THEJOURNAL OF BIOLOGICAL CHEMISTRY
Communication
Vol. 263,No. 18, Issue of June 25, pp. 8565-8568,1988 0 1988 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.
Sequence and Expression of Mouse y-Renin* (Received for publication, January 26,1988)
Catherine C. Drinkwater$, Bronwyn A. Evans, and Robert I. Richards From theHoward Florey Institute of Experimental Physiology and Medicine, University of Melbourne, Parkville, Victoria, 3052,Australia
As previously reported, we have isolated and partially characterized the entire mouse glandular kallikrein gene family (2). In this paper we present the identification of the gene encoding y-renin andsubsequent isolation of a corresponding cDNA. The complete primary structure of y-renin, derived from the nucleotide sequence, is compared to other members of the mouse glandular kallikrein family, thus indicating any amino acid residues that contribute to the unusual substrate specificity and catalytic activityof y-renin. Expression of the y-renin gene in various mouse tissues was also examined.
Mouse y-renin is a member of the group of serine as glandular kallikreins. These proteases known highly homologous proteins process a diverse range of growth factors and hormones to their biologically active form, usually by cleavage at a basic residue. y-Renin, however, cleaves at aLeu-Leubond in a similar fashion to renin. We have identified and sequenced the gene and a cDNA encoding y-renin. The completepredictedaminoacidsequence was determined, and residues that may be importantin the unusual cleavage pattern exhibited by y-renin are discussed. The nucleotide sequence enabled design of a gene-specific oligodeoxyribonucleotide which was used to determine in which mouse tissues y-renin is expressed.
EXPERIMENTAL PROCEDURES
Kallikrein clones were isolated from a BALB/c mouse genomic library constructed using the EMBL3A vector as described previously (2). Polyadenylated RNA was isolated from the submandibular gland of adult male BALB/c mice (8, 9), and double-stranded cDNA was prepared from a 2-pg aliquot by sequential treatment with reverse transcriptase (10) and a combination of ribonuclease H, Escherichia coli DNA polymerase I, and T4 DNAligase (11).Methylation of internal EcoRI sites, addition of EcoRI linkers, and ligation of cDNA to theX g t l O vector were based on the procedure of Huynh et al. (12). The resulting DNA was packaged in vitro (13) and plated out on E. coli strain CSOO/hfl. Restriction fragments of the X clones were subcloned into M13 mp 18 or 19 (14) and sequenced by the chain termination method (15) using [cx-~‘S]~ATP and either the standard M13 17-mer or kallikrein-specific oligodeoxyribonucleotides (2) as primers. Oligodeoxyribonucleotidescorresponding to a variable region of the DNA sequence from exon 3 of the gene mGK-16 (complementary tonucleotides 860-2389, Fig. 2) and toregions conserved between all the kallikrein genes (2) were synthesized by the solid-phase The serine protease y-renin was originally isolated from phosphoramidite procedure as detailed elsewhere (16). Specificity of adult male mouse submaxillary gland (1). On the basis of the oligodeoxyribonucleotidefor mGK-16 was tested by hybridization molecular mass, arginyl esterase activity, inhibition profile, to nitrocellulose filters as described previously (17). 10-pg aliquots of polyadenylated RNA from mouse salivary gland, kidney, pancreas, and partialamino acid sequence (l), y-renin hasbeen included brain, and testis were denatured in formaldehyde, electrophoresed on in a highly homologous group of trypsin-like serine proteases 1%agarose formaldehyde gels, and transferred to nitrocellulose (18). known as the mouse glandular kallikreins (2, 3). Though The Northern blots were hybridized to oligodeoxyribonucleotides members of this family are closely related structurally, they labeled at the 5’ terminus with [Y-~’P]ATPas detailed elsewhere process a diverse range of hormones and growth factors, (17).
usually with stringent substrate specificity (3-5). The low proportion of variable amino acid residues between mouse glandular kallikreins with different functions makes these enzymes an ideal system for comparative structural andfunctional analysis of serine proteases at a particularly rigorous level. Most mouse glandular kallikreins show trypsin-like specificity, cleaving at basic residues (6). However, y-renin has been shown to cleave synthetic tetradecapeptide renin substrate ata Leu-Leu bond (1).This is the same bond processed by renin as thefirst cleavage step in the generation of angiotensin (7). Amino acid residues of y-renin important to this cleavage event should be unique when compared to other glandular kallikreins.
