SCAP ligands are potent new lipid-lowering drugs - Nature

© 2001 Nature Publishing Group http://medicine.nature.com

ARTICLES

SCAP ligands are potent new lipid-lowering drugs


THIERRY GRAND-PERRET, ANNE BOUILLOT, AURÉLIE PERROT, STÉPHANE COMMANS, MAX WALKER & MARC ISSANDOU GlaxoSmithKline, 91951 Les Ulis cedex, France Correspondence should be addressed to T.G.-P.; email: [email protected]

Upregulation of low-density lipoprotein receptor (LDLr) is a key mechanism to control elevated plasma LDL-cholesterol levels. Here we identify a new class of compounds that directly binds to the sterol regulatory element-binding protein (SREBP) cleavage-activating protein (SCAP). We show that a 14C-labeled, photo-activatable analog specifically labeled both SCAP and a truncated form of SCAP containing the sterol-sensing domain. When administered to hyperlipidemic hamsters, SCAP ligands reduced both LDL cholesterol and triglycerides levels by up to 80% with a three-fold increase in LDLr mRNA in the livers. Using human hepatoma cells, we show that these compounds act through the sterol-responsive element of the LDLr promoter and activate the SCAP/SREBP pathway, leading to increased LDLr expression and activity, even in presence of excess of sterols. These findings have led to the identification of a class of compounds that represent a promising new class of hypolipidemic drugs.

Plasma levels of low-density lipoprotein (LDL) cholesterol are considered as a major risk factor for the development of cardiovascular diseases as indicated in the current clinical guidelines1,2. The LDL receptor (LDLr) is the key component in the maintenance of cholesterol homeostasis in the body, playing a pivotal role by regulating the catabolism of LDL (ref. 3). Expression of LDLr is predominantly controlling at the level of transcription through a cholesterol- or oxysterol-mediated repression4. This regulation involves a family of membranebound transcription factors called sterol regulatory element-binding proteins (SREBPs)5,6. A sterol-responsive element (SRE) has been identified in the LDLr promoter7 as well as in the promoters of other genes involved in neutral lipid metabolism8–10. Sterol-independent regulation of LDLr has also been demonstrated using several growth factors and hormones3,11, but only oncostatin M has clearly shown a direct effect at the transcriptional level12. GW compounds specifically activate LDLr promoter To find compounds capable of upregulating the expression of LDLr, we established a stable HepG2 cell line transfected with a vector containing the human LDLr promoter coupled to the firefly luciferase reporter gene. Using the increase in luciferase activity as an assay, we identified two series of transcriptional activators (Fig. 1) and optimized them for potency, metabolic stability and pharmacokinetics. The steroid-like analog GW707 (Fig. 1a) and the non-steroidal molecules GW300 (Fig. 1c), GW532 (Fig. 1d) and GW575 (Fig. 1e) each induced a dose-dependent increase in luciferase activity in cells transfected with LDLr promoter. For each series, we identified close inactive analogs such as GW706 for the steroidal series (Fig. 1b) and GW570 for the non-steroidal series (Fig. 1f). The incubation was performed in the presence of 10% serum as a physiological source of exogenous lipids in order to mimic in vivo conditions. We assessed the specificity of this effect for the LDLr promoter using two promoter–reporter constructs. Both the promoter of the hepatic apolipoprotein A1 coupled to firefly luciferase and 1332

the thymidine kinase promoter coupled to Renilla luciferase were not affected by any of the compounds (Fig. 1). Based on the absence of effect of the compounds on the pRL-TK construct used to verify the transfection efficiency, we co-transfected cells with LDLr-promoter–containing plasmid and pRL-TK and calculated the firefly:Renilla ratio. Activation of LDLr promoter occurs through SRE To determine if sterols interfere with the action of these compounds, we loaded HepG2 cells with sterols either by pre-incubation with human LDL or incubation with the soluble cholesterol analog 25-hydroxycholesterol. The basal LDLr promoter activity was reduced to less than one-third of control. In such conditions, the active analog GW300 (Fig. 2a and b) but not the inactive analog GW570 (Fig. 2c and d) induced a dosedependent increase in reporter-gene expression. At 500 nM GW300, we observed at least a 4-fold increase in reporter activity with or without exogenous sterols. This indicates that these compounds can activate the LDLr promoter even in the presence of a high dose of a sterol that acts as a repressor of LDLr expression. To identify regions of the promoter responsive to the compounds, we compared several constructs with 5′-truncations of the LDLr promoter. HepG2 cells were transiently transfected with constructs containing promoter regions ranging from 588 base-pairs (bp) (LDLp-588luc) to 31 bp (LDLp-31luc) upstream of the main transcription initiation site. The luciferase activity under control conditions decreased with successive deletions in the LDLr promoter as estimated by the firefly:Renilla ratio (Fig. 2e). The capacity of GW532 to activate transcription was clearly correlated with the presence of the SRE (LDLp-70luc versus LDLp-53luc). In addition, four copies of an SRE upstream of a minimal promoter containing 38 bp of adenovirus major late promoter13 (p4SRE-MLPluc) was sufficient to confer responsiveness to GW532 compared with the minimal construct pMLPluc. Together, these results point to a major role of the SRE in the capacity of the cell to respond to GW532. NATURE MEDICINE • VOLUME 7 • NUMBER 12 • DECEMBER 2001



