Critical elements of a mammalian mitochondrial DNA heavy-strand replication origin include a promoter and three downstream conserved sequence blocks ...
The EMBO Journal vol.15 no.12 pp.3135-3143, 1996
RNA-DNA hybrid formation at the human mitochondrial heavy-strand origin ceases at replication start sites: an implication for RNA-DNA hybrids serving as primers Baoji Xu1 and David A.Clayton2 Department of Developmental Biology, Beckman Center for Molecular and Genetic Medicine, Stanford University School of Medicine. Stanford, CA 94305-5427, USA 'Present address: Howard Hughes Medical Institute, University of California, San Francisco, CA 94143-0724, USA 2Corresponding author
Critical elements of a mammalian mitochondrial DNA heavy-strand replication origin include a promoter and three downstream conserved sequence blocks (CSBIII, CSBII and CSBI). We found recently that a stable and persistent RNA-DNA hybrid forms during in vitro transcription at Saccharomyces cerevisiae mitochondrial origins; hybrid formation was dependent on the conserved CSBII element. We report here that during in vitro transcription with human mitochondrial RNA polymerase, stable and persistent RNA-DNA hybrid formation is also evident at the human mitochondrial heavy-strand origin. As predicted, hybrid formation was dependent on the GC-rich CSBII element. The human RNA-DNA hybrids terminate within or downstream of CSBI at locations implicated in initiation of mitochondrial DNA replication. Interestingly, efficient hybrid formation in the human system is influenced by sequence 5' to the RNA-DNA hybrid, including the CSBIII element. These results suggest that the RNADNA hybrids formed during transcription across the mitochondrial DNA heavy-strand origin provide RNA primers for initiation of mitochondrial DNA replication. Keywords: mitochondria/primer/replication/RNA-DNA hybrid/transcription
Introduction In several cases RNA primers used for DNA replication are transcribed from an upstream promoter, with or without subsequent processing of the transcript to produce 3'-OH groups for elongation by DNA polymerase. Examples of this type of mechanism are the bacterial ColE 1 (Itoh and Tomizawa, 1980; Dasgupta et al., 1987), bacteriophage T7 (Fuller and Richardson, 1985) and mitochondrial DNA (mtDNA) (for a review, see Schmitt and Clayton, 1993) origins. In the case of ColEl, a 555-nucleotide RNA exits the template and folds into a complex structure that stabilizes an RNA-DNA hybrid region at the 3' end of the RNA at the origin of DNA replication. RNase H cleavage at this site provides the RNA primers for DNA synthesis (Masukata and Tomizawa, 1990). Replication of T7 DNA does not involve extensive RNA-DNA hybrid formation, but is initiated when T7 DNA polymerase K Oxford University Press
displaces T7 RNA polymerase and elongates the transcript (Fuller and Richardson, 1985). Mammalian mtDNA is replicated from two origins, a heavy (H)-strand origin (OH) and a light (L)-strand origin (OL). Replication begins at OH and continues unidirectionally along the parental L-strand to synthesize a full circle of mtDNA. Replication from the OL does not begin until elongation of the nascent H-strand is about twothirds complete, when the OL is exposed as a singlestranded region (Clayton, 1982). Therefore, the OH is also termed the leading-strand origin and the OL the laggingstrand origin. Critical elements of a mammalian OH include a promoter and three downstream conserved sequence blocks called CSBIII, CSBII and CSBI. The majority of 5' ends of nascent H-strand DNAs are located within or downstream of CSBI (Gillum and Clayton, 1979; Chang and Clayton, 1985; Chang et al., 1985). On the basis of the structure of mtDNA replication origins and the fine mapping of nascent mitochondrial RNA (mtRNA) and mtDNA strands, it has been proposed that leading H-strand mammalian mtDNA replication is primed by RNA synthesized by the mitochondrial transcription machinery (Chang and Clayton, 1985; Chang et al., 1985). Several lines of evidence are at least consistent with a similar situation in yeast cells (Schmitt and Clayton, 1993). For example, inactivation of either of the two components of Saccharomyces cerevisiae mtRNA polymerase, core mtRNA polymerase or mtTFB, results in a loss of wild-type mtDNA (Greenleaf et al., 1986; Lisowsky and Michaelis, 1988; Xu and Clayton, 1992). Previously we demonstrated that during in vitro transcription with purified yeast mtRNA polymerase, there is stable and persistent RNA-DNA hybrid formation at yeast mitochondrial origins (Xu and Clayton, 1995). RNADNA hybrid formation is dependent upon the GC-rich CSBII element and, in contrast to the ColE1 origin, is independent of RNA 5' to the hybrid. We hypothesized that RNA-DNA hybrid formation represents a critical step, following transcription initiation, in priming mtDNA replication. Since RNA-DNA hybrid formation at yeast mitochondrial origins is also dependent upon the RNA polymerase employed (Xu and Clayton, 1995), it remained unclear whether or not RNA-DNA hybrid formation is a phenomenon common to mitochondrial origins. To begin to answer this question we have examined RNA-DNA hybrid formation at the human mitochondrial origin of H-strand replication.