* This work was supported by grants to theHoward Florey Institute from the National Healthand Medical Research Council of Australia, the Ian Potter Foundation, and the Myer Family Trusts. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solelyto indicate this fact. The nucleotide sequence(s) reported in thispaper has been submitted to theGenBankTM/EMBL Data Bankwith accession numberfs) 5038 77. $ Recipient of a Commonwealth Postgraduate Research Award. To whom correspondence should be addressed.
RESULTS AND DISCUSSION
Identification of the y-Renin Gene-The two fragments of amino acid sequence from y-renin, sequence A and sequence B (l),correspond to regions encoded by exons 2 and 4 of the mouse glandular kallikrein genes (2, 19). Partial nucleotide sequence from exon 2 for all mouse glandular kallikrein genes has been obtained (2). The predicted amino acid sequences were, therefore, compared to sequence A of y-renin. None of the genes encoded the exact sequence as published; however, the proteins encoded by several genes differed at only a few residues. To clarify the situation, the nucleotide sequence from exon 4 of all potentially functional mouse glandular kallikrein genes was determined, and the predicted amino acid sequences were compared to sequence B (Fig. 1).This allowed the identification of mGK-16 as thegene encoding yrenin. Peptides A and B had been sequenced as a mixture, with assignation of residues at each position being made on the basis of relative yields and by comparison to the sequence of porcine pancreatic kallikrein (1). Difficulties in the assignment of some of these residues were mentioned (1). Whenthe peptide sequences are compared to those encoded by exons 2 and 4 of mGK-16 (Fig. l),it is clear that 4 amino acid residues have been assigned incorrectly to the corresponding position
8565
8566
Mouse y-Renin
in the otherpeptide. Furthermore, no gene other than mGK16 encodes a protein with fewer than 10 amino acid differences from the published sequence (Fig. 1and Ref. 2). 3 4 Isohtion of a cDNA Encoding y-Renin-A BALB/c mouse 5 salivary gland cDNA library was subsequently screened for 6 7 clones encoding y-renin. Initially, the primary plating of 8 9 about 60,000 recombinants was screened with pMK-1, a kal11 likrein cDNA that hybridizes to exons 3, 4, and 5 of all 12 13 members of the gene family (19,20). 90 of the 169 kallikrein14 positive cDNA clones were purified and subjected to further 16 17 screening with a gene-specific oligodeoxyribonucleotide de19 21 signed from a region in exon 3 unique to mGK-16 (comple22 mentary to nucleotides 860-889, Fig. 2). Four positives were ATTCAC 23 A T ~ identified, ~ ~ ~ ~one~ of ~which, ~ ~pMK-19, ~ ~ ~also ~ hybridized ~ ~ T T an ~ exon ~ ~ 24 to 1probe (fragment IV, Ref. 19) and was therefore chosen for GACTGTGACAAAGCCTATGTACAGAAAGTCACAGATGTCATGCTGTGT 1 AATTGTGACAAAAACCACAATAAGAAGGTGACAGATGTCATGGTGTGT 2 isolation and characterization. GACTGTGCCAAAGCCCACATAGAGAAGGTGACAGATGCCATGCTGTGT 3 4 GACTGTGACAAAGCACATGAAATGAAGGTGACAGATGCCATGCTGTGT Nucleotide Sequence Encoding y-Renin-Fig. 2 depicts the 5 GACTGTGTCAAAGCCCACATAGAGAAGGTGACAGATGTTATGTTGTGT