ARTICLES

a

b

c

d

e

f

Induction of a functional LDL receptor To confirm that promoter activation translates into induction of a functional LDLr, we set up an LDL-uptake assay in various cell types. We treated HepG2 cells with GW532 or 25-hydroxycholesterol for 20 h, followed by a further 4 h incubation with LDL labeled with the fluorescent dye 3,3′-dioctadecylindocarbocyanine (DiI-LDL). The amount of fluorescent dye that accumulates in the lysosomes reflects the cell-surface LDLr activity. Fig. 3 shows that the fluorescence was reduced when cells were incubated with 25-hydroxycholesterol (Fig. 3c versus 3a), thus confirming the repression of the LDLr expression. However, GW532 treatment (Fig. 3b) led to an increase in the intensity of fluorescence when compared with untreated cells, thus indicat-

a Fig. 2 GW compounds activate LDL receptor expression in the presence of sterols. a–d, HepG2 cells were co-transfected with LDLp588luc and pRL-TK and treated with GW300 (a and b) or GW570 (c and d), in absence () or presence of 25-hydroxycholesterol (b and d) at 0.2 µM () or 0.8 µM () or after lipid loading of the cells by incubation with human LDL added 6 h before GW compounds (a and c) at 100 µg/ml () or 400 µg/ml (). Results are expressed as percent of control and represent mean ± s.d. of triplicates. e, HepG2 cells were co-transfected with control plasmid pRLTK together with one of the LDLr promotercontaining constructs (LDLp-Xluc) or the minimal promoter (p-MLPluc) or with 4 SREs inserted in p-MLPluc (p4SRE-MLPluc). Cells were further incubated for 24 h with or without GW532 (1 µM). For each construct, the firefly:Renilla ratio was calculated under control conditions or with GW532. Fold induction by GW532 was calculated for each construct by dividing this ratio in the presence versus absence of GW532 and results represent mean ± s.d. of triplicates.

Fig. 1 Comparative activity of compounds to activate LDL receptor expression. a–f, Molecular diagrams and luciferase activity assay for the steroidlike analog GW707 (a), the non-steroidal molecules GW300 (c), GW532 (d) and GW575 (e) (*indicates the position of the 14 C-labeled carbon), and the close inactive analogs: the steroidal GW706 (b) and non-steroidal GW570 (f). HepG2 cells were co-transfected with LDLp588luc () or with ApoA1-luc () and pRL-TK () and further treated for 24 h with the respective compounds. Results are expressed as percent of control and represent mean ± s.d. of triplicates. The relative luminescent units (RLU) under basal conditions were respectively 60115 for LDLp-588luc, 10380 for pRLTK, 2860 for ApoA1-luc and < 20 for mock-transfected cells.

ing an increase in LDLr activity. Quantification of individual cell fluorescence was performed by FACS analysis on primary human (Fig. 3e) and monkey hepatocytes (Fig. 3d and f) treated in the same manner as the HepG2 cells. In both cell types, GW300 and GW707 significantly increased the mean fluorescence in the cells whereas it was reduced upon treatment with 25-hydroxy-cholesterol. The uptake of Dil-LDL in both control and GW300-treated conditions was clearly mediated by LDLr, as dilution of Dil-LDL by a 50-fold excess of non-labeled LDL reduced the fluorescence to background levels (Fig. 3f). GW compounds bind to SCAP and activate SREBP Control of gene expression by cholesterol involves the mem-

b

c

d

e

NATURE MEDICINE • VOLUME 7 • NUMBER 12 • DECEMBER 2001

1333



ARTICLES Fig. 3 SCAP ligands induce expression of a functional LDL receptor. a–c, GW532 increases the uptake of Dil-LDL in HepG2 cells. HepG2 cells were treated with vehicle (a), 0.5 µM GW532 (b) or 10 µM 25-hydroxycholesterol (c). In each panel, the perimeter of one cell is outlined in green. d–f, GW300 and GW707 increase the uptake of Dil-LDL in primary hepatocytes. Primary cynomolgus hepatocytes (d and f) or primary human hepatocytes (e) were treated with or without GW300 (3 µM), GW707 (10 µM), 25-hydroxycholesterol (‘25OH chol’; 40 µM) followed by addition of Dil-LDL. In some conditions, LDL (300 µg/ml) was added together with the Dil-LDL ().

