Mol Biol Rep (2012) 39:11201–11216 DOI 10.1007/s11033-012-2029-6
Silibinin ameliorates arsenic induced nephrotoxicity by abrogation of oxidative stress, inflammation and apoptosis in rats S. Milton Prabu • M. Muthumani
Received: 1 March 2012 / Accepted: 2 October 2012 / Published online: 16 October 2012 Springer Science+Business Media Dordrecht 2012
Abstract Arsenic (As) is an environmental and industrial pollutant that affects various organs in human and experimental animals. Silibinin is a naturally occurring plant bioflavonoid found in the milk thistle of Silybum marianum, which has been reported to have a wide range of pharmacological properties. A body of evidence has accumulated implicating the free radical generation with subsequent oxidative stress in the biochemical and molecular mechanisms of As toxicity. Since kidney is the critical target organ of chronic As toxicity, we carried out this study to investigate the effects of silibinin on Asinduced toxicity in the kidney of rats. In experimental rats, oral administration of sodium arsenite [NaAsO2, 5 mg/ (kg day)] for 4 weeks significantly induced renal damage which was evident from the increased levels of serum urea, uric acid, creatinine with a significant (p \ 0.05) decrease in creatinine clearance. As also significantly decreased the levels of urea, uric acid and creatinine in urine. A markedly increased levels of lipid peroxidation markers (thiobarbituric acid reactive substances and lipid hydroperoxides) and protein carbonyl contents with significant (p \ 0.05) decrease in non-enzymatic antioxidants (total sulfhydryl groups, reduced glutathione, vitamin C and vitamin E) and enzymatic antioxidants (superoxide dismutase, catalase, glutathione peroxidase and glutathione S-transferase), Glutathione metabolizing enzymes (glutathione reductase and glutathione-6-phosphate dehydrogenase) and membrane bound ATPases were also observed in As treated rats. Co-administration of silibinin (75 mg/kg day) along with As resulted in a reversal of As-induced biochemical S. M. Prabu (&) M. Muthumani Department of Zoology, Faculty of Science, Annamalai University, Annamalainagar 608 002, Tamil Nadu, India e-mail:
[email protected]
changes in kidney accompanied by a significant decrease in lipid peroxidation and an increase in the level of renal antioxidant defense system. The histopathological and immunohistochemical studies in the kidney of rats also shows that silibinin (75 mg/kg day) markedly reduced the toxicity of As and preserved the normal histological architecture of the renal tissue, inhibited the caspase-3 mediated tubular cell apoptosis and decreased the NADPH oxidase, iNOS and NF-jB over expression by As and upregulated the Nrf2 expression in the renal tissue. The present study suggests that the nephroprotective potential of silibinin in As toxicity might be due to its antioxidant and metal chelating properties, which could be useful for achieving optimum effects in As-induced renal damage. Keywords Arsenic Silibinin Oxidative stress Antioxidant iNOS Cas-3 NF-jB Histopathology Rat
Introduction Arsenic (As) is a notable environmental toxin. Extensive application of As in mining, smelting and refining of certain ores have distributed it into the environment. Burning of coal has also contributed to disperse As in the environment [1]. Chronic As poisoning is a global health problem affecting millions of people. It enters the organisms by dermal contact, inhalation, or ingestion of contaminated drinking water and redistributes itself to the entire organ systems of the body [2] and concentrates in the kidney during the urinary elimination [3]. Epidemiological studies and animal experiments have demonstrated that chronic exposure to As will damage the kidney and increase the risk of renal cancer [4, 5]. Accordingly kidney may be a major target for the accumulation and toxicity of
123
11202
As [2]. Investigations at the cellular and molecular levels reveals that As enhances production of reactive oxygen species (like, superoxide and hydrogen peroxide), causes lipid peroxidation, enhances oxidation of proteins, enzymes as well as DNA, disrupts mitosis and promotes apoptosis [6, 7]. The mechanism of As induced nephrotoxicity at molecular level has been studied for decades, but still it is poorly understood. Kidney is the major excretory and osmoregulatory organ that plays an important role in control and regulation of homeostasis with reabsorptive, secretory and metabolic functions [8]. As is capable of causing acute renal failure as well as chronic renal insufficiency. Since As also generates reactive oxygen species (ROS) during metabolic activation processes, oxidative stress may be one of the key mechanisms for As -induced nephrotoxicity. It was reported that As increased the generation of ROS, reactive nitrogen species (RNS), depressed the functions of antioxidant defense system and led to oxidative damages to cellular macromolecules [6, 9]. As exerts its toxic effects through several mechanisms, the most significant of it is the reversible reaction with sulfhydryl groups especially vicinal dithiols. The binding of As to thiol containing amino acid residues in proteins has provided a mechanistic framework for envisioning interactions between proteins and As and for understanding the inhibition of the activities of several enzymes by As in various organs [10]. In order to combat against As-induced oxidative renal damage, antioxidant phytochemicals may be the suitable antagonists because of their high antioxidant nature and low toxicity. The flavonoids are a family of phenolic compounds that possess a remarkable spectrum of biochemical and pharmacological activities like antibacterial, antiviral, anti-inflammatory, antiallergic, antithrombotic, antimutagenic, antineoplastic, as well as neuroprotective properties [11]. Flavonoids affect the basic cell function such as growth, differentiation and apoptosis, because of their radical scavenging activity. Silibinin, is a powerful antioxidant with pharmacological benefits including neuroprotective [12], cardioprotective [13] and nephroprotective effects [14]. In fact, some studies describe that silibinin displays potent antioxidative properties because it diminishes O•2 - release, reduces accumulation of lipid peroxidation products, scavenges free radicals, restores glutathione (GSH) level and increases the activity of GSHassociated enzymes and it also modulates the expression of the effector proapoptotic caspase-3 activity and protects mitochondria from iron overload by restoring mitochondrial potential, respiration and membrane integrity [15]. Therefore, the main objective of our study is to evaluate the potential role of silibinin in modulating the oxidative stress mediated nephrotoxicity and the expression of nitric oxide
123
Mol Biol Rep (2012) 39:11201–11216
Fig. 1 Structure of silibinin
synthase (iNOS), effector proapoptotic caspase-3 and nuclear factor-jB implicated in the nephrotoxic insult caused by As in rats.
Materials and methods Chemicals Silibinin was purchased from Sigma Chemical Co (St. Louis, MO, USA). Sodium arsenite (NaAsO2) was bought from Sisco Research Laboratory (Mumbai, India). Commercial kits to estimate urea, uric acid and creatinine were from Sigma Diagnostics (I) Pvt. Ltd. (Baroda, India). All other chemical and biochemicals were of analytical grade obtained from local firms. Chemical structure of silibinin is shown in Fig. 1. Animals and experimental design Adult male albino rats of Wistar strain (150–170 g) were used for the experiment. The rats were maintained under standard laboratory conditions (temperature 24 ± 2 C; natural light–dark cycle). The rats had free access to drinking water and commercial standard pellet diet (Lipton India Ltd., Mumbai, India). The laboratory animal protocol used for this study was approved (Vide No. 684, 2010) by the Committee for the Purpose of Control and Supervision on Experimental Animals (CPCSEA) at Annamalai University, Annamalainagar, India. In the present study, As was administered intragastrically at a dose of 5 mg/kg body weight/day for 4 weeks, which was 1/8 of the oral LD50 values in rats. A pilot study was conducted with three different doses of SB (25, 50 and 75 mg/kg) to determine the dose dependent effect of SB in As treated nephrotoxic rats. After 4 weeks of experiment, it was observed that SB pretreatment at the doses of 25, 50 and 75 mg/kg significantly (p \ 0.05) lowered the levels of serum nephritic markers, thiobarbituric acid reactive substances and elevated the levels of reduced GSH in the renal tissue of As intoxicated rats (data have not shown). 75 mg/kg of SB showed higher significant effect than the lower doses 25 and 50 mg/kg. Hence, we have chosen the highest dose (75 mg/kg) of SB for our study.
