Runx1 binds as a dimeric complex to overlapping Runx1 sites within a ...

Runx1 binds as a dimeric complex to overlapping Runx1 sites within a palindromic element in the human GM-CSF enhancer. Sarion R. Bowers, Fernando J. Calero-Nieto, Stephanie Valeaux, Narcis Fernandez-Fuentes, and Peter N. Cockerill Supplementary methods Computational modelling and refinement of the dimeric form of Runx1-CBF-DNA ternary complex The structure of CBF bound to DNA was previously determined using the Runt domain of Runx1 plus CBF and the DNA sequence GTTGCGGTTG (1). In order to understand the structural basis and feasibility of a dimeric form of Runx1-CBF recognizing concurrently two independent DNA binding sites a structural model was generated as follows. First, a structural model of a guide BDNA containing two canonical Runx1 DNA binding sites was generated using the nucleic acid builder tool (2) included in the AmberTools 1.3 package. For this purpose we employed the 21 bp GM450 Runx1-binding sequence ATGTGTGGCTGCCCACAAAAC from the human GM-CSF enhancer. Then, using MODELLER (3), two Runx1-CBF protein units were simultaneously modelled in the context of the guide B-DNA by using the coordinates from the crystal structure of the human Runx1-CBF-DNA ternary complex (1) as a template. Sequences and templates were aligned so that DNA molecules of the template were aligned to the corresponding DNA binding sites in the guide B-DNA preserving the native Runt1-CBF-DNA interactions described in the crystal structure (1). This model incorporates Runx1 amino acids 54 to 178. The entire structural model was refined by two rounds of energy minimization and a short molecular dynamic simulation to ensure reasonable stereochemical geometry, resolve steric hindrances, and assess the stability of the complex, as follows. The energy minimization and molecular dynamic simulation was performed in AMBER 10 (4) using the ff99SB force field (5). The structural model as generated by MODELLER (3) was used as the starting conformation and it was solvated in a rectangular box of TIP3 (6) water molecules with a buffer size of 10.0 Angstroms and counter ions were added to neutralize net charges resulting in a system containing 89872 atoms of which 26843 water molecules and 35 counter ions. The energy minimization step consisted of two phases: In phase one, energy minimization consisted of 5000 steps of steepest descent followed by 2500 steps of conjugate gradient keeping a 500 kcal.mol-1 restraint force on the proteins and DNA and allowing solute molecules to freely move. In phase two, all harmonic restraint forces, with the exception of the atoms mediating the atomic interactions between DNA and proteins, were lifted and the system was further minimized by 5000 steps of steepest descent followed by 5000 steps of conjugate gradient. Subsequently, the system was heated up from 0K to 300K on 6 steps of 50K using a time step of 0.5 fsec for 50 psec, temperature-coupling constant of 1.0 psec. A decreasing restraints force was applying to the atoms that mediate protein-DNA interactions during the heating process of 50, 40, 30, 20, 10 and 5 kcal.mol-1 on the 0K-50K, 50K-100K, 100K-150K, 150K-200K, 200K-250K, 250K-300K stage respectively. Prior to production Molecular Dynamic Simulation, a further equilibration step was performed, lifting all restraints and simulating the system for 0.5 nsec at 300K and 2 fsec time steps. Finally the system was further simulated for 4 nsec. The trajectory was clustered using the average linkage clustering algorithm implemented on the ptraj program (7) in the AmberTools packege, resulting in a total of 11 clusters. A representative structure was selected from each cluster (i.e. the structure closer to the centroid of the cluster) and the stereochemical quality was assessed using PROCHECK (8) and visually inspected. The cluster with the best PROCHECK G-factor was selected as the final model presented in Supplementary Data file 1.

Two analyses of the molecular dynamic trajectory were performed to assess the stability and convergence of the simulation. First, was the Root Mean Square Deviation (RMSD) of main-chain atoms when compare with equilibrated complex along the simulation. Second, the total energy was plotted as a function of the simulation time to assess the convergence of the simulation and the stability of the complex. Supplementary data file 1 Coordinates of a theoretical dimeric CBF/DNA structure with the best PROCHECK G-score extracted from the molecular simulation (see computational modelling and refinement of the dimeric form of Runx1-CBFβ-DNA ternary complex section). This model incorporates amino acids 54 to 178 of Runx1, as in the crystal structure derived by Bravo et al. (1), the segment of CBF included in this crystal structure, and the GM-CSF enhancer DNA duplex sequence ATGTGTGGCTGCCCACAAAAC. Several features of this model are of interest: (i) the C-terminal regions of the two Runt domains interact with GG sequences on each of the two DNA strands via Runx1 arginine 174 and 177 interactions with two adjacent guanines, (ii) the C-terminal regions of Runx1 pass on opposite sides of the DNA helix, meaning that the full Runx1 dimeric complex is likely to encircle the DNA, (iii) the two CBF molecules are closely aligned in an anti-parallel arrangement involving close complementary ionic interactions, and (iv) the Runx1 arginine 178 at the C-terminus of each Runt domain is in close proximity to the binding site of the opposing Runt domain on the opposite DNA strand. It is possible that this close interaction of arginine 178 is responsible for the DMS hyper-reactivity of the guanine present at position 451 in the GM-CSF enhancer in the dimeric complex seen in figure 1B. Arginine 178 and guanine 451 are at atomic interaction distance that involves the guanidinium group of arginine 178 being positioned approximately 2 to 3 Å from the phosphate and deoxyribose groups attached to guanine 178. Supplementary references 1.

2. 3. 4.

5.

6.

7.

8.

Bravo, J., Li, Z., Speck, N.A. and Warren, A.J. (2001) The leukemia-associated AML1 (Runx1)--CBF beta complex functions as a DNA-induced molecular clamp. Nat Struct Biol, 8, 371-378. Macke, T.J. and Case, D.A. (1998) Modeling unusual nucleic acid structures. American Chemistry Society, Washington DC. Sali, A. and Blundell, T.L. (1993) Comparative protein modelling by satisfaction of spatial restraints. J.Mol.Biol., 234, 779. Case, D.A., Darden, T.E., Cheatham, T.E., III, Simmerling, C., Wang, J., Duke, R.E., Luo, R., Crowley, M., Ross, C., Walker, W. et al. (2008) AMBER 10. University of California, San Francisco. Hornak, V., Abel, R., Okur, A., Strockbine, B., Roitberg, A. and Simmerling, C. (2006) Comparison of multiple Amber force fields and development of improved protein backbone parameters. Proteins, 65, 712-725. Jorgensen, W.L., Chandrasekhar, J., Madura, J.D., Impey, R.W. and Klein, M.L. (1983) Comparison of simple potential functions for simulating liquid water. The Journal of Chemical Physics, 79, 926-935. Shao, J., Tanner, S.W., Thompson, N. and Cheatham, T.E. (2007) Clustering Molecular Dynamics Trajectories: 1. Characterizing the Performance of Different Clustering Algorithms. Journal of Chemical Theory and Computation, 3, 2312-2334. Laskowski, R.A., Rullmannn, J.A., MacArthur, M.W., Kaptein, R. and Thornton, J.M. (1996) AQUA and PROCHECK-NMR: programs for checking the quality of protein structures solved by NMR. J Biomol NMR, 8, 477-486.