a

b

c

d

e

f

brane-bound transcription factor SREBP and the SREBP-cleavage activating protein (SCAP)14. When free cholesterol in the cell is low, the SREBP–SCAP complex moves from the endoplasmic reticulum to the Golgi apparatus with subsequent release of mature SREBP, which is then translocated to the nucleus and leads to an increase in expression of LDLr. In the presence of sterols, the SREBP–SCAP complex is retained in the endoplasmic reticulum and cleavage does not occur15–20. The N-terminal domain of SCAP contains eight alternating hydrophobic and hydrophilic sequences forming membrane-spanning helices. Among them, five helices form a putative sterol-sensing domain21. We set up a photo-affinity labeling assay to determine if GW575, a 14C-labeled photo-activable analog of GW532 (Fig. 1), could reverse the effect of sterols by interacting directly with SCAP. We expressed the full-length hamster SCAP in Sf-9 insect cells by infection with a recombinant baculovirus encoding SCAP. As a control, we also infected Sf-9 insect cells with a recombinant baculovirus encoding β-galactosidase (β-gal). Three days after infection, Sf-9 cells were incubated with [14C]GW575, followed by 365 nm UV irradiation and SDS–PAGE. [14C]GW575 specifically labeled a protein identified as SCAP by western-blot analysis (data not shown) and molecular weight, whereas no labeling occurred after incubation of [14C]GW575 with Sf-9 cells expressing the β-gal protein (Fig. 4a and b). Measurement of the radioactivity associated with SCAP on a mole-to-mole basis revealed that the stoichiometry between GW575 and SCAP was 1:10 at 5 µM and more than 50 µM was required to reach 1:1. The SCAP labeling could be displaced in a dose-dependent manner by an excess of the active analog GW707 (Fig. 4c), whereas

Table 1

the inactive analog GW706 had no effect (Fig. 4d). These data indicate that GW575 and GW707 bind specifically to SCAP, presumably to the same site. Similar studies were performed using a truncated form of SCAP corresponding to Leu2–Tyr473, which contains the sterol-sensing domain21. This truncated form of SCAP was also specifically labeled with [14C]GW575 and the labeling was also displaced by GW707 (Fig. 4e). Partial proteolytic digestion with Lys-C protease of the 14C-labeled, truncated protein followed by amino-acid sequencing confirmed the sequence of SCAP (′′LQVDT, corresponding to amino acids 148–152). It was not possible to displace the labeling of SCAP using 25-hydroxycholesterol. This may be due to the lack of solubility of this oxysterol when used at the high concentrations required to compete with irreversible GW575 binding. The direct binding of cholesterol on the putative sterol-sensing domain of SCAP has never been demonstrated but only suggested by mutation in this domain21. The binding of our compounds to SCAP or to its truncated form containing the sterol-sensing domain is consistent with an antagonism of sterol action; however, we cannot exclude the possibility that sterols bind another accessory protein that binds to SCAP.

SCAP ligand reduces plasma LDL cholesterol and triglycerides in hamsters

VLDL-chol g/L

LDL-chol g/L

HDL-chol g/L

VLDL-TG g/L

Apo-B100 a.u.

ALAT a.u.

ASAT a.u.

CONTROL n = 10

0.33 ± 0.14

1.15 ± 0.16

1.88 ± 0.2

1.23 ± 0.6

1.02 ± 0.25

80 ± 18

56 ± 14

GW532 5 mg/kg, n = 10

0.06 ± 0.02**

0.42 ± 0.2**

2.2 ± 0.2*

0.44 ± 0.2*

0.51 ± 0.22**

88 ± 22

54 ± 11

36 ± 17%

117 ± 11%

36 ± 16%

50 ± 21%

110 ± 27 %

% of control

18 ± 6%

96 ± 20 %

Data are mean ± s.d. of 10 animals. *, P < 0.01; **, P < 0.001. a.u., arbitrary unit.

