendocrinol 2014; 26: 35–42. 14 Park JB, Skalska S, Stern JE. Characterization of a novel tonic gammaaminobutyric acidA receptor-mediated inhibition in magnocellular neurosecretory neurons and its modulation by glia. Endocrinology 2006; 147: 3746–3760. 15 Tobin VA, Bull PM, Arunachalam S, O’Carroll AM, Ueta Y, Ludwig M. The effects of apelin on the electrical activity of hypothalamic magnocellular vasopressin and oxytocin neurons and somatodendritic peptide release. Endocrinology 2008; 149: 6136–6145. 16 Choe KY, Han SY, Gaub P, Shell B, Voisin DL, Knapp BA, Barker PA, Brown CH, Cunningham JT, Bourque CW. High salt intake increases blood pressure via BDNF-mediated downregulation of KCC2 and impaired baroreflex inhibition of vasopressin neurons. Neuron 2015; 85: 549–560. 17 Brown CH, Scott V, Ludwig M, Leng G, Bourque CW. Somatodendritic dynorphin release: orchestrating activity patterns of vasopressin neurons. Biochem Soc Trans 2007; 35: 1236–1242. 18 Scott V, Brown CH. Kisspeptin activation of supraoptic nucleus neurons in vivo. Endocrinology 2011; 152: 3862–3870. 19 Scott V, Brown CH. Beyond the GnRH axis: kisspeptin regulation of the oxytocin system in pregnancy and lactation. Adv Exp Med Biol 2013; 784: 201–218. 20 Kokay IC, Bull PM, Davis RL, Ludwig M, Grattan DR. Expression of the long form of the prolactin receptor in magnocellular oxytocin neurons is associated with specific prolactin regulation of oxytocin neurons. Am J Physiol Regul Integr Comp Physiol 2006; 290: R1216–R1225. 21 Blume A, Torner L, Liu Y, Subburaju S, Aguilera G, Neumann ID. Prolactin activates mitogen-activated protein kinase signaling and corticotropin releasing hormone transcription in rat hypothalamic neurons. Endocrinology 2009; 150: 1841–1849. 22 Dine J, Ducourneau VR, Fenelon VS, Fossat P, Amadio A, Eder M, Israel JM, Oliet SH, Voisin DL. Extracellular signal-regulated kinase phosphorylation in forebrain neurones contributes to osmoregulatory mechanisms. J Physiol 2014; 592: 1637–1654. 23 Song Z, Levin BE, Stevens W, Sladek CD. Supraoptic oxytocin and vasopressin neurons function as glucose and metabolic sensors. Am J Physiol Regul Integr Comp Physiol 2014; 306: R447–R456. 24 Sapsford TJ, Kokay IC, Ostberg L, Bridges RS, Grattan DR. Differential sensitivity of specific neuronal populations of the rat hypothalamus to prolactin action. J Comp Neurol 2012; 520: 1062–1077. 25 Qiu J, Hindmarch CC, Yao ST, Tasker JG, Murphy D. Transcriptomic analysis of the osmotic and reproductive remodeling of the female rat supraoptic nucleus. Endocrinology 2011; 152: 3483–3491.


26 Swanson LW, Sawchenko PE. Hypothalamic integration: organization of the paraventricular and supraoptic nuclei. Annu Rev Neurosci 1983; 6: 269–324. 27 Wormald S, Hilton DJ. Inhibitors of cytokine signal transduction. J Biol Chem 2004; 279: 821–824. 28 Donner N, Neumann ID. Effects of chronic intracerebral prolactin on the oxytocinergic and vasopressinergic system of virgin ovariectomized rats. Neuroendocrinology 2009; 90: 315–322. 29 Ghosh R, Sladek CD. Prolactin modulates oxytocin mRNA during lactation by its action on the hypothalamo-neurohypophyseal axis. Brain Res 1995; 672: 24–28. 30 Parker SL, Armstrong WE, Sladek CD, Grosvenor CE, Crowley WR. Prolactin stimulates the release of oxytocin in lactating rats: evidence for a physiological role via an action at the neural lobe. Neuroendocrinology 1991; 53: 503–510. 31 Popeski N, Amir S, Diorio J, Woodside B. Prolactin and oxytocin interaction in the paraventricular and supraoptic nuclei: effects on oxytocin mRNA and nitric oxide synthase. J Neuroendocrinol 2003; 15: 687–696. 32 Lerant A, Kanyicska B, Freeman ME. Nuclear translocation of STAT5 and increased expression of Fos related antigens (FRAs) in hypothalamic dopaminergic neurons after prolactin administration. Brain Res 2001; 904: 259–269. 33 Anderson GM, Beijer P, Bang AS, Fenwick MA, Bunn SJ, Grattan DR. Suppression of prolactin-induced signal transducer and activator of transcription 5b signaling and induction of suppressors of cytokine signaling messenger ribonucleic acid in the hypothalamic arcuate nucleus of the rat during late pregnancy and lactation. Endocrinology 2006; 147: 4996–5005. 34 Luckman SM, Dyball RE, Leng G. Induction of c-fos expression in hypothalamic magnocellular neurons requires synaptic activation and not simply increased spike activity. J Neurosci 1994; 14: 4825–4830. 35 Van den Pol AN, Wuarin JP, Dudek FE. Glutamate, the dominant excitatory transmitter in neuroendocrine regulation. Science 1990; 250: 1276. 36 Decavel C, Van den Pol AN. GABA: a dominant neurotransmitter in the hypothalamus. J Comp Neurol 1990; 302: 1019–1037. 37 Brussaard AB, Kits KS, Baker RE, Willems WP, Leyting-Vermeulen JW, Voorn P, Smit AB, Bicknell RJ, Herbison AE. Plasticity in fast synaptic inhibition of adult oxytocin neurons caused by switch in GABA(A) receptor subunit expression. Neuron 1997; 19: 1103–1114. 38 Stern JE, Hestrin S, Armstrong WE. Enhanced neurotransmitter release at glutamatergic synapses on oxytocin neurones during lactation in the rat. J Physiol 2000; 526: 109–114. 39 Cole RL, Sawchenko PE. Neurotransmitter regulation of cellular activation and neuropeptide gene expression in the paraventricular nucleus of the hypothalamus. J Neurosci 2002; 22: 959–969. 40 Ladyman SR, Augustine RA, Scherf E, Phillipps HR, Brown CH, Grattan DR. Attenuated hypothalamic responses to alpha-melanocyte stimulating hormone during pregnancy in the rat. J Physiol 2015; Nov 28. doi: 10.1113/JP271605. [Epub ahead of print]. 41 Suzuki K, Koizumi N, Hirose H, Hokao R, Takemura N, Motoyoshi S. Changes in plasma arginine vasopressin concentration during lactation in rats. Comp Med 2000; 50: 277–280. 42 Bourque CW. Central mechanisms of osmosensation and systemic osmoregulation. Nat Rev Neurosci 2008; 9: 519–531. 43 Scott V, Bishop VR, Leng G, Brown CH. Dehydration-induced modulation of kappa-opioid inhibition of vasopressin neurone activity. J Physiol 2009; 587: 5679–5689. 44 Scott V, Brown CH. State-dependent plasticity in vasopressin neurones: dehydration-induced changes in activity patterning. J Neuroendocrinol 2010; 22: 343–354.