Mol Biol Rep (2012) 39:11201–11216
The animals were randomly divided into four groups of six animals in each group. Group 1: control rats received only the vehicles i.e., normal saline and carboxymethyl cellulose. Group 2: rats orally received As (as NaAsO2) in 0.5 mL sterile physiological saline at a dose of 5 mg/ (kg day) for 4 weeks. Group 3: rats orally received As 5 mg/(kg day) and silibinin at a dose of 75 mg/(kg day) for 4 weeks. Group 4: rats orally received silibinin alone (suspended in 0.5 % carboxymethyl cellulose) at a dose of 75 mg/(kg day) for 4 weeks. As was administered orally at a dose of 5 mg/(kg day) 1 h after the administration of silibinin for 4 weeks. During the experimental period, body weight, blood glucose, food and water consumption and physical examinations were determined at regular intervals. The dosage was adjusted every week according to any change in body weight to maintain similar dose per kg body weight of rat over the entire period of study for each group. At the end of the treatment period, the rats were fasted overnight, anaesthetized with pentobarbital sodium (35 mg/kg, i.p.) and sacrificed by cervical decapitation. Blood was collected and centrifuged (1,0009g for 15 min) for the separation of serum. Urinary samples were obtained from each animal housed in a specially designed metabolic cage, were fecal contamination was avoided. Urine samples were collected into bottles with in 24-h cycles. The volume of each sample was recorded and centrifuged at 3,0009g for 5 min. Urine samples were collected in the morning between 9.00 and 10.00 h. Kidney tissues from control and experimental groups of rats were excised, rinsed with ice-cold saline and homogenized in 100 mM Tris–HCl buffer (pH 7.4) using Teflon homogenizer and centrifuged at 12,0009g for 30 min at 4 C. The supernatant was pooled and used for the estimations. The protein content in the tissue homogenate was also estimated [29]. Biochemical assays Estimation of urea, uric acid, creatinine and creatinine clearance The levels of urea, uric acid and creatinine in serum and urine were estimated spectrophotometrically using commercial diagnostic kits (Sigma Diagnostics (I) Pvt. Ltd., Baroda, India). Creatinine clearance as an index of glomerular filtration rate was calculated from serum creatinine and a 24 h urine sample creatinine levels. Determination of lipid peroxidation and protein carbonyl contents Lipid peroxidation in the renal tissue was estimated calorimetrically by measuring thiobarbituric acid reactive substances (TBARS) and lipid hydroperoxides as described
11203
by Niehiaus and Samuelsson [16] and Jiang et al. [17] respectively. As a hallmark of protein oxidation, total protein carbonyl content was determined in the kidney by a spectrophotometric method described by Levine et al. [18] and expressed as nmol/mg protein. Measurement of non-enzymatic antioxidants Reduced GSH was determined by the method of Moron et al. [19] based on the reaction with Ellman’s reagent (19.8 mg dithionitrobisbenzoic acid in 100 mL of 0.1 % sodium citrate). Total sulfhydryl groups (TSH) in the kidney homogenate were measured after the reaction with dithionitrobisbenzoic acid using the method of Ellman [20]. Ascorbic acid (vitamin C) and vitamin E concentrations were measured by the methods of Omaye et al. [21] and Desai [22] respectively. Assay of antioxidant and GSH metabolizing enzymes Superoxide dismutase (SOD) activity was determined by the method of Kakkar et al. [23] in which the inhibition of formation of NADH-phenazinemethosulfate nitroblue tetrazolium formazon was measured spectrophotometrically at 560 nm. Catalase (CAT) activity was assayed calorimetrically as described by Sinha [24] using dichromate acetic acid reagent. Glutathione peroxidase (GPx) activity was assayed by the method based on the reaction between glutathione remaining after the action of GPx and 5,5dithiobis-2-nitrobenzoic acid to form a complex that absorbs maximally 412 nm [25]. Glutathione S-transferase (GST) activity was determined spectrophotometrically by using dichloro-2,4-dinitrobenzene as the substrate [26]. Glutathione reductase (GR) that utilizes NADPH to convert metabolized Glutathione (GSSG) to the reduced form was assayed by the method of Horn and Burn [27]. The estimation of Glucose 6-phosphate dehydrogenase (G6PD) was carried out by the method of Beutler [28], where an increase in the absorbance was measured when the reaction was started by the addition of glucose 6-phosphate. Protein level was determined by using Bovine serum albumin as the standard at 560 nm [29]. Assay of renal nitric oxide (NO) and TNF-a The NO was indirectly measured by determining the nitrite level using colorimetric assay kit as indicated by the manufacturer (Cayman Chemical Company, USA) based on the Griess reaction [30]. Also, the level of tumor necrosis factor-a (TNF-a) in renal homogenates was determined by enzyme linked immunosorbent assay using mouse TNF-a immunoassay kit according to the recommendations of the manufacturer (R&D Systems, USA).
123
11204
Estimation of membrane-bound adenosine triphosphatases (ATPases) Total ATPase activity in kidney homogenate was measured by the method of Evans [31]. The ATPase activity in 0.1 mL of aliquot of the homogenates were measured in a final volume of 2 mL containing 0.1 mL of 0.1 M Tris– HCl (pH 7.4), 0.1 mL of 0.1 M NaCl, 0.1 mL of 0.1 M MgCl2, 1.5 mL of 0.1 M KCl, 0.1 mL of 1 mM EDTA and 0.1 mL of 0.01 M ATP. The reaction was stopped at 20 min by the addition of 1 mL of 10 % TCA and then centrifuged (1,5009g for 10 min) and the inorganic phosphorus (Pi) liberated was estimated in the protein-free supernatant. The amount of liberated Pi was estimated according to the method of Fiske and Subbarow [32]. The activity of Na?/K?-dependent ATPase was determined by the method of Bonting [33]. In this assay, 0.2 mL of brain tissue homogenate was added to the mixture containing 1 mL of 184 mM Tris–HCl buffer (pH 7.5), 0.2 mL of 50 mM MgSO4, 0.2 mL of 50 mM KCl, 0.2 mL of 600 mM NaCl, 0.2 mL of 1 mM EDTA and 0.2 mL of 10 mM ATP and incubated for 15 min at 37 C. The reaction was arrested by the addition of 1 mL of ice cold 10 % TCA. Then the amount of Pi liberated was estimated in protein free supernatant. The activity of Ca2?–ATPase was assayed according to the method of Hjertan and Pan [34]. In brief, 0.1 mL of tissue homogenate was added to a mixture containing 0.1 mL of 125 mM Tris–HCl buffer (pH 8), 0.1 mL of 50 mM CaCl2 and 0.1 mL of 10 mM ATP. The contents were incubated at 37 C for 15 min. The reaction was then arrested by the addition of 0.5 mL of ice cold 10 % TCA and centrifuged. The amount of Pi liberated was estimated in supernatant. The activity of Mg2?–ATPase was assayed by the method of Ohinishi et al. [35]. The contents were incubated for 15 min at 37 C and the reaction was arrested by adding 0.5 mL of 10 % TCA. The Pi liberated was then estimated in protein free supernatant. The activities of these ATPase enzymes in tissue homogenate were expressed as lg Pi liberated/min/mg protein.