1334




ARTICLES Through direct binding to SCAP, SCAP ligands may induce the translocation to the Golgi apparatus of the SCAP/SREBP complex, leading to the maturation of SREBP, thus mimicking cholesterol depletion. To test this hypothesis, we determined the effects of compounds on maturation of SREBP2 and SREBP1a, the two transcription factors involved in cholesterol homeostasis in cells6. We expressed HSV-tagged precursor forms of human SREBP2 and SREBP1a (ref. 22) in CHO cells by transient transfection. Upon treatment with active LDLr upregulators such as GW300 and GW707, the mature forms of both SREBP1a and SREBP2 were increased in the nuclear fraction (Fig. 4f). Inactive compounds such as GW706 and GW570 were ineffective at triggering the maturation of any of the SREBPs. Thus, SCAP ligands trigger the proteolytic maturation of SREBPs and their migration in the nucleus leading to the transcriptional activation of target genes such as LDLr. This mechanism of action is different from that of the statins, which act through depletion of cellular cholesterol and subsequent derepression of SCAP (refs. 23–25). SCAP ligands reduce plasma levels of lipids We investigated the ability of SCAP ligands to reduce plasma lipid levels in vivo in hamsters. LDLr regulation by cholesterol is very similar in hamsters and humans. Feeding hamsters with a diet rich in cholesterol reduces SREBP2 maturation and LDLr expression and leads to an increase in plasma LDL cholesterol26,27. Fat-fed hamsters were therefore treated for three days with GW532 and the plasma lipoproteins were analyzed. GW532 strongly decreased cholesterol in both very low-density lipoprotein (VLDL) and LDL fractions. At 5 mg per kg, GW532

a

b

Fig. 4 GW compounds bind to SCAP and activate the translocation of SREBP. a and b, [14C]GW575 binds to the full-length SCAP protein and not to β-gal. Full-length SCAP and β-gal were expressed in SF-9 insect cells infected with corresponding baculovirus and labeled (see Methods section). Respectively, black arrow and asterisk indicate the position corresponding to the SCAP protein or to the β-gal protein after Coomassie staining (a) or radioactivity detection (b). c–e, Binding competition. Binding of [14C]GW575 (5 µM) on SCAP was displaced with GW707 (c) but not with GW706 (d). e, [14C]GW575 binds to a truncated form of SCAP. The empty arrow indicates the position of the truncated SCAP. f, SCAP ligands increase the amount of mature nuclear form of SREBP1a and SREBP2. Western blot of nuclear extracts from CHO cells transfected without (Mock) or with plasmid encoding precursor form of SREBP2 (pTK-BP-2) or SREBP1a (pTK-BP-1a) and then treated with 0.5 µM active (GW707, GW300) or inactive (GW706, GW570) compounds. Positions corresponding to the mature form of SREBP2 or SREBP1a are indicated with an empty arrow or asterisk, respectively. NATURE MEDICINE • VOLUME 7 • NUMBER 12 • DECEMBER 2001

c

reduced VLDL cholesterol (–82%), LDL cholesterol (–64%) and triglycerides (–64%), whereas high-density lipoprotein (HDL) cholesterol was not significantly affected (+17%) (Table 1). The reduction in atherogenic lipoproteins was confirmed by quantification using SDS–PAGE of the amount of apolipoproteinB100 (Apo-B100), the main component of the VLDL and LDL particles. Plasma Apo-B100 was reduced by 50% after treatment with GW532. We assessed liver integrity by monitoring plasma level of liver enzymes. We observed no effect of the treatment on levels of either alanine amino transferase (ALAT) or aspartate amino transferase (ASAT). We charted dose-response curves of GW532 for animals on both high-fat and normal diets. We observed a large reduction in VLDL/LDL cholesterol with GW532 in hamsters on both type of diets with reduction up to 80% (Fig. 5a), whereas VLDL/LDL triglycerides were decreased only in fat-fed animals (Fig. 5b). This finding confirmed the potential of this class of compounds to markedly reduce plasma levels of atherogenic lipids. Reduction of plasma triglycerides in normal-diet hamsters was not significant due to the low plasma levels of triglycerides and the high variability of this parameter in these animals. We investigated modulation of gene expression in the liver using HMGCoA reductase and LDLr as examples of genes regulated by the SREBP pathway. Hepatic LDLr and HMGCoA reductase mRNA levels were respectively increased 3- and 3.5-fold upon treatment with GW532 as revealed by real-time PCR (Fig. 5c), confirming the activation of SREBP pathway. We observed no effect on the internal control ribosomal 18S RNA. Analysis of the lipid content of livers from GW532-treated animals did not show any accumulation of cholesteryl esters, the main storage