Results Purification of RNase H-free human mtRNA polymerase Human mitochondrial transcription activity can be fractionated into two complements, h-mtTFA and a mtRNA 3135
B.Xu and D.A.Clayton
polymerase fraction (Fisher and Clayton, 1985). Human mtTFA, which is essential for transcription initiation at a human mitochondrial promoter (Fisher and Clayton, 1985), has been purified and its gene has been cloned (Fisher and Clayton, 1988; Parisi and Clayton, 1991). However, the mtRNA polymerase fraction has not yet been purified to homogeneity and its exact protein composition remains unknown. In order to detect RNA-DNA hybrid formation during transcription, it was essential to obtain RNase H-free mtRNA polymerase. RNase H specifically degrades the RNA component of an RNA-DNA duplex. There was RNase H activity in the human mtRNA polymerase fraction purified by a standard purification procedure, which included column chromatography on DEAESephacel and Phosphocellulose 11 (data not shown). Further purification of human mtRNA polymerase resulted in large losses of polymerase activity. Activity could not be recovered by combining different fractions (data not shown). The fragile nature of human mtRNA polymerase during purification forced us to find a single procedural step which could efficiently separate RNase H activities from mtRNA polymerase. We found that Bio-Rex 70 resin was able to separate RNase H from mtRNA polymerase. Human mtRNA polymerase was eluted at 480 mM KCl while RNase H activity was eluted at 320 mM KCI (Figure 1A and B). These mtRNA polymerase fractions contained a trace amount of h-mtTFA; however, maximal transcription initiation activity was obtained by adding purified recombinant h-mtTFA (data not shown). Based on the chromatographic properties of the RNase H activity and human mtRNA polymerase on a Bio-Rex 70 column, a purification procedure to obtain RNase
H-free human mtRNA polymerase was developed (see Materials and methods for details). By increasing the KCl concentration in the Bio-Rex 70 loading sample to 350 mM, all RNase H activity was removed from the human mtRNA polymerase fraction. We used our previously established assay for RNA-DNA hybrid formation at the yeast ori5 template (Xu and Clayton, 1995) to verify that our human mtRNA polymerase fraction was indeed free of RNase H (Figure IC). RNA-DNA hybrids at the yeast oriS template were resistant to treatment with RNase A which cleaves single-stranded RNA at pyrimidine sites (Figure IC, compare lane 2 with lane 1). The RNase A-resistant transcripts could be further degraded by Escherichia coli RNase H (Figure IC, lane 4), but not by the human mtRNA polymerase fraction purified by Bio-Rex 70 column chromatography, indicating that the human mtRNA polymerase fraction was free of RNase H contamination. This enzyme was used to assay RNADNA hybrid formation at the human mitochondrial H-strand origin.
RNA-DNA hybrid formation at the human mitochondrial H-strand origin Human mtDNA has two major transcription promoters, the L-strand promoter (LSP) and the H-strand promoter (HSP). Each of these promoters is responsible for transcribing one strand of mtDNA, with the LSP transcript likely used to generate the primer for H-strand DNA synthesis. The human mitochondrial OH-containing plasmid, pBX210, contains the LSP. When the LSP of pBX210 was inactivated by mutations, no transcription products were observed (data not shown), indicating that no additional transcription promoters are present on the plasmid.
Fig. 1. Purification of RNase H-free human mtRNA polymerase. (A) Elution profile of RNase H activities on a Bio-Rex 70 column. RNase H activity is expressed as the percentage of RNA-DNA hybrid substrate which is degraded. (B) Human mtRNA polymerase activity of Bio-Rex 70 fractions. Plasmid L5'A-70, which contains only one (the LSP) of two human mitochondrial promoters, was linearized with EcoRI and used as the run-off transcript template. Each transcription reaction was supplemented with 25 ng of h-mtTFA. The LSP-specific full-length transcription products are shown. (C) RNase H-free human mtRNA polymerase. Transcription with purified yeast mtRNA polymerase and subsequent RNase treatment of transcription products were performed as described (Xu and Clayton, 1995). Origin ori5-containing pHS40 was linearized with AvaIl and used as the transcription template. The RNase A-resistant transcripts are about three nucleotides shorter than the full length transcripts, which are 224 nucleotides in size. During RNase treatment, 100 ng RNase A, 0.3 U E.coli RNase H and 0.5 p.g human mtRNA polymerase fraction were used. Lane M, 32P-labeled HpaII fragments of pBR322 DNA; they are 307. 242, 238, 217, 201 and 190 nucleotides, respectively.
3136
RNA-DNA hybrid formation at a mitochondrial origin
Supercoiled plasmid DNA was used as the transcription template because it more accurately represents the configuration of native mtDNA. Transcription paused or terminated at multiple locations to produce RNA transcripts of several lengths (Figure 2A, lane 1). The transcription products were treated with increasing amounts of RNase A. Interestingly, a small number of transcripts was protected from RNase A digestion (Figure 2A, lanes 24) and was further degraded by E.coli RNase H (Figure 2A, lane 5). These results demonstrate that persistent RNA-DNA hybrids form at the OH-containing template during transcription. To estimate more accurately the sizes of the RNA strands present in the RNA-DNA hybrids, a series of RNA size markers was generated using yeast mtRNA polymerase to transcribe yeast ori5 in the presence of a low concentration of CTP (Figure 2B, lane 1). Under our gel electrophoresis conditions, the mobilities of DNA and RNA size markers were similar (Figure 2B, compare lanes 1 and M). Based on both DNA and RNA size markers, the lengths of the seven largest protected RNAs (RNA1RNA7) were estimated to be 124, 119, 112, 98, 96, 93 and 90 nucleotides, respectively (Figure 2B).