Mol Biol Rep (2012) 39:11201–11216
Following deparaffinization and rehydration, sections were irradiated in 0.1 mol/L sodium citrate buffer (pH 6.0) in a microwave oven (medium low temperature) for 20 min. Then the sections were exposed to 3 % H2O2 for 10 min to bleach endogenous peroxidases, followed by rinsing 3 times in Tris buffer (pH 7.4) for 10 min. Sections were selectively incubated under humid conditions using an anticaspase-3 and polyclonal antibody (Thermo Scientific, USA) for overnight at 4 C. Next day, slides were washed 3 times in Tris buffer for 10 min each. The specificity of the antibody was tested by omission of the primary antibody and a positive control of rat tonsil tissue. After washing in Tris buffer (pH 7.4), tissues were visualized with 3.30-diaminobenzidine (DAB) and counterstained with hematoxylin. Finally, the sections were dehydrated in xylene, mounted with DPX and cover slipped. Slides prepared for each case were examined by light microscopy. Positive and negative controls were conducted in parallel with caspase-3 stained sections. Staining of sections with commercially available antibody served as the positive control and negative controls included staining tissue sections with omission of the primary antibody. For iNOS and nuclear factor-jB (NF-jB) expressions, four micrometer thick sections were prepared from different animal groups. Sections were deparaffinised, rehydrated and endogenous peroxidase activity was blocked with H2O2 in methanol. Sections were pre-treated in citrate buffer (pH 6.0) in a microwave and incubated at room temperature with monoclonal anti-iNOS and anti-NF-jB antibodies (Thermo Scientific, USA, dilution 1:100). Ultra vision detection System (Thermo Scientific) was used as follows; sections were incubated with biotinylated goat anti-polyvalent, then with streptavidin peroxidase and finally with DAB plus chromogen. Slides were counterstained with hematoxylin, visualized under light microscope and the extent of cell immunopositivity was assessed. The number of immunopositive cells was counted in 5 separate microscopic fields in each slide and the mean number for each slide was obtained, then the mean ± SD was calculated for each group (10 slides). Real-time qPCR analysis for renal NADPH oxidase and Nrf2
Immunohistochemistry To examine the protective effects of silibinin on apoptosis in the kidney, caspase-3 expression in the kidney was assessed by immunohistochemical staining. Kidney sections on polylysine coated slides obtained were fixed in neutral buffered formalin and embedded in paraffin and was treated for caspase-3 antibody for immunohistochemical analysis. The procedures were processed according to the manufacturer’s protocol recommended for the caspase3 immunohistochemistry with slight modifications.
123
Total RNA was extracted from the renal tissues from control and experimental groups of rats by TRIzol reagent (Invitrogen, Carlsbad, CA), according to the manufacturer’s protocol and purified by Qiagen RNeasy Mini Kit (Qiagen, Venlo, The Netherlands). Purified total RNA was reverse transcribed into single strand cDNAs, which were successively analyzed by real-time qPCR using the SYBR GREEN PCR master mix (Applied Biosystems, Foster City, CA). The amplification protocol comprised of 1 cycle at 95 C for 3 min followed by 40 cycles at 95 C for 30 s,
Mol Biol Rep (2012) 39:11201–11216
11205
Table 1 List of primer sequences for real-time qPCR Accession no.
Gene description
Gene symbol
Forward
Reverse
Product size
NM_031789.1
Nuclear factor (erythriod-derived 2)-like 2
Nrf2
gagacggccatgactgat
gtgaggggatcgatgagtaa
196
NM_000089.1
NADPH Oxidase
Nox
gtaaagttttggaattgcagatgag
tccttatgagattttctgtccagtc
189
NM_017008.3
Glyceraldehyde-3-phosphate dehydrogenase
Gapdh
aggttgtctcctgtgacttc
ctgttgctgtagccatattc
130
58 C for 30 s, and then 72 C for 30 s. Primer sequences were designed using the Primer Express 2.0 software ensuing the instructions of Applied Biosystems for optimal primer design and were synthesized commercially. The primer sequences for NADPH oxidase, nuclear factor (erythroid-derived 2)-like 2 (Nrf2) and GAPDH were given in Table 1. A standard curve was prepared using a serial dilution of a reference sample, and was included in each real-time run to correct for possible variations in product amplification. Relative copy numbers were obtained from standard curve values, and were normalized to values obtained for the internal control, GAPDH. The fold change in expression was then obtained by 2-DDCT method. Histopathology For histopathological examination, the kidney tissues were dissected and the tissue samples were fixed in Bouin’s solution for 14–18 h, processed in a series of graded ethanol and embedded in paraffin. Paraffin sections were cut at a 5 lm thickness and stained with hematoxylin and eosin for light microscopy examination. The sections were viewed and photographed on a Olympus light microscope (Olympus BX51, Tokyo, Japan) with attachment photograph machine (Olympus C-5050, Olympus Optical Co. Ltd., Japan). Ten slides were prepared from each kidney. All sections were evaluated for the degree of tubular and glomerular injury, inflammatory cell infiltration, necrosis, edema and calcification. Each kidney slides were examined and assigned for severity of changes using scores on a scale of none (-), mild (?), moderate (??) and severe (???) damage.
Statistical analysis All the data were expressed as mean ± SD of number of experiments (n = 6). The statistical significance was evaluated by one-way analysis of variance using SPSS version 9.0 (SPSS, Cary, NC, USA) and the individual comparisons were obtained by Duncan’s multiple range test (DMRT). Values were considered statistically significant when p \ 0.05.
Results Body weight gain, food intake, water intake and organ body weight ratio Table 2 depicts the effects of As, silibinin on body weight gain, food and water intake and organ-body weight ratio (%) in control and experimental rats. In As treated rats, water and pellet diet consumption significantly (p \ 0.05) decreased with a decrease in body weight. A significant (p \ 0.05) increase in kidney-body weight ratio was recorded in As treated rats when compared with control rats. Treatment with silibinin effectively attenuated the As-induced alterations in food and water intake, body weight gain and kidney-body weight ratio, when compared with As treated rats. Administration of silibinin alone to rats did not show any alterations in these parameters and did not differ significantly from that of the normal control group. Serum and urine markers of nephrotoxicity
Analysis of metal Renal and urine samples were wet digested and concentration of arsenic in the digested samples were measured using hydride generation atomic absorption spectrophotometer (AAS, ECIL-4141, India) at 193.7 nm wavelength and 10 Ma current. The values were expressed in microgram per gram of tissue or microgram per milliliter of urine. Detection limit for arsenic was 0.02 ppm. Analytical accuracy was ensured by repeated analysis of test samples; five freshly prepared standards and reagent blanks, run with each analytical series.
The levels of renal functional markers in control and experimental groups were shown in Fig. 2. A significant (p \ 0.05) increase in the level of serum urea (A), uric acid (B) and creatinine (C) with significant (p \ 0.05) decrease in the level of creatinine clearance (D) in serum and a significant decrease (p \ 0.05) in the level of urea (E), uric acid (F) and creatinine (G) in the urine was observed in As treated rats when compared with normal control rats. Simultaneous administration of As along with silibinin significantly (p \ 0.05) restored the levels of nephritic markers when compared with As-treated rats. In silibinin
123
11206
Mol Biol Rep (2012) 39:11201–11216
Table 2 Bodyweight, absolute and relative kidney weight, food and water intake in control and experimental rats Groups
Control
Body weight
% Change
Absolute kidney weight (g)
Relative kidney weight (g/100 g bw)
Food intake (g/ 100 g bw/day)
Water intake (mL/rat/day) 20.15 ± 2.08
Initial (g)
Final (g)
173.00 ± 1.89
192.00 ± 4.62
10.98 ± 0.59a
1.69 ± 0.03a
0.57 ± 0.004a
12.25 ± 1.15
b
b
Arsenic
172.00 ± 2.42
163.00 ± 4.09
5.52 ± 0.40
1.36 ± 0.01
0.49 ± 0.002b
8.17 ± 0.86
14.54 ± 1.36
Arsenic ? silibinin Silibinin
176.00 ± 1.37 174.00 ± 2.18
190.00 ± 4.28 194.00 ± 4.79
7.36 ± 0.68c 10.30 ± 0.54a
1.54 ± 0.02c 1.71 ± 0.03a
0.53 ± 0.003c 0.58 ± 0.004a
10.74 ± 0.98 12.95 ± 1.07
17.68 ± 1.72 20.96 ± 1.86
Values are given as mean ± SD from six rats in each group. Values not sharing a common superscript letter (a–c) differ significantly at p \ 0.05 (DMRT)
treated rats, the levels of renal markers were not much altered and were comparable to those of the control rats. Renal oxidative stress markers Changes in the levels of renal lipid peroxidation, lipid hydroperoxides (LOOH) and protein carbonyls (PC) in control and experimental rats are shown in Table 3. The levels of lipid peroxidation products namely TBARS, LOOH and PC significantly (p \ 0.05) increased in As treated rats when compared with the control groups. Administration of silibinin along with As significantly (p \ 0.05) decreased the levels of TBARS, LOOH and PC in the kidney tissue of rats when compared to As treated rats. Administration of silibinin alone significantly (p \ 0.05) reduced the levels of TBARS, LOOH and PC when compared with the control group.