d

e

f

1335


ARTICLES


a

c

d

e

form of cholesterol in cells, nor triglycerides, suggesting that fatty acid and cholesterol homeostasis are not dysregulated in vivo (data not shown). Discussion In recent years, major clinical trials have shown a strong correlation between the reduction in plasma LDL cholesterol and the reduction in cardiovascular mortality/morbidity. Statins, alone or in combination, have provided the clearest beneficial effects28–30. The maximal effects achieved by statins in man are of the order of 60% reduction of LDL cholesterol and 30% reduction of triglycerides levels, even with the new generation of statins such as rosuvastatin31. Statins are highly liver-selective, inhibiting 3-hydroxy-3-methylgluteryl–coenzyme-A reductase, the key enzyme in the synthesis of cholesterol25. The subsequent depletion of intracellular cholesterol induces the mRNA for the LDL receptor leading to the promotion of LDL clearance and reduction of plasma cholesterol levels32,33. Other additional mechanisms could play a role in the clinical benefit observed with these agents23. Regulation of LDLr expression by cholesterol has been extensively reviewed and involves the SREBP transcription factors as well as the protein SCAP (refs. 5,14,20). The pivotal roles of SCAP and SREBP for hepatic lipid synthesis have been demonstrated in vivo under basal and adaptative conditions34. Here we describe a new class of hypolipidemic drugs acting directly on SCAP. We demonstrate that these compounds specifically bind to SCAP presumably in the putative sterolsensing domain and increase the mature nuclear form of SREBPs, which activate gene expression. We found that the SRE of the LDLr promoter is necessary for the stimulation by our compounds, reinforcing the involvement of the SCAP/SREBP pathway in their mechanism of action. Moreover, these compounds upregulate the expression of LDLr when cells are loaded 1336

Fig. 5 SCAP ligand reduces plasma LDL cholesterol and triglycerides in hamsters. a and b, GW532 reduces VLDL/LDL cholesterol (a) and triglycerides (b) in both fat-fed and chow-diet hamsters. Animals were treated for 3 d with GW532 before determination of VLDL/LDL. Results represent mean ± s.d. of 5 animals. c–e, GW532 increases LDLr and HMGCoA reductase mRNA in the liver. Fat-fed hamsters were treated for 3 d with GW532 (5 mg/kg) before liver total RNA extraction. LDLr and HMGCoA reductase cDNA were quantified as a reference. The Ct values for both control and treated animals were, respectively, 26.3 ± 0.58 and 24.7 ± 0.5*** for LDLr, 26.06 ± 0.4 and 24.3 ± 0.55*** for HMGCoA reductase, and 10.6 ± 0.35 and 10.6 ± 0.11 for ribosomal RNA 18S (***, P < 0.001). Discrete values () and the mean ± s.d. (n = 6; ) for each group are indicated.

b

with sterols, suggesting that they can act even under conditions where feedback inhibition of LDLr could have occurred. Using the hamsters as a relevant animal model for regulation of LDLr under high-fat diet conditions, we observed a highly significant reduction in atherogenic particles following treatment with the compounds. Analysis of lipoprotein distribution revealed a marked reduction of cholesterol and triglycerides in both VLDL and LDL lipoproteins, which is correlated with the upregulation of the mRNA for LDLr in the liver. Thus, SCAP ligands stimulate the transcription of LDLr without depletion in sterols leading to a potent and sustained reduction of both LDL cholesterol and triglycerides in vivo. The magnitude of the effects obtained on cholesterol and triglycerides (up to 80% reduction without any reduction of HDL cholesterol) is greater than those described with statins in animal models, leading us to postulate that SCAP ligands represent a promising new class of hypolipidemic drugs. Methods Promoter-reporter constructs. The human LDLreceptor promoter (Genbank L29401) corresponding to nucleotides –588 to +91 (relative to the major transcription site) was PCR cloned from human genomic DNA (Clontech, Palo Alto, California) using GAAGATCTCACAAAACAAAAAATATTTTTTTGGC and GGCCCCATGGTCGCAGCCTCTGCCCAGGCAGTGTCC primers. This was inserted into pGL3-basic vector (Promega, Madison, Wisconsin) at HindIII and NcoI sites (LDLp-588luc). A stable clone was isolated from HepG2 cells (American Type Culture Collection, Manassas, Virginia) co-transfected with LDLp-588luc and pCIneo (Promega) after geneticin selection. 5′-truncated promoters in pGL3-basic were obtained by PCR sub-cloning using KpnI and NarI sites. Primers were CAATTGTTCCAGGAACCAGG (luciferase) and GGGGTAC CAATCAGAGCTTCACGGGTTAAAA, GGGGTACCACATCGGCCGTTGAAACTC, GGGGTACCTGAAAATCACCCCACTCAAACT, GGGGTACCAAACTCCTCCCCCTGCTAGAAA and GGGGTACCTCACATTGAAATGCTGTAAATGA, respectively for LDLp-149luc, LDLp-118luc, LDLp-70luc, LDLp-53luc and LDLp-31luc. The adenovirus major late promoter was introduced in pGL3-basic (p-MLPluc) as described13. Four repeats of the SRE (underlined sequence) were introduced in p-MLPluc (p4SRE-MLPluc) using the BglII site, GATCTAAAATCACCCCACTGCAAAATCACCCCACTGCA and complementary oligo (two inserts). The human ApoA1 promoter corresponding to nucleotides –1161 to +232 relative to the major transcription site was cloned in pGL3-basic (ApoAI-luc) using AGATCTCCTTCCAGGAGAAACCTG and AAGCTTCCTGAAGGGCCGTGGGGGAC primers. Thymidine kinase promoter–Renilla luciferase (pRL-TK) was from Promega. NATURE MEDICINE • VOLUME 7 • NUMBER 12 • DECEMBER 2001