B
A R Nase A RNase H
-
-
-
-
-
RNsA~~-m mm
ob
-
Eb
A
Location of the RNA-DNA hybrids at the human mitochondrial H-strand origin Four RNase A-resistant RNAs (RNA2, RNA3, RNA5 and RNA6 in Figure 2B) were purified from a denaturing polyacrylamide gel. The individual purified RNAs were annealed with one of five downstream PCR primers (B33B37), which together spanned a 96-base region around CSBI (Figure 3A). Complementary DNAs to these RNAs were then synthesized with reverse transcriptase. The cDNAs were subjected to PCR amplification using the primer used for the reverse transcription reaction and a common upstream primer, B3 1, which partially overlaps CSBII (Figure 3A). If the downstream primer does not hybridize with the RNase A-resistant RNA, or the complementary region of the RNA and primer is too short, no PCR products will be produced. However, a primer can be used to initiate reverse transcription even when the 3' region of an RNA only partially overlaps with the primer. A long LSP transcript whose 3' end extended beyond the locations of all downstream primers was used as a positive control (Figure 3B, lanes 1, 6, 11, 16 and 21). When RNA6 was used as the template, DNA could be amplified with primer B33 and primer B34, but not with other primers (Figure 3B, lanes 2, 7, 12, 17 and 22). These results indicate that RNA6 has its 3' end located somewhere within the 5' half of primer B34 or within the last few nucleotides of primer B35. Similarly, the locations of the 3' ends of RNA2 (Figure 3B, lanes 5, 10, 15, 20 and 25), RNA3 (Figure 3B, lanes 4, 9, 14, 19 and 24) and RNA5 (Figure 3B, lanes 3, 8, 13, 18 and 23) could be estimated. The results of this mapping experiment are summarized in Figure 3C. The 3' ends of the four mapped RNAs were located within a region in which the majority of mtDNA replication is thought to begin (Figure 3C, underlined). By estimating the respective sizes and the 3' end locations of these RNAs, the 5' ends of the RNA molecules map to the middle of CSBII. However, since the CSBII sequence in transcript RNA does not contain any RNase
Fig. 2. RNA-DNA hybrid formation at the human H-strand origin. (A) In vitro transcription and RNase digestion were performed with human mtRNA polymerase as described in Materials and methods. Supercoiled pBX210 was used as the DNA template. Transcription products were treated with buffer (lane 1), 50 ng RNase A (lane 2). 100 ng RNase A (lane 3), 200 of RNase A (lane 4) or 100 ng RNase A plus 0.3 U Ecoli RNase H (lane 5). Lane M, 32P-labeled HpaII fragments of pBR322 DNA. (B) Sizing of RNA-DNA hybrids formed during transcription with RNA size markers. In vitro transcription was performed on supercoiled pBX210 with human mtRNA polymerase. Transcription products were treated with buffer (lane 2) or 100 ng RNase A (lane 3). Seven long RNase A-resistant RNAs, termed RNAI-RNA7. are indicated. RNA size markers (lane 1) were generated by in vitro transcription with yeast mtRNA polymerase (10 ng mtTFB plus 10 ng core mtRNA polymerase) in the presence of a low concentration of CTP (0.25 gM) using supercoiled ori5-containing pHS40 as the DNA template. When transcription would incorporate CMP, a portion of transcription is terminated prematurely due to scarcity of CTP to produce a certain length of RNA. The size of each RNA size marker is labeled in nucleotides. Lane M, 32P-labeled HpaII fragments of pBR322 DNA.
A-cleavable pyrimidines, the estimated 5' end locations of these RNA species may result from a cleavage of the RNA molecules in the middle of CSBII by a nuclease present in the partially purified mtRNA polymerase. This assignment might also be due to unexpected mobility properties of these RNA molecules in a denaturing polyacrylamide gel. Otherwise, the 5' ends of these RNAs would be mapped to the 5' end of the CSBII element, as occurs in the yeast mitochondrial origins. The boundaries of the shorter RNA-DNA hybrids (Figure 2A) were not mapped. In conclusion, RNA-DNA hybrid formation at the human mitochondrial H-strand origin starts at CSBII during transcription and the four major RNA-DNA hybrids detected have their 3' boundaries located at CSBI and within a ~30 bp region immediately downstream, coincident with the mapped position of initiating H-strand mtDNA replication in vivo (Tapper and Clayton, 1981; Chang and Clayton, 1985).
3137
:G AG
B.Xu and D.A.Clayton
- 7
-'-U']
-, TAGS
5
1 AAA1 A0 '.r A AAG'A1,AAAAT
AA
ITTGTTTTT GGGGTTTGGC AGAGAiJ T t Au'rCC
GGGGGGC
AGA!
T' -T5GATr TT(A.. iJTT 1UCA: (TAA
5>1 _ B3 __3 B. C A FTCAATT; Tfr ATIATTATGT CCTACAAGCA UAAAAT 5A(.ACAL-' rAGAZ
B36
jjiAACM f.;GCAY
-_37
-
'A ATAT'QAACC TAGGl
CCGAT AAAT-ATA't iGA(
I
a
'S
'
a.. -:
;e _
~~~~~flj
prnm
B
ri rr
F33
1
1
2
or
1
mer
1
4
1
1
35primner
1 2:'
7-rlmer-
F336
Ji ds(.'
25
R-3
h:- NA.
A ..,.h-'T Al- I'CCFACAAGCATTAATTA;A-.i
e
rlis ni iNA D vN
Fig. 3. Mapping the 3' boundaries of RNA-DNA hybrids formed during transcription at the human mitochondrial H-strand origin. (A) Alignment of PCR primers with the DNA sequence of the human H-strand origin. The locations and directions (5'-3') of PCR primers, B31, B33, B34, B35, B36 and B37, are shown by long arrows on the top of the sequence. Three conserved sequence blocks, CSBI, CSBII and CSBIII, are shaded. The right-angled arrow represents the transcription initiation site of the LSP. (B) The 3' boundaries of four RNA-DNA hybrids were mapped by reverse transcription-PCR (RT-PCR). RT-PCR was performed with one of the downstream primers (B33-B37) as indicated in the figure and the common upstream primer B31. The RNA templates were control RNA (lanes 1, 6, 11, 16 and 21), RNA6 (lanes 2, 7, 12, 17 and 22), RNA5 (lanes 3, 8, 13, 18 and 23), RNA3 (lanes 4, 9, 14, 19 and 24) and RNA2 (lanes 5, 10, 15, 20 and 25). The control RNA was generated with human mtRNA polymerase using EcoRI-digested pBX210 as the DNA template. RNA2, RNA3, RNA5 and RNA6 were the RNA strands in four RNA-DNA hybrids formed during transcription at the human H-strand origin, as indicated in Figure 2B. Lane M, 32P-labeled HpaII fragments of pBR322 DNA. (C) Summary of RNA-DNA hybrid mapping data. The sequence includes human CSBI (shaded) and its downstream region. The bar under the sequence represents the locations of the 3' boundaries of RNA-DNA hybrids. The bars above the sequence represent the 5' ends of '7S' DNAs according to Tapper and Clayton (1981) and Chang and Clayton (1985).