(p \ 0.05) increased the activities of these antioxidant enzymes (Table 5) when compared with As treated rats. Rats administered with silibinin alone showed a significant increase in the level of these enzymatic antioxidants when compared with the control rats. Renal membrane bound ATPases Table 6 shows the activities of hepatic Na?/K?, Ca2? and Mg2? ATPases in the kidney of control and experimental rats. A significant (p \ 0.05) decrease in the activities of membrane bound ATPases in the kidney tissue of As treated rats when compared with control rats. Treatment of silibinin (75 mg/kg bw/day) along with As significantly (p \ 0.05) restored the levels of membrane bound ATPases in the kidney of As intoxicated rats. No significant changes were observed between control and silibinin treated rats in the activities of these membrane bound ATPases.
Renal non-enzymatic antioxidants Renal TNF-a and NO Table 4 illustrates the alterations in the levels of nonenzymatic antioxidants in the kidney tissues of control and experimental rats. A significant decrease (p \ 0.05) in the levels of non-enzymatic antioxidants (GSH, TSH, vitamins C and E) in the kidney tissue was observed in rats treated with As when compared to the control. Administration of silibinin along with As significantly (p \ 0.05) increased the levels of these non-enzymatic antioxidants to near normalcy when compared with As treated rats. Rats administrated with silibinin alone showed a significant increase in the level of these non-enzymatic antioxidants when compared with the control rats. Renal enzymatic antioxidants The activities of enzymatic antioxidants namely (SOD, CAT, GPx and GST) and glutathione metabolizing enzymes (GR and G6PD) significantly (p \ 0.05) decreased in the kidney tissues of As treated rats when compared with the control groups. Administration of silibinin along with As intoxicated rats significantly
123
The levels of TNF-a and NO significantly (p \ 0.05) increased in the kidney tissues of As treated rats when compared with the control groups. Administration of silibinin along with As significantly (p \ 0.05) decreased the levels of TNF-a and NO (Fig. 3) when compared with As treated rats. In silibinin alone treated rats, the levels of renal TNF-a and NO were not much altered and were comparable to those of the control rats. Renal immunohistochemistry Immunohistochemical examinations of rat kidney (Figs. 4, 5, 6, 7) revealed that As administration caused significant (p \ 0.05) increase in the immunoreactivity of iNOS, NFjB and caspase-3 in the cytoplasm of proximal tubular cells as compared to the control group. On the other hand, silibinin treated rats shows significant (p \ 0.05) reductions in the As-induced over expression of iNOS, NF-jB and caspase-3 in the kidney tissue as compared with As group. The rats received silibinin alone shows negative
Mol Biol Rep (2012) 39:11201–11216
11207
Fig. 2 Effect of silibinin on arsenic-induced changes in renal functional markers: a urea, b uric acid, c creatinine, d creatinine clearance in serum, e urea, f uric acid, g creatinine in urine of male
albino Wistar rats. Values are mean ± SD for six rats in each group. Bars not sharing a common superscript letter (a–c) differ significantly at p \ 0.05 (DMRT)
immunostaining for iNOS, NF-jB and caspase-3 in the kidney tissue and were similar to that of the control group.
the results are presented in Table 7. Treatment with As caused marked tubular necrosis, tubular degeneration, tubular dilation, desquamation and thickened basement membrane. In addition diffuse haemorrhagia, luminal cast formation and marked atrophy of glomeruli tufts were also observed in this group (Fig. 8b, c). According to microscopic examinations pathological lesions induced by As were remarkably reduced by the administration of silibinin
Histolopathology of kidney Histological changes in the kidneys were evaluated semi quantitatively as described in materials and methods and
123
11208
Mol Biol Rep (2012) 39:11201–11216
Table 3 Changes in the levels of renal thiobarbituric acid reactive substances (TBARS), lipid hydroperoxides (LOOH) and protein carbonyls (PCC) of control and experimental rats Groups
Control
TBARS
2.49 ± 0.17a 0.59 ± 0.05
a
1.78 ± 0.12
a
Lipid hydroperoxides Protein carbonyls
Arsenic
Arsenic ? silibinin
Silibinin
4.21 ± 0.34b
2.68 ± 0.19c
2.34 ± 0.12d
b
c
0.47 ± 0.04d
c
1.64 ± 0.11d
0.95 ± 0.09
0.65 ± 0.07
b
4.52 ± 0.35
2.26 ± 0.18
Values are given as mean ± SD from six rats in each group. Values not sharing a common superscript letter (a–d) differ significantly at p \ 0.05 (DMRT). TBARS—mg/g tissue, LOOH—mmol/g tissue, PCC—nmol/mg protein
Table 4 Changes in the levels of renal non-enzymatic antioxidant status of control and experimental rats Groups
Control
Arsenic a
Arsenic ? silibinin b
Silibinin
1.39 ± 0.14
d
2.41 ± 0.19
2.83 ± 0.24c
GSH (lg/g protein)
2.71 ± 0.21
TSH (lg/g protein)
9.29 ± 0.79a
6.57 ± 0.51b
8.24 ± 0.65d
9.48 ± 0.84c
0.90 ± 0.06
a
b
d
0.97 ± 0.06c
0.54 ± 0.05
a
d
0.63 ± 0.05c
Vitamin C (lmol/mg tissue) Vitamin E (lmol/mg tissue)
0.54 ± 0.03
b
0.26 ± 0.02
0.78 ± 0.05 0.45 ± 0.04
Values are given as mean ± SD from six rats in each group. Values not sharing a common superscript letter (a–d) differ significantly at p \ 0.05 (DMRT)
Table 5 Changes in the levels of renal enzymatic antioxidant status of control and experimental rats Groups
Control
SOD
10.78 ± 0.87a
6.28 ± 0.45b
9.37 ± 0.78c
12.27 ± 0.85d
CAT
46.12 ± 3.17
a
29.47 ± 2.21
b
41.27 ± 2.82
c
49.72 ± 2.97a
5.25 ± 0.32
a
2.64 ± 0.17
b
4.56 ± 0.29
c
5.39 ± 0.31a
GST
5.07 ± 0.27
a
3.23 ± 0.19
b
4.69 ± 0.25
c
5.78 ± 0.25d
GR
0.39 ± 0.04a
0.21 ± 0.02b
0.34 ± 0.03c
0.48 ± 0.04a
a
b
c
1.87 ± 0.11a
GPx
G6PD
Arsenic
1.75 ± 0.12
1.08 ± 0.07
Arsenic ? silibinin
1.61 ± 0.10
Silibinin
Values are given as mean ± SD from six rats in each group. Values not sharing a common superscript letter (a–d) differ significantly at p \ 0.05 (DMRT) SOD one unit of enzyme activity was taken as the enzyme reaction, which gave 50 % inhibition of NBT reduction in 1 min/mg protein, CAT lmol of H2O2 utilized/min/mg protein, GPx—lg of GSH consumed/min/mg protein, GST—lmol of CDNB-GSH conjugate formed/min/mg protein, GR—nmol of NADPH oxidized/min/mg protein, G6PD—nmol of NADPH formed/min/mg protein
Table 6 Changes in the activities of renal membrane bound ATPases of control and experimental rats Groups
Control
Total ATPases
1.84 ± 0.19a a
?
?
Na /K ATPase 2?