ARTICLES Cell culture, transfection and reporter assays. HepG2 cells were seeded in 24-well plates in BME medium containing 10% FCS. After 24 h, the medium was replaced by RPMI1640 plus 10% FCS before transfection with ApoAI-luc or LDLp-luc together with pRL-TK using Fugene-6 (Boehringer). 24 h after transfection, cells were incubated for another 24 h in the presence of GW532, GW575, GW300, GW570, GW707 or GW706. In some conditions, sterols were added either as 25-hydroxycholesterol or by loading cells with human LDL 6 h before compounds. Firefly and Renilla luciferase activities were measured using Dual Luciferase Assay Kit (Promega) and Lumistar (BMG, Offenburg, Germany) and the ratio of firefly to Renilla activities calculated. LDL uptake assays. HepG2 seeded in Biocoat slides (Beckton Dickinson, San Jose California) were pretreated with GW532 or 25-hydroxycholesterol for 20 h and incubated 4 h with 6 µg/ml of fluorescent Dil-LDL (Biomedical Technologies, Stoughton, Massachusetts). Intracellular fluorescent dye was detected by microscopy using Axioplan-2 Zeiss (Jena, Germany) rhodamine filters with DXC950P camera (Sony, Tokyo, Japan). Primary human and cynomolgus monkey hepatocytes (Bioprodic, Rennes, France) were seeded for 24 h in collagen-coated plates in Williams E medium with 0.1% FCS, 0.4 µg/ml insulin and 0.1 µM dexamethasone. Cells were then treated for 16 h with compounds or vehicle. Dil-LDL (6 µg/ml) with or without LDL (300 µg/ml) were added for 4 h. The mean red fluorescence of 5,000–10,000 trypsinized cells was measured using FACScan (Becton Dickinson). SCAP binding assay. Hamster SCAP was re-cloned in pTen12 (Q-Biogene) from pTK-HSV-SCAP-T7 (ATCC clone 63365) using BglII and XbaI. QBiogene produced the recombinant baculovirus and provided β-gal control baculovirus and Sf-9 cells. Cells were grown in CCM-3 medium (Hyclone) and seeded at 8 × 106 cells 4 h before infection with 200 × 106 p.f.u. A baculovirus coding truncated SCAP (Leu2-Tyr473) was produced according the manufacturer’s instructions using PCR and the pDonR201, pDest10, pFastBac and the recombinase Gateway cloning system (Life Technologies, Grand Island, New York). 72 h after infection, 2 × 105 cells/well were incubated at 28 °C in Dulbecco PBS for 30 min with GW707, GW706 or vehicle followed by 30 min after addition of [14C]GW575. Photo-activation was performed by irradiation for 10 min at 4 °C using a 6-W, 365-nm VL-6LP lamp (Vilbert–Lourmat, Marne la Vallée, France). Cellular proteins (10 µg) were analyzed by SDS–PAGE and radioactivity detected using a PhosporImager screen (Molecular Dynamics, Sunnyvale, California). Western-blot analysis. HSV-tagged human SREBP2 and SREBP1a were expressed in CHO cells transfected for 20 h with pTK-BP2 or pTK-BP-1a (ref. 22; ATCC clone 99530 and 99532) using Fugene-6. 18 h after addition of compounds or vehicle, nuclear extracts were obtained as described35. Proteins (20 µg) were separated on SDS–PAGE, and blotted onto BA83 nitrocellulose membrane (Schleicher & Schuell, Keene, New Hampshire). HSV tag was detected using 0.2 µg/ml antibodies against HSV (Invitrogen, Carlsbad, California) and 0.2 µg/ml goat antibody against mouse IgGN– peroxidase conjugate (Pierce, Rockford, Illinois) after saturation with 20% goat serum and revealed with Supersignal femto (Pierce) and IS440CF (Kodak, Rochester, New York). GW532 in vivo activity. 2 wk before treatment, the food of male Syrian golden hamsters (Janvier, Le Genest, France) was switched to a high-fat diet (0.12% cholesterol, 10% coconut oil). Animals were treated orally once a day for 3 d with GW532 or vehicle (0.5% methylcellulose, 5% Tween 80). 4 h after the last treatment, serum were prepared and lipoproteins were analyzed by HPLC on Superose 6HR column (Pharmacia, Uppsala, Sweden) with on-line colorimetric determination of cholesterol and triglycerides using the RTU enzymatic assay (Biomerieux, Marcy l’Étoile, France). Liver enzymes were measured in serum using an autoanalyzer. Apolipoprotein-B100 was analyzed as described36. Real-time PCR quantification of RNA. Treated animals were killed and livers immediately dropped into liquid nitrogen. RNA was extracted and cDNA produced using RNAqueous (Ambion, Austin, Texas) and Taqman reverse transcription (Perkin Elmer) kits. Real-time PCR was performed on NATURE MEDICINE • VOLUME 7 • NUMBER 12 • DECEMBER 2001