Sequence requirements of RNA-DNA hybrid formation at the human H-strand origin Similar to the case of yeast, CSBII is necessary for stable RNA-DNA hybrid formation during transcription at the human H-strand origin. When the human CSBII element was deleted, RNA-DNA hybrid formation was abolished (Figure 4A). The importance of CSBII in hybrid formation
3138
was confirmed by direct base-pair substitutions. Human CSBII consists of two guanosine stretches which are separated by one adenosine. This human CSBH sequence was changed by replacement of all six nucleotides of the first guanosine stretch (Figure 4B, pBX301) or the first six nucleotides of the second nine-guanosine stretch with six thymidines (Figure 4B, pBX302). The efficiencies of
RNA-DNA hybrid formation at a mitochondrial origin
C
B
A
CSBIII
WT
RNase A RNase H
\CSBII AC'SBIII
m ml-I r - + + - + + - - + - - +
- ---
WT
pBX30 pBX302
r-r ----i r--l -_-
-
m
..I
MUTANT
WT
m
+
-
m
*M
_0 _I
ow
4.
4
l
2I
Ml 2 3 4 5 6 Ml 2 3 4 5 6 7 8 9 CSBII GGGGGGAGGGGGGGGG CSBIII TGTTTTTCGGGGTTTGGCA
M 1 2 3 4 5 6 7 8 9 WT CSBII
GGGGGGAGGGGGGGGG pBX301 CSBII TTTTTTAGGGGGGGGG pBx302 CSBII GGGGGGATTTTTTGGG
WT CSBIII TGTTTTGGGGTTTGGCA CSBII MUTANT TGTTTAArTFFTTTGGCA
Fig. 4. Efficient RNA-DNA hybrid formation depends on CSBII and CSBIII. (A) Supercoiled pBX210 DNA containing a wild-type human mitochondrial H-strand origin (lanes 1-3), its CSBII deletion derivative (pBX203, lanes 4-6) and its CSBIII deletion derivative (pBX211, lanes 7-9) were used as in vitro transcription templates. (B) Supercoiled pBX210 DNA (WT) and its two CSBII mutation derivatives (pBX301 and pBX302) were used as in vitro transcfiption templates. (C) Supercoiled pBX210 DNA (WT, lanes 1-3) and its CSBIII mutation derivative (pBX218, lanes 4-6) were used as in vitro transcription templates. Transcription products were treated with buffer, 100 ng RNase A or 100 ng RNase A plus 0.3 U Ecoli RNase H. Lane M, 32P-labeled HpaII fragments of pBR322 DNA.
hybrid formation at these two mutated templates were -2and -16-fold lower, respectively, than that at the wildtype OH template (Figure 4B). In contrast to the yeast mitochondrial origin used in our previous studies (Xu and Clayton, 1995), the mammalian H-strand origin contains an additional conserved sequence block, CSBIII. We either deleted CSBIII entirely or mutated a 6 bp cluster within CSBIII to investigate the role of CSBIII in RNA-DNA hybrid formation (Figure 4A and C). The deletion of CSBIII did not diminish RNA-DNA hybrid formation and indeed almost doubled the efficiency of hybrid formation, although some species of RNA-DNA hybrids became shorter (Figure 4A). Interestingly, when the sequence of CSBIII was changed, the efficiency of RNA-DNA hybrid formation decreased ~8-fold (Figure 4C, compare lanes 2 and 5). However, this CSBIII mutation did not change the lengths of RNADNA hybrids formed during transcription (Figure 4C). These results indicate that the fundamental mechanism of RNA-DNA hybrid formation at a mitochondrial replication origin is similar between yeast and humans with regard to the requirement of CSBII. However, human hybrid formation is more complicated and the RNA sequence upstream of the RNA-DNA hybrid region, especially CSBIII, may be involved in the regulation of hybrid formation efficiency. However, not all conserved flanking sequences are critical, as several point mutations in CSBI have no significant effect on hybrid formation (data not shown). There is additional evidence to implicate the RNA sequence 5' to the hybrid as important for RNA-DNA hybrid formation at the human mitochondrial H-strand origin. At a yeast mitochondrial origin the RNA sequence upstream of the CSBII block is not important for RNADNA hybrid formation during transcription, but the efficiency of hybrid formation showed an inverse relationship
with the length of the RNA region 5' to the CSBII block (Xu and Clayton, 1995). Previously we proposed that rapid removal of this upstream RNA would increase the efficiency of RNA-DNA hybrid formation. This prediction is confirmed in the yeast system (Figure 5A). In this experiment, we used an ori5 derivative template with a 72-bp distance between transcription initiation site and CSBII. With this template only a small amount of RNADNA hybrid formation could be detected, presumably due to the long distance between the transcription initiation site and CSBII (Figure SA, lane 2). When RNase A was added at the beginning of transcription to remove rapidly the RNA 5' to CSBII, the efficiency of RNA-DNA hybrid formation was increased (Figure SA, lane 5). In contrast, when RNase A was added to human mitochondrial transcription reactions, RNA-DNA hybrid formation was abolished (Figure SB), suggesting a role of the upstream RNA in the formation or stabilization of RNA-DNA hybrids at the human H-strand origin.
Discussion Leading-strand mtDNA replication is primed by mtRNA polymerase (for a review, see Schmitt and Clayton, 1993). However, precisely how mtRNA polymerase-derived transcripts prime mtDNA replication remains unclear. Previously we demonstrated that there is stable and persistent RNA-DNA hybrid formation during transcription at yeast mitochondrial origins and that this hybrid formation is dependent on the CSBII element (Xu and Clayton, 1995), which is the most conserved sequence among known and
putative mitochondrial origins. On the basis of these observations, we hypothesized that the RNA-DNA hybrids formed during transcription serve as RNA primers to initiate mtDNA replication after an RNA processing event. Unfortunately, we were not able to demonstrate a
3139
B.Xu and D.A.Clayton
used to demonstrate RNA-DNA hybrid formation (Xu and Clayton, 1995), are not required for propagation of these severely defective p- mitochondrial genomes, although these ori sequences show striking similarity to vertebrate mitochondrial H-strand origins in structure. It is likely that ori sequences are the primary replication origins and are required for maintenance of wild-type yeast mitochondrial genomes, but when this primary mechanism is disabled, yeast can use a bypass pathway
Fig. 5. The RNA sequence upstream of CSBII is required for hybrid formation at the human mitochondrial H-strand origin. (A) In vitro transcription was performed as described in Materials and methods except that human mtRNA polymerase and h-mtTFA were replaced with yeast mtRNA polymerase (30 ng core mtRNA polymerase and 30 ng mtTFB). AvaIl-digested pO5-72 was used as the template at a concentration of 2 ,ug/ml. Transcription reactions were run in the absence (lanes 1-3) or in the presence of (lanes 4-6) 150 ng of RNase A. Transcription products were treated with buffer (lanes I and 4), 100 ng RNase A (lanes 2 and 5) or 100 ng RNase A plus 0.3 U Ecoli RNase H (lanes 3 and 6). (B) In vitro transcription was performed as described in Materials and methods using supercoiled pBX210 as the template at a concentration of 4 tg/ml. Transcription reactions were run in the absence (lanes 1-3) or in the presence of 150 ng RNase A (lanes 4-6). Transcription products were treated with buffer (lanes 1 and 4), 100 of RNase A (lanes 2 and 5) or 100 ng RNase A plus 0.3 U Ecoli RNase H (lanes 3 and 6). Lane M, 32P-labeled HpaII fragments of pBR322 DNA.