Ca
ATPase
Mg2? ATPase
Arsenic
0.55 ± 0.07
a
Arsenic ? silibinin
Silibinin
1.36 ± 0.12b
1.68 ± 0.16c
1.87 ± 0.17a
b
0.47 ± 0.06
c
0.53 ± 0.06a
c
0.56 ± 0.05a 0.69 ± 0.07a
0.37 ± 0.05
b
0.58 ± 0.06
0.35 ± 0.04
0.51 ± 0.06
0.67 ± 0.08a
0.48 ± 0.05b
0.62 ± 0.06c
Values are given as mean ± SD from six rats in each group. Values not sharing a common superscript letter (a–c) differ significantly at p \ 0.05 (DMRT). ATPases—lg Pi liberated/min/mg protein
(Fig. 8d), which were in agreement with the results of renal functional markers and the kidney lipid peroxidation and antioxidant status. There was no histological alteration in the kidney of silibinin alone treated rats (Fig. 8e) when compared to the control groups (Fig. 8a).
123
Renal real-time qPCR analysis for NADPH oxidase and Nrf2 The effect of silibinin on the mRNA expression of NADPH oxidase and Nrf2, in the kidney tissues of control and
Mol Biol Rep (2012) 39:11201–11216
11209
Fig. 3 Effects of silibinin treatment on renal a tumor necrosis factora (TNF-a), b nitric oxide (NO) levels in rats with nephrotoxicity induced by arsenic. Values are mean ± SD for six rats in each group. Bars not sharing a common superscript letter (a–c) differ significantly at p \ 0.05 (DMRT)
experimental groups of rats is depicted in Fig. 9. The mRNA expression of NADPH oxidase was significantly (p \ 0.05) increased with simultaneous decrease of Nrf2 mRNA expression in the renal tissues of As treated rats. However, these altered mRNA expressions by As were significantly (p \ 0.05) normalized in rats administered with silibinin. On the contrary, silibinin treatment to control group of rats did not demonstrate any statistical difference in comparison to control group of rats.
Fig. 4 Effects of silibinin treatment on the expression of a inducible nitric oxide synthase (iNOS), b nuclear factor-jB (NF-jB), c caspase3 in the kidney of rats with nephrotoxicity induced by arsenic. Values are mean ± SD for six rats in each group. Bars not sharing a common superscript letter (a, b and ND) differ significantly at p \ 0.05 (DMRT)
Arsenic concentration in kidney and urine The effect of silibinin on the levels of As in kidney and urine tissues of control and experimental groups of rats is represented in Fig. 10. Arsenic treated rats showed significantly (p \ 0.05) higher levels of arsenic in kidney and urine compared to control animals. Administration of silibinin along with As significantly (p \ 0.05) decreased the levels of the concentration of arsenic when compared with As treated rats. Rats administrated with silibinin alone, the
concentration of arsenic was not significant when compared with the control rats.
Discussion As induces a wide spectrum of pathological effects and biochemical dysfunctions constituting serious hazards to health. As interferes with antioxidant defense mechanisms,
123
11210
Fig. 5 Immunohistochemistry of caspase-3 (9400 magnifications). Representative photomicrographs of caspase-3 expression determined by immunohistochemistry: a there is no expression of caspase-3 in the cortical regions of kidney arsenic administration, b arsenic administration strongly increases the caspase-3 expression in inner cortical and outer medullary areas especially in the proximal convoluted tubules, c there is partial inhibition of caspase-3 expression as evidenced by weak immunostaining in the distal tubules in the cortical regions of rat kidneys treated with silibinin (75 mg/kg bw), d silibinin administration itself doesn’t induce caspase-3 as shown by the absence of staining in the tubular structures of inner cortex and outer medullary regions. Brown colour indicates immunopositivity. (Color figure online)
disrupts the mitochondrial respiratory chain together with the production of ROS, which may act as a signaling molecule in the induction of cell death [36]. Several studies have demonstrated that As-induced nephrotoxicity is associated with oxidative stress, proximal tubular damage and results in proximal tubular epithelial cell necrosis in the kidney of rats [7, 37]. Accordingly, among the main approaches practiced to ameliorate—As induced nephrotoxicity is the use of agents with powerful antioxidant properties. Silibinin is well documented for the attenuation of oxidant mediated hepatic damage induced by As [38]. In this context, the present study also confirmed that the administration of silibinin significantly restored the kidney function against the oxidative toxic insult elicited by As. Reduction in body weight is used as an indicator for the deterioration of the animal health status. In addition to body weight, we assessed the food and water intake, changes in the relative and absolute kidney weight of the control and experimental rats during the experimental period. It has been reported that As accumulation causes disturbances in the total body weight, absolute and relative kidney weights of rats may be due to As induced oxidative damage to tubular cells [37]. Our results are in line with
123
Mol Biol Rep (2012) 39:11201–11216
Fig. 6 Immunohistochemical staining of inducible nitric oxide synthase (iNOS, 9400 magnifications) in rat kidney from: a Control group showing no expression of iNOS, b arsenic group without silibinin treatment showing a significant increase in iNOS immunoreactivity in the cytoplasm of proximal tubular cells, c arsenic plus silibinin group showing a significant decrease in iNOS immunostaining, d silibinin administration itself does not induce caspase-3 as shown by the absence of staining in the tubular structures of inner cortex and outer medullary regions. Brown color indicates immunopositivity. (Color figure online)
this report as As treated rats showed decreased intake of water and food accompanied with retardation in growth rate and alterations in absolute and relative kidney weights. All these morphological changes observed in As intoxicated rats were effectively attenuated by treatment with silibinin. As induced nephrotoxicity is a well documented event, kidney injury due to As intoxication could be assessed by measuring the serum and urinary markers of kidney which are the biochemical hallmarks of renal damage. Urea is the end product of protein metabolism and due to the excess production of oxygen free radicals by As, it induces tubular necrosis which in turn increases tubular permeability, resulting in diffusion and back leak of the filtrate in decreased excretion and increased retention of nitrogenous waste i.e., urea in serum [39]. Uric acid is the final product of purine metabolism and it is formed from guanine and hypoxanthine via xanthine in reactions catalysed by guanase and xanthine oxidase. The increased level of serum creatinine after As intoxication is due to enhanced formation of metabolic waste product of muscle metabolism. Creatinine clearance was taken as indicator of glomerular function. In the present study, the elevated levels of renal markers in the As intoxicated rats are in line with the report of Patel and Kalia [40]. Administration of silibinin in As
Mol Biol Rep (2012) 39:11201–11216
11211
Fig. 7 Immunohistochemistry of NFrB (9400 magnifications). Representative photomicrographs of NF-jB determined by immunohistochemistry: a There is no expression of NF-jB in the inner part of the cortical regions kidney in control rats, b arsenic administration strongly increases the NF-jB expression in inner cortical and outer medullary areas especially in the proximal and distal convoluted tubules, c there is partial inhibition of NF-jB expression as evidenced by weak immunostaining in the cortical regions of rat kidneys treated with silibinin (75 mg/kg bw), d silibinin administration itself does not induce NF-jB expression as shown by the absence of staining in the tubular structures of inner cortex and outer medullary regions. Brown color indicates immunopositivity. (Color figure online) Table 7 Semi quantitative histopathological scoring of renal tissue in control and experimental rats Groups
Control
Arsenic
Arsenic ? silibinin
Silibinin
Tubular degeneration
-
???
??
-
Glomeruli space
-
???
??
-
Tubular dilation
-
???
??
-
Tubular necrosis
-
???
?
-
Vacuolization
-
???
?
-
Hemorrhage
-
???
??