Abi-Prism 7700 using Master Mix SYBRgreen kit (PE-Applied Biosystems, Norwalk, Connecticut) according to manufacturer’s instructions (60 °C, 300 nM of primers). Primers were AAGACACATGCGACAGGAATGAG and GACCCACTTGCTGGCGATAC for LDLr, and TCACTGGCAACAACAAGATCTGT and AGGATGATGATGTCACTGCTCAAT for HMGCoA-reductase. Taqman ribosomal RNA (18S) control reagent (Perkin Elmer) was used as reference. Amplification efficiencies were 100%, 99% and 97%, respectively. Relative abundance of RNA were calculated from the cycle threshold (Ct) using the formula 2−Ct and expressed as arbitrary units. Acknowledgments We thank R. Guillard, V. Paillard and V. Baudet for technical assistance; T. Dean for synthesis of GW 707; and J.C. Rodriguez for critical reading of the manuscript.

RECEIVED 30 JULY; ACCEPTED 18 OCTOBER 2001 1. Ansell, B.J., Watson, K.E. & Fogelman, A.M. An evidence-based assessment of the NCEP Adult Treatment Panel II guidelines. National Cholesterol Education Program. JAMA 282, 2051–2057 (1999). 2. Expert panel on Detection Evaluation and Treatment of High Blood Cholesterol in Adults. Executive summary of the third report of the National Cholesterol Education Program (NCEP). JAMA 285, 2486–2497 (2001). 3. Kovanen, P.T. & Schneider, W. J. Regulation of the low density lipoprotein (B/E) receptor. Adv. Vasc. Biol. 5, 165–185 (1999). 4. Brown, M.S. & Goldstein, J.L. A receptor-mediated pathway for cholesterol homeostasis. Science 232, 34–47 (1986). 5. Brown, M.S. & Goldstein, J.L. The SREBP pathway: Regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 89, 331–340 (1997). 6. Horton, J.D. & Shimonura, I. Sterol regulatory element-binding proteins: activators of cholesterol and fatty acid biosynthesis. Curr. Opin. Lipidol. 10, 143–150 (1999). 7. Briggs, M.R. et al. Nuclear protein that binds sterol regulatory element of low density lipoprotein receptor promoter. J. Biol. Chem. 268, 14490–14496 (1993). 8. Natarajan, R., Ghosh, S. & McLean Grogan, W. Molecular cloning of the promoter for rat hepatic neutral cholesterol ester hydrolase: Evidence for transcriptional regulation by sterols. Biochem. Biophys. Res. Commun. 243, 349–355 (1998). 9. Sato, R. et al. Sterol regulatory element-binding protein negatively regulates microsomal triglycerides transfer protein gene transcription. J. Biol. Chem. 274, 24714–24720 (1999). 10. Luong, A. et al. Molecular characterization of human Acetyl-CoA synthetase, an enzyme regulated by sterol regulatory element-binding protein. J. Biol. Chem. 275, 26458–26466 (2000). 11. Makar, R.S., Lipsky, P.E. & Cuthbert, J.A. Multiple mechanisms, independent of sterol regulatory element binding proteins, regulate low density lipoprotein gene transcription. J. Lipid Res. 41, 762–774 (2000). 12. Liu, J. et al. Identification of a novel sterol-independent regulatory element in the human low density lipoprotein receptor promoter. J. Biol. Chem. 275, 5214–5221 (2000). 13. Ham J. et al. Several different upstream promoter elements can potentiate transactivation by the BPV-1 E2 protein. EMBO J. 10, 2931–2940 (1991). 14. Edwards, P.A., Tabor, D., Kast, H.R. & Venkateswaran, A. Regulation of gene expression by SREBP and SCAP. Biochim. Biophys. Acta 1529, 103–113 (2000). 15. Hua, X., Nohturfft, A., Goldstein, J.L. & Brown, M.S. Sterol resistance in CHO cells traced to point mutation in SREBP cleavage-activating protein. Cell 87, 415–426 (1996). 16. Cheng, D. et al. Secreted site-1 protease cleaves peptides corresponding to luminal loop of sterol regulatory element-binding proteins. J. Biol. Chem. 274, 22805–22812 (1999). 17. Duncan, E.A. et al. Second-site cleavage in sterol responsive element-binding protein occurs at transmembrane junction as determined by cysteine panning. J. Biol. Chem. 273, 17801–17809 (1998). 18. DeBose-Boyd, R.A. et al. Transport-dependent proteolysis of SREBP: Relocation of site-1 protease from Golgi to ER obviates the need for SREBP transport to Golgi. Cell 99, 703–712 (1999). 19. Nohturfft, A., Yabe, D., Goldstein, J.L., Brown, M.S. & Espenshade, P.J. Regulated step in cholesterol feedback localized to budding of SCAP from ER membranes. Cell 102, 315–323 (2000). 20. Sakai, J. & Rawson, R.B. The sterol regulatory element-binding protein pathway: control of lipid homeostasis through regulated intracellular transport. Curr. Opin. Lipidol. 12, 261–266 (2001). 21. Yang, T., Goldstein, J.L. & Brown, M.S. Overexpression of membrane domain of SCAP prevents sterols from inhibiting SCAP-SREBP exit from endoplasmic reticulum. J. Biol. Chem. 275, 29881–29886 (2000). 22. Hua, X., Sakai, J., Brown, M.S. & Goldstein, J.L. Regulated cleavage of sterol regulatory element binding proteins requires sequences on both sides of the endoplasmic reticulum membrane. J. Biol. Chem. 271, 10379–10384 (1996). 23. Aguilar-Salinas, C.A., Barrett, H. & Schonfeld, G. Metabolic modes of action of the statins in the hyperlipoproteinemia. Atherosclerosis 141, 203–207 (1998).