composite cDNA and gene sequences encoding y-renin. The 6 GACTGTGCCAAAGCCCACATAGAGAAGGTGACAGATGACATGTTGTGT GAGTGTGCCAAAACCGAG--AGTGMGGTGACAGATGTCATGCTGTA 7 cDNA clone is almost full-length, starting 10 base pairs from 8 AACTGTATAGAAAACCACAATGTGAAGGTGACAGATGTCATGCTGTGT the second putative transcription initiation site. 526 base pairs 9 GACTGTGGCAAAGCCCACATAGAGAAGGTGACAGATGTCATGCTGTGT GTCTGTGTCAAAAACCACAATCAAAAGGTGACAGATGTCATGTTGTGC 11 of DNA 5’ to pMK-19 were derived from the gene mGK-16. GACTGTGTCAAAAACTACAATGAGAAGGTGACAGATGTCATGTTGTGT 12 Positions of exon-intron boundaries were determined from 13 AACTGTGCCAAAGTCTACCTACAGAAKTCACAGATGTCATGCTGTGT 14 TACTGTGACAAGACACATAAAATGAAGGTGACAGATGTCATGCTGTGT mGK-16. However,the sequence from introns is not presented 16 AACTGTGCCAAAGCCTACCTACTGAAAGTCACAGATGTCATGCTGTGT TACTGTGACAAAACACATAAAATGAAGGTGACAGATGTCATGCTGTGT 17 here. The boundary locations are identical to those of all other 19 AACTGTGCCAAAGGCCACATAGAGAAAGCCACAGATGTCATGCTGTC characterized functional mouse kallikrein genes (2,16, 17,19, 21 AATTGTGCCAAAGCCTACATACATAAAGTCACAGATGTCATGCTGTGT GTCTGTGTGAAAGCCCATATACTGAAGGTGACAGATGTCATGCTGTGT 22 21). mGK-16 also contains the variant 5’-TTTAAA-3’ seTACTGTGACAAAACACATAAAATGAAGGTGACAGATGTCATGCT 23 AACTGTACCAAACCCTACTTACATAAAGTCACAGATGTCATGCTGT quence typical of kallikrein promoter regions (16, 17, 19, 21) 24 and a normal polyadenylation signal (22). Since the cDNA clone encoding y-renin is not completely full-length, it was 170 150 160 not possible to determine which of the two potential transcripB 1 tion initiation sites (19) is used. 2 Expression of y-Renin in Mouse Tissues-The expression 3 4 profile of y-renin was of interest because of its renin-like 5 6 action in vitro. A brain renin-angiotensin system has been 7 described in several animals (for review, see Ref. 23).In mouse 8 9 ti N A KIDL o c VIN LIK L L P N D I C I A K I AH I EIKv T D v n L cI brain, however, renin synthesis is undetectable (24) though 11 12 other components of the renin-angiotensin system have been 13 detected (24,25). The possibility therefore arises that another 14 16 enzyme processes angiotensinogen in mouse brain. Glandular 17 19 kallikrein(s) have been detected in mouse (16) and rat (26) 21 brain. Therefore, we investigated the possibility that y-renin o N P NID L O CTS 1 1 ~ ’ i f i i l ~ N E I V I C I V I K I A H I LIK v T D v K L cI 22 23 is responsible for the first cleavage step of angiotensin pro24 duction in the brain. The gene-specific oligodeoxyribonucleotide for mGK-16 C was used as a probe on mRNA from male and female salivary r-r.otnI..wnc.r) I V G G F K C E K N S P P V P V U V Y Y I K E Y L t G G V L V D X n Y Y L T l l . .. gland, male kidney, pancreas, testis, and brain of BALB/c I V G G F K C E K ~ S D P H O Y ~ V Y Y ~ K E H I C G G V ~ L ~ R ~ ~ V L I A ~ mice (Fig.3). A 1-kilobase band was detected in salivary gland Y Q K P D D L Q C H f I K L L P N E H C H K ~ ~ l t K ~ I D L ~ L X X l E ~at X E much higher levels in the male tissue. This expression . .. phenotype is exhibited by most mouse glandular kallikrein ( W ) P K P O D L Q C ~ ~ I K L L P N E N ~ ~ K ~ Y L L K ~ I D ~ ~ L ~ ~ I E ~ G E genes, with the exception of renal kallikrein which is exFIG. 