-
Scoring was done as follows: none (-), mild (?), moderate (??) and severe (???)
intoxicated rats showing the decreased levels of renal markers such as urea, uric acid and creatinine clearance. Silibinin, a flavolignan, is a phenolic antioxidant which is found in the milk thistle of Silybum marianum and has been demonstrated to scavenge reactive oxygen and nitrogen species. It can chelate metal ions, such as ferrous cations, which are involved in the so called Fenton reaction, which generates reactive oxygen species, preventing lipid
Fig. 8 Photomicrographs of rat kidney (H & E) from: a (9100) Control group showing normal renal architecture, b and c (9100) as group without silibinin treatment showing widespread coagulative necrosis with dilatation, vacuolar degeneration, epithelial desquamation and intraluminal cast formation in the proximal tubules, d (9100) As plus silibinin group displaying marked improvement in the histological picture which is comparable to that of the control group, e (9100) silibinin group showing normal histological architecture of the renal tissue
peroxidation and thereby restored the altered serum and urine renal markers. In addition to its antioxidant properties, a number of other interesting activities have been described, particularly their effects on membrane stabilization [41]. Kidney in general has been found to be more vulnerable to As toxicity. The exact molecular mechanism of As nephrotoxicity and oxidative damage is mediated via the induction of NADPH oxidase [42]. As acts as a pro-oxidant in biological systems and causes lipid peroxidation which is a basic cellular deteriorating process in the kidney [37]. Profound free radical generation and enhanced lipid peroxidation are the dual facets of oxidative stress that initiate the pathogenesis of As-induced nephrotoxicity. In addition to lipid peroxidation, protein carbonylation also served as a well-validated marker for protein oxidation. In the present investigation, there was a significant increased level of TBARS, LOOH and PCC in the kidney of As exposed rats which confirms the oxidative stress. Decreased levels of
123
11212
Fig. 9 Effects of silibinin treatment on the mRNA expression of a NADPH oxidase b nuclear factor (erythroid-derived 2)–like 2 (Nrf2) in the kidney of rats with nephrotoxicity induced by arsenic. Values are mean ± SD for six rats in each group. Bars not sharing a common superscript letter (a, b, c and d) differ significantly at p \ 0.05 (DMRT)
oxidative stress markers in As treated rats administered with silibinin revealed the radical scavenging activity of silibinin which could be mainly attributed to the orientation of one methoxy group which is responsible for enhanced electron donating ability and three hydroxyl groups at 3rd, 5th and 7th positions enhances the antioxidant efficacy of this molecule as metal chelators [39]. Antioxidant enzymes, such as SOD, CAT, GST, GR and GPx are considered to be the second line of cellular defense against oxidative renal injury induced by As. SOD and CAT mutually functions as important enzymes in the elimination of ROS and RNS. SOD is an antioxidant enzyme, which catalyzes the dismutation of superoxide to H2O2 which in turn is removed by CAT [43]. Thus, SOD can act as a primary defense against superoxide anion and prevents further generation of free radicals. Reduction in SOD activity in As-exposed animals reflects enhanced production of superoxide radical anions [44]. The increase in superoxide radicals also inhibits CAT activity [45]. NADPH is required for the activation of CAT from its inactivated form. Thus, reduced activity of CAT in As exposed renal tissue may be due to the insufficient supply of NADPH during As metabolism [46]. On the other hand, glutathione-related enzymes, such as GPx, GR and GST
123
Mol Biol Rep (2012) 39:11201–11216
Fig. 10 Effects of silibinin treatment on renal and urine arsenic level of control and experimental rats. Values are mean ± SD for six rats in each group. Bars not sharing a common superscript letter (a–c) differ significantly at p \ 0.05 (DMRT)
function either directly or indirectly as antioxidants. GST is a family of proteins involved in the detoxification process by catalyzing the reaction of glutathione with toxicants to form an S-substituted glutathione [47]. GPx is a seleniumcontaining enzyme. It is well established that As interacts with essential selenocysteine moiety of GPx to form insoluble and inactive As-selenium complex [48] rendering it unavailable and ultimately resulting in the inhibition of GPx activity or altering the expression and synthesis of selenoproteins like GPx [49]. GST and GPx plays principle function to reduce organic hydroperoxides within membranes and lipoproteins in the presence of GSH. Therefore, decreased activities of GST and GPx with a concomitant decrease in the activity of GSH-regenerating enzyme, GR suggest the consumption of glutathione while protecting against the As-induced oxidative stress in the renal tissue, as they help to maintain cellular redox status. G6PD is an important enzyme of hexose monophosphate shunt. It converts one molecule of glucose 6-phosphate into 6-phosphogluconolactone in the presence of Mg2?, Mn2? and Ca2? ions and subsequently NADP? is reduced to NADPH. A subsequent reduction of the G6PD activity in As intoxicated kidney tissue shows impaired generation of NADPH which is required for the reduction of GSSG to GSH [50, 51]. In the present study, it has been observed that As intoxicated rats significantly reduced the activities
Mol Biol Rep (2012) 39:11201–11216
of all the antioxidant enzymes in the renal tissue. Interestingly, the fact that silibinin could markedly renew the impairment of antioxidant defense system in the kidney of As-treated rats might be attributed to its powerful antioxidant and metal chelating properties [52]. The inexorable generation of reactive free radicals and lipid peroxides during As-mediated oxidative stress could be correlated to decline in the level of non-enzymatic antioxidants such as GSH, TSH, vitamin C and vitamin E. In the present study, there was a significant decrease in the level of GSH, TSH, vitamins C and E in the kidney of As exposed rats clearly signifies the oxidative stress which is in agreement with the findings of Sharmila Banu et al. [53] Thiols may play a crucial role in protecting cells against reactive oxygen species. Depleted levels of TSH and GSH represent an excess free radical production, which may be due to the binding of As with various sulfhydryls that exist in the cell [10]. Silibinin is reported to enhance the activity of c-glutamylcysteine synthetase and demonstrated simultaneous escalation in the intracellular glutathione level. Restoration of these non enzymatic antioxidants in the kidney of As along with silibinin treated rats could be related to its antioxidant stimulating activity [52]. Increase in GSH levels in turn contributes to the recycling of other antioxidants such as vitamins C and E. Therefore this property of silibinin might have resulted in the recoupment of the levels of these non-enzymatic antioxidants to near normalcy in As intoxicated rats. The determination of membrane associated enzyme activities like ATPases indicates the changes in membranes under pathological conditions [54]. In the present study a significant decrease in the activities of membrane bound total ATPases in the kidney was observed in As treated rats. Decreased activity of Na?/K? ATPase could be due to enhanced lipid peroxidation by free radicals on As induction, since Na?/K? ATPase is a ‘SH’ group containing enzyme and is lipid dependent [55]. Decreased activity of Na?/K? ATPase can lead to a decrease in sodium efflux, thereby altering membrane permeability [56]. The disruption of membrane permeability or fragmentation of the membrane leads to the leakage of Ca2? ions into cells thereby potentiating irreversible cell destruction. The Ca2? overload medicated by As also decreased the Ca2? ATPase activity in cell membrane. It is generally accepted that due to high affinity for SH groups, As binds avidly to various enzyme proteins and inactivates them. Mg2? ATPase activity is involved in other energy requiring process in the cell and its activity is sensitive to lipid peroxidation. Administration of silibinin in As intoxicated rats significantly reduced the lipid peroxidation in liver tissue and sustained the activities of membrane bound enzymes. This could be due to the ability of silibinin to protect the SH groups from the oxidative damage through the inhibition of