1337



ARTICLES 24. Blumenthal, R.S. Statins: effective antiatherosclerotic therapy. Am. Heart J. 139, 577–583 (2000). 25. Vaughan, C.J., Gotto, A.M. & Basson, C.T. The evolving role of statins in the management of atherosclerosis. J. Am. Coll. Cardiol. 35, 1–10 (2000). 26. Shimomura, I. et al. Cholesterol feeding reduces nuclear forms of sterol regulatory element binding proteins in hamster liver. Proc. Natl. Acad. Sci. USA 94, 12354–12359 (1997). 27. Sheng, Z., Otani, H., Brown, M.S. & Goldstein, J.L. Independent regulation of sterol regulatory element-binding proteins 1 and 2 in hamster liver. Proc. Natl. Acad. Sci. USA 92, 935–938 (1995). 28. Thompson, G.R. & Naoumova, R.P. Novel lipid-regulating drugs. Expert Opin. Investig. Drugs 9, 2619–2628 (2000). 29. Chong, P.H. & Bachenheimer, B.S. Current, new and future treatments in dyslipidaemia and atherosclerosis. Drugs 60, 55–93 (2000). 30. Brown, W.V. Novel approaches to lipid lowering: What is on the horizon? Am. J. Cardiol. 87, 23B–27B (2001). 31. Olsson, A.G. Statin therapy and reductions in low density lipoprotein cholesterol:

1338

initial clinical data on the potent new statin rosuvastatin. Am. J. Cardiol. 87, 33B–36b (2001). 32. Ma, P.T.S. et al. Mevinolin, an inhibitor of cholesterol synthesis, induces mRNA for low density lipoprotein receptor in liver of hamsters and rabbits. Proc. Natl. Acad. Sci. USA 83, 8370–8374 (1986). 33. Bilheimer, D.W. et al. Mevinolin and colestipol stimulate receptor-mediated clearance of low density lipoprotein from plasma in familial hypercholesterolemia heterozygotes. Proc. Natl. Acad. Sci. USA 80, 4124–4218 (1983). 34. Matsuda, M. et al. SREBP cleavage-activating protein (SCAP) is required for increased lipid synthesis in liver induced by cholesterol deprivation and insulin elevation. Genes Dev. 15, 1206–1216 (2001). 35. Hua, X. et al. Hairpin orientation of sterol regulatory element-binding protein-2 in cell membranes as determined by protease protection. J. Biol. Chem. 270, 29422–29427 (1995). 36. Benoist, F. & Grand-Perret, T. Co-translational degradation of apolipoprotein B100 by the proteasome is prevented by microsomal triglyceride transfer protein. J. Biol. Chem. 272, 20435–20442 (1997).