1. A, nucleotide sequences from exon 4of all potentially pressed at equal levels in both male and female salivary glands functional mouse glandular kallikrein genes aligned to maximize homology. Sequences not included are from kallikrein genes shown (16, 27). Exposure of the blot for longer periods failed to to be pseudogenes either due to gross rearrangementsor characterized detect any hybridization to brain mRNA (not shown). Thus, by nucleotide substitutions, insertions, or deletions in exons 2 and 3 y-renin does not represent the predominant mouse glandular that give rise to in-phase termination codons (2). Splice acceptor sites kallikrein@) expressed in brain (16). Although the lack of at the 5”intron-exon junction are boxed. The dashed box indicates a detection of y-renin in the brain using Northern blots (as potential alternative splice acceptor site for mGK-14. B, predicted well as in situ hybridization histochemistry)’ does not preamino acid sequences from exon 4. Boxed areas indicate residues which are identical for at least 85% of the genes. Numbers refer to clude the possibility of low level expression, it would appear the position relative to the amino terminus of mature mouse y-nerve to be too low to support an important role in angiotensin growth factor (34). C, comparison of the amino acid sequence of y - biosynthesis in mouse brain. renin (1) to predicted amino acid sequences from exons 2 and 4 of Structure of y-Renin-Determination of the complete semGK-16. The sequences are aligned relative to the NHz-terminal quence of pMK-19 allows the structure of y-renin to be amino acid of each peptide, so that corresponding residues are directly predicted. The coding potential indicates that the protein is above each other. Asterisks denote differences between residues. The tryptophan residue in parentheses is actually encoded by the end of synthesized as a larger precursor, from which presumably a exon 3 as well as the beginning of exon 4 (see Fig. 2) but is included leader sequence of 17 hydrophobic residues (the signal pepA
1
TGCAAAAGATCTCCAGTGTGTGAACCTCAAGCTCCTGCCTAATGAG TGCAAAAGATCTCCAGTGTGTGAACCTCAAGCTCCTGCCTAATGAG CACAGATGATCTCTACTGTGTGAACCTCAAGCTCCTGCCTAATGAG TCCAGATGATCTCCAGTGTGTGAACCTCAAGCTCCTGCCTAATGAG CGCAGATGATCTCCAGTGTGTGAACTTCAAGCTCCTGCCTAATGAG CCAGATGAGCTCCAGTGTGTGAACCTCAAGCTCCTGCCTAATGAG GCAAAAGATCTCCAGTGTGTGAACCTCAAGCTCCTGCCTAATGAG CCAGATGATCTCCAGTGTGTGTTCCTCAAGCTCCTGCCTATTAAG CCAAAAGATCTCCAGTGTGTGAACCTCAAGCTCCTGCCTAATGAG CCAGATGATCTCCAGTGTGTGTCCATCAAGCTCCTGCCTAATGAG CCAGATGATCTGCAGTGTGTGTCCATCAAGCTTCTGCCTATTGAG CCAGATGATCTTCAGTGTGTGTTCATCACGCTCCTGCCCAATGAG
[email protected]&.TGATCTCCAATGTGTGAACCTCAAGCTCCTGCCTAATGAG CCGATGATCTTCAGTGTATCTTCACCAAGCTCCTGCCCAATGAG CCAGATGCTCTCCAATCTGTGAACCTCAAGCTCCTGCCTAATGAG CCAGATGATGTCCAGTGTGTGTTCATCAAGCTCCTGCCCAATGAG CCAAATGATCTCCAGTGTGGGTTCATCAAGCCCCTGCCTAATGAA CCAAATGATCTCCAGTGTGTGTCCATCAAGCTCCATCCTAATGAG TCAAATATCCAGATGCTCTCCAATGTGTGAACCTCAAGCTCCTGCCTAATGAG C C A ~ G C A A A A G C C ~
L~C-MI.=~~*)
~=-cm