physiological role for this interesting in vitro finding for several reasons. First, mtDNA replication initiation sites in yeast have not been fully established. One report showed by 51 nuclease mapping that RNA to DNA transition sites were located immediately upstream of CSBII (Baldacci et al., 1984). If this is correct, yeast mtDNA replication would be primed by a very short RNA primer at two of the four most likely yeast mitochondrial origins (ori3 and oriS, where CSBII is only 4 bp downstream of the transcription initiation site). We were unable to reproduce these results, and instead found many S1 nuclease-hypersensitive sites around CSBII (B.Xu and D.A.Clayton, unpublished observations). Second, mtDNA replication in yeast may involve multiple mechanisms. For example, a mitochondrial genome which is exclusively composed of A+T can be maintained in yeast (Fangman et al., 1989). Therefore the yeast ori sequences, which we
3140
to propagate p- genomes. In contrast, vertebrate mtDNAs contain well-defined replication origins. Replication start sites have been mapped accurately at the mouse mitochondrial OH (Gillum and Clayton, 1979; Chang et al., 1985). Some mouse nascent mtDNAs contain RNA at their 5' ends and the RNA to DNA transition sites most likely define the bona fide replication initiation sites. The majority of the replication start sites falls within or immediately downstream of CSBI (Gillum and Clayton, 1979; Chang et al., 1985). The 5' ends of human mtDNAs have also been mapped (Tapper and Clayton, 1981; Chang and Clayton, 1985). In this case, most DNA 5' ends map immediately downstream of CSBI (see Figure 3C). It is not clear if these 5' ends represent the exact start sites of H-strand replication since human nascent DNA strands do not have detectable ribonucleotides at their 5' termini (Chang and Clayton, 1985). It is possible that a robust primer-removing activity is present in human mitochondria and this activity not only removes RNA primers efficiently, but also degrades the nascent DNA molecules to a limited extent. In this study we used the defined human OH to further document RNA-DNA hybrid formation at mitochondrial origins. We showed that there is stable RNA-DNA hybrid formation during in vitro transcription with human mtRNA polymerase at the human OH. As is the case in yeast, this hybrid formation depends on the highly conserved CSBII element. In addition, the 3' boundaries of major RNADNA hybrids formed at the human OH were mapped to the major mtDNA replication start sites. This observation provides the first evidence in support of the hypothesis that mammalian mtRNA polymerase may facilitate mtDNA replication through the formation of an RNA-DNA hybrid intermediate. Besides the large RNA-DNA hybrids whose 3' ends were mapped to the major mtDNA replication start sites, some shorter hybrids were formed during in vitro transcription (Figure 2). The 3' ends of these shorter hybrids have not been mapped. If we assume that these short hybrids also have their 5' ends located at CSBII, their 3' ends should be between CSBI and CSBII. Since minor mtDNA replication start sites have been mapped between CSBI and CSBII (Chang and Clayton, 1985; Chang et al., 1985), it is possible that these shorter hybrids are utilized in primer formation. This study not only extends our previous finding of site-specific hybrid formation at yeast mitochondrial origins and provides strong evidence to support the physiological significance of the finding, but also results in a new observation which may point to the future research directions in the mtDNA replication field. In contrast to the case in yeast, human mtRNA sequence upstream of the hybrid region is also important for efficient RNA-
RNA-DNA hybrid formation at a mitochondrial origin
DNA hybrid formation, especially the conserved CSBIII element which is absent from the putative yeast mitochondrial origins (Figures 4C and 5). However, the exact role of CSBIII, in the form of DNA, RNA or both, is not known. Since there is no absolute requirement for CSBIII, it seems reasonable to consider it as a modulating element in RNA-DNA hybrid formation. In this context, complete removal of CSBIII permits RNA-DNA hybrid formation in a manner similar to the natural situation in yeast. However, mutations within CSBIII may exhibit a dominant negative effect due to improper interaction at the RNARNA or RNA-DNA level. For example, based on primary sequence, there is significant opportunity for RNA base pairing between CSBIII and CSBII, and studies of the fine structure of nucleic acids from this region of mtDNA may reveal such interactions. Results with this human leading-strand origin can be compared with those with the bacterial ColEl origin. In a ColE1 origin, a 555-nucleotide RNA with a complex structure interacts with its DNA template through a very short stretch of rG-dC pairing and subsequently promotes persistent RNA-DNA hybrid formation in a downstream region. The RNA-DNA hybrid is cleaved by RNase H and provides a primer to initiate ColE1 replication (Masukata and Tomizawa, 1990). The replication of the ColEl plasmid is regulated by a small RNA molecule of 108 nucleotides (reviewed by Polisky, 1988). The regulatory RNA, termed RNA I, is complementary to the 5' terminal region of the primer RNA. RNA I inhibits ColE1 plasmid replication by interacting with the primer RNA to prevent RNA-DNA hybrid formation at the origin (Lacatena and Cesareni, 1981; Masukata and Tomizawa, 1984). The similarity between mammalian mtDNA and ColEl DNA replication mechanisms makes it attractive to consider whether antisense RNA regulatory circuitry is also employed to regulate mtDNA replication. It is not clear what determines the downstream boundary of a RNA-DNA hybrid formed at a mitochondrial origin. Limited mutational analysis indicated that the CSBI element is not likely involved in this process (data not shown). However, at least three possible mechanisms can be considered for termination of hybrid formation within or downstream of CSBI. (i) An intrinsic nuclease activity present in the partially purified human mtRNA polymerase processes an RNA-DNA hybrid in a site-specific fashion. (ii) When an RNA synthesized by an ongoing transcription apparatus associates with its DNA template to form a hybrid, transcription can cease at a specific site to generate a transcript whose 3' end also defines the downstream boundary of the RNA-DNA hybrid. (iii) An extended RNA-DNA hybrid is produced during transcription, but the hybrid downstream of CSBI is not stable and dissociates from the DNA template when mtRNA polymerase eventually exits the template, thereby leading to degradation or processing of the portion downstream of CSBI. In the case of transcription termination, the termination event might be specific to RNA-DNA hybrids and independent of trans-acting factors. The only currently defined mitochondrial transcription termination factor, mtTERM, does not mediate transcription termination at CSBI in vitro (Christianson and Clayton, 1988). Two nucleases, RNase MRP (Chang and Clayton, 1987) and endonuclease G (Cote and Ruiz-Carrillo, 1993), have been proposed to
play a role in the processing of mtRNA primers. However, it is not yet clear whether the DNase endonuclease G also processes RNA in any specific manner or if it has RNase H-like capacity (Clayton, 1994; Gerschenson et al., 1995). Further work with appropriate additional activities should help reveal the next important steps in initiating mtDNA replication.