11213
peroxidation of membrane lipids and stabilization of the cell membrane [41]. In the present study As induced the expression of NF-jB and iNOS and elevated the levels of NO and TNF-a in renal tissues of rats. It has been demonstrated that increased NO production is implicated in As-mediated cytotoxicity and oxidative damage. TNF-a is a key element in a network of proinflammatory chemokines and cytokines activated in the kidney by As. Blockade of TNF-a action prevents the activation of this cytokine network and provides protection against As nephrotoxicity [57]. This can be explained by the ability of TNF-a to up-regulate the iNOS enzyme. Excess NO reacts with superoxide anion to generate peroxynitrite radical that causes further cell damage by oxidizing and nitrating cellular macromolecules. Also, excess NO depletes intracellular GSH increasing the susceptibility of the renal tissue to As mediated oxidative stress. Silibinin, was proved to be effective in reducing the generation of reactive oxygen species and pro-inflammatory mediators. The antioxidant and anti-inflammatory properties of silibinin related to its ability to prevent the activation of NF-jB signaling pathway which promotes the transcription of NADPH oxidase, TNF-a and iNOS genes [58]. This is in accordance with the present results which revealed that silibinin treatment significantly suppressed lipid peroxidation, maintained the antioxidant defense mechanisms, attenuated the overproduction of TNFa and NO and reduced the expression of NF-jB and iNOS in the kidney of rat exposed to As intoxication. Previous results have indicated that As induced apoptosis in cultured renal proximal tubular cells proceeds via both caspase dependent and caspase independent pathways, and that inhibition of the executioner caspase-3 blocks about 50 % of As-induced apoptosis. ROS plays an important role in mediating apoptosis by inducing the activation of caspases. Among all the caspase members, caspase-3 in particular is an essential apoptotic effector leading to cytoskeletal breakdown, nuclear demise, and other cell changes associated with apoptosis [59]. Mechanisms that activate caspases-8 and caspase-9 or executioner caspase-3 are all known to be involved in As induced tubular cell apoptosis and caspase inhibition markedly reduces kidney injury [57]. In our study As induced the caspase-3 expression in renal tubular cells and silibinin administration down regulated caspase-3 expression in an effective manner. These results suggest a possible antiapoptotic role of silibinin in diminishing the signal generated either via integral membrane death receptor proteins such as Fas and tnfr1 or via mitochondrial cytochrome-C release pathway, and finally reducing the expression of effector caspase-3, thereby attenuating the apoptotic death and disruption of renal tubular cells caused by As. The present study revealed that silibinin treatment significantly inhibited the As-induced expression of caspase-3, an
123
11214
executioner of cell apoptosis, in renal tissue. The antiapoptotic activity observed with silibinin treatment can be attributed to its free radical scavenging activity, antiinflammatory action with reduced TNF-a production and inhibition of NF-jB expression. However, this needs to be clarified by further investigations. Oxidative stress may be caused by either excess ROS production and/or deficient antioxidant capacity. It is likely that both upregulation of NADPH oxidase and downregulation Nrf2, a member of the cap-N-collar family, is the key transcription factor that regulates antioxidant response element-mediated expression of detoxifying antioxidant enzymes contributed to the ROS generation induced by chronic As exposure. Inhibition of ROS overproduction by stable over expression of Nrf2, or stable knockdown of NADPH oxidase, suppressed the As-induced oxidative renal dysfunction. In the present study, the expression NADPH oxidase was significantly increased and Nrf2 expression was significantly decreased in the renal tissue of As intoxicated rats clearly demonstrated the ROS mediated oxidative stress in the renal tissue. However, silibinin treatment significantly modulates the expression of NADPH oxidase and Nrf2 in As- mediated oxidative stress by downregulation of NADPH oxidase and upregulation Nrf2 in the kidney. Hence, this investigation should be considered an innovative assessment for the nephroprotective nature of silibinin in rats intoxicated with As. The renal defensive nature of silibinin is further confirmed by the histological findings. The histopathological observation in As treated rats showed the tubular necrosis, inflammatory cell infiltration, tubular degeneration, hemorrhage, swelling of tubules and vacuolization. This could be due to the accumulation of free radicals as the consequence of increased lipid peroxidation by free As ions in the renal tissue of As-treated rats. The increased formation of lipid peroxides and associated reactive oxygen species leads to damage in membrane integrity and other pathological changes in kidney tissue of As intoxicated rats. Administration of silibinin reduced the histological alterations provoked by As is quite appreciable. It can be attributed to the antiradical, antioxidant, anti-inflammatory and metal chelating efficacy of silibinin which significantly reduced the oxidative stress, leading to the reduction of histopathological alterations and restoration of normal physiological state of an organism. Further, the membrane stabilizing properties of silibinin might be helpful to alleviate the histopathological alterations caused by As in the kidney tissue of rats.
Conclusion The results of the present study indicate that silibinin significantly protected against As-induced nephrotoxicity in
123
Mol Biol Rep (2012) 39:11201–11216
rats. The antioxidant, anti-inflammatory, membrane stabilizing and antiapoptotic activities can be considered as the main factors responsible for the nephroprotective effect of silibinin against As induced oxidative renal damage. Therefore, silibinin represents a potential therapeutic option to prevent oxidative renal tissue injury and dysfunction resulting from As intoxication. Further detailed studies are in progress to elucidate the precise mechanism by which silibinin reduces the As renotoxicity.
References 1. Yadav RS, Sankhwar ML, Shukla RK, Chandra R, Pant AB, Islam F, Khanna VK (2009) Attenuation of arsenic neurotoxicity by curcumin in rats. Toxicol Appl Pharmacol 240:367–376 2. Ratnaike RN (2003) Acute and chronic arsenic toxicity. Postgrad Med J 79:391–396 3. Ginsburg JM (1965) Renal mechanism for excretion and transformation of arsenic in the dog. Am J Physiol 208:832–840 4. Liu J, Liu Y, Goyer RA, Achanzar W, Waalkes MP (2000) Metallothionein-I/II null mice are more sensitive than wild-type mice to the hepatotoxic and nephrotoxic effects of chronic oral or injected inorganic arsenicals. Toxicol Sci 55:460–467 5. Yang Y, Xia M, Jin Q, Bendahhou S, Shi J, Chen Y, Liang B, Lin J, Liu Y, Liu B, Zhou Q, Zhang D, Wan R, Ma N, Su X, Niu K, Pe Y, Xu W, Chen Z, Wan H, Cui J, Barhanin J, Chen Y (2004) Identification of a KCNE2 gain-of-function mutation in patients with familial atrial fibrillation. Am J Hum Genet 75:899–905 6. Lin A, Zhang X, Zhu YG, Zhao FJ (2008) Arsenate-induced toxicity: effects on antioxidative enzymes and DNA damage in Vicia faba. Environ Toxicol Chem 2:4139 7. Li Y, Ling M, Xu Y, Wang S, Li Z, Zhou J, Wang X, Liu Q (2010) The repressive effect of NF-kappaB on p53 by mot-2 is involved in human keratinocyte transformation induced by low levels of arsenite. Toxicol Sci 116:174–182 8. Taylor DJ, Green NPO, Stout GW, Soper R (2003) Biological sciences. Cambridge University Press, Cambridge, pp 680–692 9. Bhadauria S, Flora SJS (2007) Response of arsenic-induced oxidative stress, DNA damage and metal imbalance to combined administration of DMSA and monoisoamyl-DMSA during chronic arsenic poisoning in rats. Cell Biol Toxicol 23:91–104 10. Kokilavani V, Devi MA, Sivarajan K, Panneerselvam C (2005) Combined efficacies of DL-a9-Lipoic acid and meso 2,3-dimercaptosuccinic acid against arsenic induced toxicity in antioxidant system of rats. Toxicol Lett 160:1–7 11. Uivarosi V, Barbuceanu SF, Aldea V, Arama CC, Badea M, Olar R, Marinescu D (2010) Synthesis, spectral and thermal studies of new rutin vanadyl complexes. Molecules 15:1578–1589 12. Sakai K, Li Y, Shirakawa T, Kitagawa Y, Hirose G (2001) Induction of major histocompatibility complex I class molecules on human neuroblastoma line cells by a flavonoid antioxidant. Neurosci Lett 298:127–130 13. Zhou B, Wu LJ, Tashiro S, Onodera S, Uchiami F, Ikejima T (2006) Silibinin protects rat cardiac myocyte from isoproterenolinduced DNA damage independent on regulation on regulation of cell cycle. Biol Pharmacol Bull 29:1900–1905 14. Dietzmann J, Thiel U, Ansorge S, Neumann KH, Tager M (2002) Thiol-inducing and immunoregulatory effects of flavonoids in perinuclear blood mononuclear cells from patients with end-stage diabetic nephropathy. Free Radic Biol Med 33:1347–1354