Materials and methods Enzymes and plasmids Purified recombinant human mtTFA was provided by D.J.Dairaghi of our laboratory (Dairaghi et al., 1995). Plasmid L5'A-70 contains the human mitochondrial H-strand replication origin (Chang and Clayton, 1984). Yeast ori5-containing pHS40 and its derivative pO5-72 were described previously (Xu and Clayton, 1995).
Preparation of RNase H-free human mtRNA polymerase A typical purification scheme used 10 1 of KB cell culture at late exponential growth stage. Mitochondria were isolated from KB cells and purified on a sucrose gradient as described (Bogenhagen and Clayton, 1974). Mitochondria were pelleted by centrifugation and resuspended in 9 ml of 2x buffer F. Buffer F contained 25 mM HEPES-KOH pH 7.4, 10% glycerol (v/v), I mM dithiothreitol (DTT), I mM EDTA, 2 mM benzamidine, 1 mM PMSF, 2 ,ug/ml pepstatin A and 2 .g/ml leupeptin. The volume of mitochondrial suspension was brought up to 14.85 ml with ice-cold water. The diluted mitochondrial suspension was homogenized in a glass Dounce homogenizer after 0.45 ml of 20% (v/v) Triton X- 100 was added. Then 2.7 ml of 2 M KCI was added to a final concentration of 0.3 M and homogenization was repeated to extract protein. The mitochondrial lysate was centrifuged at 130 000 g for 60 min to obtain mitochondrial S- 130 extract. Typically, - 140 mg of mitochondrial protein was obtained from 10 1 of KB cell culture. The S-130 extract was diluted with buffer F to -5 mg/ml protein and its salt concentration was adjusted to 0.35 M. This mitochondrial extract was loaded onto a 12-ml Bio-Rex 70 column (l.5X6.8 cm) which was equilibrated in buffer F plus 0.35 M KCI. After the column was washed extensively with buffer F containing 0.35 M KCI, the bound proteins were eluted with an 80-ml linear KCI gradient from 0.35 M to 0.8 M in buffer F. Human mtRNA polymerase was eluted around 0.48 M KCI. The peak fractions of mtRNA polymerase were pooled, dialyzed in the enzyme storage buffer [10 mM Tris-HCI pH 7.9, 50% (v/v) glycerol, 1 mM DTT, 0.1 mM EDTA, 100 mM KCI, I mM benzamidine, 1 ,ug/ml pepstatin A and I gg/ml leupeptin], and stored at -20°C.
Determination of RNase H activity The RNA-DNA hybrid substrate for assay of RNase H activity was synthesized in a 100-gl reaction mixture which contained 40 mM TrisHCI pH 7.9, 10 mM MgClI, 0.1 mM EDTA, 150 mM KCI, 0.1 mM DTT, 0.5 mg/ml bovine serum albumin, 150 IIM each of ATP, CTP and GTP, 20 jM [a-32P]UTP (40 Ci/mmol), 10 U Ecoli RNA polymerase (United States Biochemical Corp.) and 4 jg single-stranded Ml3mpl9 DNA. The reaction was performed at 37°C for 60 min and then terminated by extraction with an equal volume of phenol:chloroform (1:1). The unincorporated radioactive nucleotides were removed using a Sephadex G-50 spin column. RNase H activities in the Bio-Rex 70 fractions were measured in a 25-pl reaction mixture containing 10 mM Tris-HCI pH 7.9, 10 mM MgCl2, 1 mM DTT, 100 gg/ml BSA, 2 jul fraction and 10 ng 32P-labeled M13mpl9 hybrid substrate. Incubations were at 30°C for 30 min, after which nucleic acids were precipitated in 2 ml of ice-cold 5% (w/v) trichloroacetic acid-50 mM sodium pyrophosphate solution and filtered through Whatmann GF/B paper; radioactivity on the paper was assayed by liquid scintillation spectroscopy. The RNase activity was expressed as a percentage of radioactivity which became acid-soluble after incubation. In vitro transcription assay A 25-,l transcription reaction mixture contained 10 mM Tris-HCI pH 7.9, 10 mM MgCl2, I mM DTT, 100 jg/mI RNase-free bovine serum albumin, 100 jM ATP, 100 jM CTP, 100 jM GTP, I jiM [a-32P]UTP (240 Ci/mmol), 2 jig/ml EcoRI-linearized L5'A-70, 3 jul of dialyzed fraction and 2S ng of h-mtTFA. After incubation at 25°C for 30 min, the reaction was terminated by extraction with an equal volume of phenol:chloroform (1: 1). The transcription products were precipitated
3141
B.Xu and D.A.Clayton Table I. DNA oligonucleotides used in this study Name
Sequence (5'-*3')
Use
B20 B25 B31
ATTTGGCCAG AAGCTTTGGT GGAAATTTTT TGTT CTGGTGTTAG GGTTCTTGAG ATGTGMAA GTGC GGTTTGGTGG AAATTTTTTG AATAATAACA ATTGAATGTC TTAATGCTTG TAGGACAT TACTAAAGTG TGTTAATTAA ATATTACAGG CGAACATACT TTATCGCACC TACGTTCA TGTTAGGGTT CTTTGTTTAA TTTTTTTGGC GAGATGTGT TT AATTGGCCAG AAGCTrTTTT AGGGGGGGGG TFTGGTGGAA AATTGGCCAG AAGCGGGGGG ATTT'lTTGGG TTGGTGGA AATTTTTT
delete CSBII to construct pBX203 delete CSBIII to construct pBX211 map locations of RNA-DNA hybrids map locations of RNA-DNA hybrids map locations of RNA-DNA hybrids map locations of RNA-DNA hybrids map locations of RNA-DNA hybrids map locations of RNA-DNA hybrids mutate CSBIII to construct pBX218 mutate CSBII to construct pBX301 mutate CSBIII to construct pBX302
B33 B34 B35 B36 B37 B44 B57 B58
with ethanol in the presence of 5 jg Ecoli tRNA, dissolved in 7 jl of formamide loading buffer (80% formamide, 0.2 mg/ml xylene cyanol FF, 0.2 mg/ml bromophenol blue and 10 mM EDTA pH 8.0), and separated on a 6% polyacrylamide-7 M urea gel.
Detection of RNA-DNA hybrid formation DNA templates used in transcription reactions were purified with two successive CsCl gradients. A typical 75-ji transcription reaction mixture contained 10 mM Tris-HCI pH 7.9, 10 mM MgCl2, 1 mM DTT, 100 jg/ml BSA, 0.5 mM ATP, 0.1 mM CTP, 0.1 mM GTP, 2 ,uM [a-32P]UTP (120 Ci/mmol), 300 ng supercoiled DNA template, 2.2 jg human mtRNA polymerase (Bio-Rex 70 fractions) and 90 ng h-mtTFA. Incubations were at 30°C for 20 min, after which the reactions were transferred to ice and 2 M KCI was added to a final concentration of 150 mM to terminate transcription. A 25-pl aliquot of this mixture was transferred into a microfuge tube containing either buffer (2 ,ul), 100 ng of RNase A (2 ,l) or 100 ng of RNase A plus 0.3 U Ecoli RNase H (2 j.), respectively. The tubes were vortexed briefly to mix their contents and incubated at 30°C for 5 min. Subsequently, RNase digestion was terminated by the addition of 75 ,ul of protein K mixture (0.33 mg proteinase K per ml, 0.67% SDS, 13.3 mM EDTA) and incubation at 37°C for 30 min. After proteinase K digestion, the mixture was extracted once with an equal volume of phenol:chloroform (1:1). Transcription products were precipitated with 10 ,ug glycogen, 2 M ammonium acetate and 2 vol of ethanol. Products were dissolved in 7 jil of formamide loading buffer and analyzed on 8% polyacrylamide-7 M urea gels that were exposed to X-ray films at -70°C. The films were scanned with a Molecular Dynamics 300A densitometer (Sunnyvale, CA) to quantify amounts of RNA-DNA hybrids.
Mapping the locations of RNA-DNA hybrids In vitro transcription and RNase A digestion were performed as described above. RNA-DNA hybrids formed during transcription in four 100-jl reactions were separated on 8% polyacrylamide-7 M urea gels. The individual RNA strands of RNA-DNA hybrids were eluted from the gel separately as described (Stohl and Clayton, 1992). The eluted RNAs were purified one more time with a further 8% polyacrylamide-7 M urea gel. The purified RNAs were dissolved in 15 jl of water and stored at -800C. The approximate locations of the 3' ends of these purified RNAs were determined by reverse transcription-polymerase chain reaction (RTPCR). 1 gl of a purified RNA was mixed with 20 pmol of one of five downstream PCR primers (oligo B33-oligo B37 in Table I) in 16.5 jil of solution A (12.1 mM Tris-HCI pH 8.3, 1.8 mM MgCl2, 61 mM KCI and 121 ,ug/ml gelatin). The mixture was heated for 5 min at 95°C, incubated for 5 min at 42°C and then set on ice. After the addition of 40 nmol each of four deoxynucleotides, 18 U of RNase inhibitor (Pharmacia) and 100 U of M-MuLV reverse transcriptase (Gibco-BRL) in a volume of 3.5 gl, the annealed mixture was incubated at 42°C for 60 min to synthesize the cDNA strand. Reverse transcription was terminated by incubation at 95°C for 5 min. The reverse transcription products (20 gl) were transferred to a 0.5-ml microfuge tube which contained 80 ji of solution B [10 mM Tris-HCI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 100 jig/mi gelatin, 0.625 jiM 32P-labeled primer B31 (1.2X i05 c.p.m./pmol), 31 U/mi of Taq DNA polymerase]. PCR was performed in the following way: 1 cycle of 3 min at 94°C, 30 cycles of 1 min at 94°C/I min at 45°C/I min at 72°C and 1 cycle of 9 min at 72°C. PCR products were precipitated with ethanol in the presence of 20 jig of glycogen and dissolved in 5 jl of water. Subsequently, 10 jil
3142
of formamide loading buffer was added and one-third of the PCR products were analyzed on a 10% polyacrylamide-7 M urea gel.