Mol Biol Rep (2012) 39:11201–11216 15. Ligeret H, Brault A, Vellerand D, Hadded Y, Hadded PS (2008) Antioxidant and mitochondrial protective effects of silibinin in cold preservation warm reperfusion liver injury. J Ethnopharmacol 115:507–514 16. Niehiaus WG, Samuelsson D (1968) Formation of malondialdehyde from phospholipids arachidonate during microsomal lipid peroxidation. Eur J Biochem 6:126–130 17. Jiang ZY, Hunt JV, Wolff SD (1992) Ferrous ion oxidation in the presence of xylenol orange for detection of lipid hydroperoxide in low density lipoprotein. Ann Biochem 202:384–389 18. Levine RL, Garland D, Oliver CN, Amic A, Climent I, Lenz AG, Ahn BW, Shaltiel S, Stadtman ER (1990) Determination of carbonyl content in oxidatively modified proteins. Methods Enzymol 186:464–478 19. Moron MS, Despierre JW, Minnervik B (1979) Levels of glutathione, glutathione reductase and glutathione S-transferase activities in rat lung and liver. Biochim Biophys Acta 582: 67–78 20. Ellman GL (1959) Tissue sulfhydryl groups. Arch Biochem Biophys 82:70–77 21. Omaye ST, Turnbull JD, Sauberlich HE (1979) Selected methods for the determination of ascorbic acid in animal cells, tissues and fluids. Methods Enzymol 62:3–11 22. Desai ID (1984) Vitamin E analysis method for animal tissues. Methods Enzymol 105:138–143 23. Kakkar P, Das B, Viswanathan PN (1984) A modified spectrophotometric assay of superoxide dismutase. Indian J Biochem Biophys 21:130–132 24. Sinha AK (1972) Colorimetric assay of catalase. Ann Biochem 47:389–394 25. Rotruck JT, Rope AL, Ganther HF, Swason AB (1973) Selenium: biochemical role as a component of glutathione peroxidase. Science 179:588–590 26. Habig WH, Pabst MJ, Jakpoly WB (1974) Glutathione transferase: a first enzymatic step in mercapturic acid formation. J Biol Chem 249:7130–7139 27. Horn HD, Burns FH (1978) Assay of glutathione reductase activity. In: Bergmeyer HV (ed) Methods of enzymatic analysis. Academic Press, New York, pp 142–146 28. Beutler E (1983) Active transport of glutathione disulfide from erythrocytes. In: Larson A, Orrenius S, Holmgren A, Mannerwik B (eds) Functions of glutathione, biochemical, physiological, toxicological and clinical aspects. Raven Press, New York, p 65 29. Lowry OH, Rosenbrough MJ, Farr AL, Randall RJ (1951) Protein measurement with Folin–phenol reagent. J Biol Chem 193: 265–275 30. Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR (1982) Analysis of nitrate, nitrite, and [15N] nitrate in biological fluids. Anal Biochem 126:131–138 31. Evans DJ Jr (1969) Membrane adenosine triphosphatase of E. coli activation by calcium ions and inhibition by monovalent cations. J Bacteriol 100:914–922 32. Fiske CH, Subbarow Y (1925) The colorimetric determination of phosphorus. J Biol Chem 66:375–400 33. Bonting SL (1970) Presence of enzyme system in mammalian tissues. In: Bilter EE (ed) Membrane and ion transport. Wiley Inter Science, London, pp 257–263 34. Hjerten S, Pan H (1983) Purification and characterization of two forms of low affinity Ca??–ATPase from erythrocyte membrane. Biochim Biophys Acta 728:281–288 35. Ohnishi T, Suzuki T, Suzuki Y, Ozawa K (1982) A comparative study of plasma membrane Mg??–ATPase activities in normal, regenerating and malignant cells. Biochim Biophys Acta 684:67–74
11215 36. Shi H, Djikeng A, Tschudi C, Ullu E (2004) Argonaut protein in the early divergent eukaryote Trypanosoma brucei: control of small interfering RNA accumulation and retroposon transcript abundance. Mol Cell Biol 24:420–427 37. Sinha H, Manna P, Sil PC (2008) Arjunolic acid attenuates arsenic-induced nephrotoxicity. Pathophysiology 15:147–156 38. Muthumani M, Milton Prabu S (2012) Silibinin potentially protects arsenic induced oxidative hepatic dysfunction in rats. Toxicol Mech Methods 22:277–288 39. Rajnarayana K, Sripalreddy M, Chaluvadi MR, Krishna DR (2001) Bioflavonoids classification, pharmacological, biochemical effects and therapeutic potential. Indian J Pharmacol 33: 2–16 40. Patel HR, Kalia K (2010) Sub-chronic arsenic exposure aggravates nephrotoxicity in experimental diabetic rats. Indian J Exp Biol 48:762–768 41. Basiglio CL, Sanchez Pozzi EJ, Mottino AD, Roma MG (2009) Differential effects of silymarin and its active component SB on plasma membrane stability and hepatocellular lysis. Chem Biol Interact 179:297–303 42. Chou WC, Jie C, Kenedy AA, Jones RJ, Trush MA, Dang CV (2004) Role of NADPH oxidase in arsenic-induced reactive oxygen species formation and cytotoxicity in myeloid leukemia cells. Proc Natl Acad Sci 101:4578–4583 43. Usoh IF, Akpan EJ, Etim EO, Farombi EO (2005) Antioxidant actions of dried flower extracts of Hibiscus sabdariffa L. on sodium arsenite-induced oxidative stress in rats. Pakistan J Nutr 4:135–141 44. Yamanaka K, Hasegawa A, Sawamura R, Okada S (1991) Cellular response to oxidative damage in lung induced by administration of dimethyl arsenic acid, a major metabolite of inorganic arsenic in mice. Toxicol Appl Pharmacol 108:205–213 45. Kono Y, Fridovich I (1982) Superoxide radical inhibits catalase. J Biol Chem 257:5751–5754 46. Kirkman MN, Gaetani GF (1984) Catalase: a tetrameric enzyme with four tightly bound molecules of NADPH. Proc Nat Acad Sci USA 81:4343–4347 47. Danyelle TM, Kenneth TD (2003) The role of glutathione S-transferase in anticancer drug resistance. Drug Res 22:7369– 7375 48. Flora SJS, Kannan GM, Kumar P (1999) Selenium effects on gallium arsenite induced biochemical and immunotoxicological changes in rat. Chem Biol Interact 122:1–13 49. Ganyc D, Talbot S, Konate F, Jackson S, Schanen B, Cullen W, Self WT (2007) Impact of trivalent arsenicals on selenoprotein synthesis. Environ Health Perspect 115:346–353 50. Shila S, Kokilavani V, Subathra M (2005) Brain regional responses in antioxidant system to a-lipoic acid in arsenic intoxicated rat. Toxicology 210:25–36 51. Hughes MF (2002) Arsenic toxicity and potential mechanisms of action. Toxicol Lett 133:1–16 52. Haddad Y, Vallerand D, Brault A, Haddad PS (2011) Antioxidant and hepatoprotective effects of silibinin in a rat model of nonalcoholic steatohepatitis. Evid Based Complement Alternat Med. doi:10.1093/ecam/nep164 53. Sharmila Banu G, Kumar G, Murugesan AG (2009) Ethanolic leaf extract of Trianthema portulacastrum L. A meliorates aflatoxin B1 induced hepatic damage in rats. Indian J Clin Biochem 24:250–256 54. Kempaiah RK, Srinivasan K (2006) Protective effect of curcumin, capsaicin and garlic on erythrocyte integrity in high fat fed rats. J Nutr Biochem 17:471–478 55. Ithayarasi AP, Devi CS (1997) Effect of alpha-tocopherol on lipid peroxidation in isoproterenol induced myocardial infarction in rats. Indian J Physiol Pharmacol 41:369–376
123
11216 56. Finotti P, Palatini P (1986) Reduction of erythrocyte Na?/K? ATPase activity in type I insulin dependent diabetic subjects and its activation by homologus plasma. Diabetology 29:623–628 57. Das AK, Bag S, Sahu R, Dua TK, Sinha MK, Gangopadhyay M (2010) Protective effect of Corchorus olitorius leaves on sodium arsenite-induced toxicity in experimental rats. Food Chem Toxicol 48:326–335
123
Mol Biol Rep (2012) 39:11201–11216 58. Katiyar SK (2005) Silymarin and skin cancer prevention: antiinflammatory, antioxidant and immunomodulatory effects (review). Int J Oncol 26:169–176 59. Bratton SB, Cohen GM (2001) Apoptotic death sensor: an organelle’s alter ego? Trends Pharmacol Sci 22:306–315