Plasmid construction Constructs containing the human mitochondrial H-strand origin (mtOH). Plasmid L5'A-70 harbors a 483-bp, OH-containing human mtDNA fragment which is inserted at EcoRI and BamHI sites of pBR322 (Chang and Clayton, 1984). The 483-bp insert of L5'A-70 was subcloned into pBluescript II KS- at EcoRI and BamHI sites to generate pBX202. The OH in pBX202 and L5'A-70 has a CSBII version with a sequence of GGGGGGAGGGGGGGGGGGG (G6AG12). The CSBII sequence displays a polymorphism in human KB cells (Hauswirth and Clayton, 1985). Plasmid pBX210 was constructed by replacement of the CSBII sequence in pBX202 with the most common version of CSBII with a sequence of G6AG9. Deletion and mutation of CSBII. Oligonucleotide B20 (Table I) was used to delete CSBII from pBX202. The oligonucleotide B20 contains 20 bases of mtDNA sequence immediately downstream of CSBII (TTTGGTGGAAATTTTTTGTT), 11 bases of sequence immediately upstream of CSBII (TGGCCAGAAGC, the underlined sequence is an MscI restriction site) and three extra bases of ATT, but does not contain the CSBII sequence. The oligonucleotide B20 and the reverse sequencing primer were used to amplify DNA from pBX202. The PCR product was used to replace the corresponding fragment of pBX202 after digestion with MscI and EcoRI to generate pBX203 in which CSBII is deleted. In the same way oligonucleotides B57 and B58 (Table I) were used to substitute six GC pairs of CSBII with six TA pairs to generate pBX301 and pBX302 by using pBX210 as the PCR template. The sequence of human OH in the mutant constructs was verified. Mutagenesis of human OH Mutagenesis was performed on pBX210 according to Deng and Nickoloff (1992) using the Transformer SiteDirected Mutagenesis Kit (Clontech Laboratories, Inc.). The oligonucleotides B25 and B44 used in construction of pBX211 and pBX218 are listed in Table I.
Acknowledgements We thank Gerry Shadel, Alison Davis, Tim Brown, Nils-Goran Larsson, Eric Van Dyck, Jan Paluh, Dan Lee, David Garman and Jin Shang for critical reading of this manuscript, Daniel J.Dairaghi for purified recombinant h-mtTFA, and Jackie Doda for help in KB cell tissue culture. B.X. was a trainee in the graduate program of the Department of Biological Sciences, Stanford University and was supported by a predoctoral fellowship from The Rockefeller Foundation. This work was supported by grant GM-33088-25 from the National Institute of General Medical Sciences.
References Baldacci,G., Cherif-Zahar,B. and Bernardi,G. (1984) EMBO J., 3, 2115-2120. Bogenhagen,D. and Clayton,D.A. (1974) J. Biol. Chem., 249, 7991-7995. Chang,D.D. and Clayton,D.A. (1984) Cell, 36, 635-643. Chang,D.D. and Clayton,D.A. (1985) Proc. Nati Acad. Sci. USA, 82, 351-355. Chang,D.D. and Clayton,D.A. (1987) Science, 235, 1178-1184.
RNA-DNA hybrid formation at a mitochondrial origin Chan.D.D.. Hauswirth.W.W. and Clayton,D.A. (1985) EMBO J.. 4, 1559-1567. Christianson.T.W. and Clayton.D.A. (1988) Mol. Cell. Biol.. 8. 45024509. Clayton.D.A. (1982) Cell, 28. 693-705. Clayton.D.A. (1991) Annal(. Rev. Cell Biol., 7. 453-478. Clayton.D.A. (1994) Proc. Nodtl Acacld. Sci. USA, 91, 4615-4617. Cott,J. and Ruiz-Carrillo,A. (1993) Science, 261, 765-769. Dairaghi.D.J.. Shadel.G.S. and Clayton.D.A. (1995) J. Mol. Biol., 249, 11-28. Dasgupta,S., MasukataRH. and Tomizawa,J. (1987) Cell, 51. 1113-1122. Deng.W.P. and Nickoloff.J.A. (1992) Anial. Biochemn., 200, 81-88. Fangman,W.L.. Henly,J.W.. Churchill.G. and Brewer,B.J. (1989) Mol. Cell. Biol.. 9, 1917-1921. Fisher.R.P. and Clayton,D.A. (1985) J. Biol. Chem., 260. 11330-11338. Fisher,R.P. and Clayton.D.A. (1988) Mol. Cell. Biol.. 8. 3496-3509. Fuller.C.W. and Richardson,C.C. (1985) J. Biol. Clhern.. 260, 3185-3196. Gerschenson.M.. Houmiel,K.L. and Low,R.L. (1995) Nucleic Acids Res., 23. 88-97. Gillum,A.M. and Clayton,D.A. (1979) J. Mol. Biol., 135, 353-368. Greenleaf.A.L.. Kelly,J.L. and Lehman,I.R. (1986) Proc. Natl Acad. Sci. USA. 83, 3391-3394. Hauswirth,W.W. and Clayton,D.A. (1985) Nutcleic Acids Res., 13, 8093-8104. Itoh,T. and Tomizawa.J. (1980) Proc. Natl Acad. Sci. USA, 77. 24502454. Lacatena,R.M. and Cesareni,G. (1981) Nature, 294. 623-626. Lisowsky.T. and Michaelis,G. (1988) Mol. Gen. Genet., 214, 218-223. Masukata,H. and Tomizawa,J. (1984) Cell, 36, 513-522. Masukata,H. and Tomizawa,J. (1990) Cell, 62, 331-338. Parisi,M.A. and Clayton.D.A. (1991) Science, 252, 965-969. Polisky,B. (1988) Cell. 55, 929-932. Schmitt,M.E. and Clayton,D.A. (1993) Curr. Opin. Genet. Dev., 3, 769-774. Stohl,L.L. and Clayton,D.A. (1992) Mol. Cell. Biol., 12, 2561-2569. Tapper,D.P. and Clayton,D.A. (1981) J. Biol. Chiem., 256, 5109-5115. Xu,B. and Clayton,D.A. (1992) Nucleic Acids Res., 20, 1053-1059. Xu.B. and Clayton,D.A. (1995) Mol. Cell. Biol., 15, 580-589. Received on Mai, 9. 1995: revised on Decemnber 14, 1995
3143
