Parasitology International 66 (2017) 964–971
Contents lists available at ScienceDirect
Parasitology International journal homepage: www.elsevier.com/locate/parint
Simple detection of single nucleotide polymorphism in Plasmodium falciparum by SNP-LAMP assay combined with lateral flow dipstick Suganya Yongkiettrakul, Jantana Kampeera, Wanwisa Chareanchim, Roonglawan Rattanajak, Wichai Pornthanakasem, Wansika Kiatpathomchai, Darin Kongkasuriyachai ⁎ National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency, 113 Phahonyothin Road, Klong Nueng sub-district, Klong Luang district, Pathum Thani 12120, Thailand
a r t i c l e
i n f o
Article history: Received 29 May 2016 Received in revised form 20 September 2016 Accepted 25 October 2016 Available online 2 November 2016 Keywords: Plasmodium falciparum Malaria detection Pyrimethamine resistant Dihydrofolate reductase Single nucleotide polymorphism-loop mediated isothermal amplification SNP-LAMP
a b s t r a c t The significant strides made in reducing global malaria burden over the past decades are being threatened by the emergence of multi-drug resistant malaria. Mechanisms of resistance to several classes of antimalarial drugs have been linked to key mutations in the Plasmodium falciparum genes. Pyrimethamine targets the dihydrofolate reductase of the bifunctional dihydrofolate reductase thymidylate synthase (DHFR-TS), and specific point mutations in the dhfr-ts gene have been assigned to resistant phenotypes. Several molecular methods are available to detect the mutant genotypes including DNA sequencing and PCR-based methods. In this study, we report the development of PfSNP-LAMP to detect nucleotide polymorphism in the dhfr gene associated with N51I mutation and antifolate resistance. The PfSNP-LAMP method was validated with genomic DNA samples and parasite lysates prepared from sensitive and pyrimethamine resistant strains of P. falciparum. © 2016 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Significant strides has been made in reducing the global malaria burden through scale-up of prevention and vector control, and expansion of malaria diagnostics and treatment services. However in 2014, approximately 50% of the world's population remain at risk while 214 million malaria cases have been diagnosed and 438,000 died from malaria [1]. While the malaria burden remains higher in sub-Saharan Africa, many of the countries have achieved marked reduction in reported malaria cases. In high malaria burden areas, Intermittent Preventive Therapy (IPT) with pyrimethamine-sulfadoxine combination is provided to pregnant women, while seasonal malaria chemoprevention (SMC) is provided to children under-5 years old. Pyrimethamine resistant parasites have been reported since 1960's in Southeast Asia, thereafter, the resistance has been found in other parts of the world [2,3]. Specific point mutations in the dihydrofolate reductase of the bifunctional dihydrofolate reductase-thymidylate synthase (dhfr-ts) gene have been assigned to drug resistant phenotypes in malaria parasites: N51I, C59R, S108N/T, and N164I [4–6]. An amino acid substitution S108N in the dhfr gene can cause low level of pyrimethamine resistance, up to 100 folds more than wildtype, though
⁎ Corresponding author. E-mail address:
[email protected] (D. Kongkasuriyachai).
http://dx.doi.org/10.1016/j.parint.2016.10.024 1383-5769/© 2016 Elsevier Ireland Ltd. All rights reserved.
this single point mutation has not been found in the field samples [5,7, 8]. Each additional gain of mutations in the dhfr gene at one of the following positions would yield progressively higher pyrimethamine resistant phenotypes: N51I, C59R, and I164L [5,9–12]. The double mutants of N51I + S108N and C59R + S108N are resistant to pyrimethamine, while the double mutant (A16V + S108T) is sensitive to pyrimethamine but resistant to cycloguanil [6,11]. The triple mutant (N51I, C59R, and S108N) is 225 times more resistant than the wildtype lab strain, while the quadruple mutant (N51I, C59R, S108N, I164L) confers very high level of pyrimethamine and cycloguanil resistance, and is often found in Asia and Africa [11–16]. Triple mutant (N51I, S108N, and I164L) has been found in South America and Africa, while the triple mutant (N51I, C59R, S108N) has been found in South America [12,17,18]. Several methods are available to detect mutant phenotypes or genotypes. Short-term in vitro culture may be used to evaluate IC50 of the parasites against antimalarials, although the method is tedious and not practical for routine surveillance. Molecular detection of mutant genotypes can be an option if the drug resistant markers are known. To detect these point mutations, the protocols usually call for either DNA sequencing or restriction fragment length polymorphism (RFLP) of the amplified PCR products [4,5,19]. Real-time PCR using molecular beacon detect mutations associated with antifolate resistance in the malaria dhfr gene has also been developed [20]. Loop-mediated isothermal amplification (LAMP) offered an alternative molecular detection method for differentiation of malaria species
S. Yongkiettrakul et al. / Parasitology International 66 (2017) 964–971
965
Table 1 Description of primers and probe used to detect SNP associated with antifolate resistant at the nucleotide position 152 (AA 51). The bold and underlined nucleotide at the 5′ of the forward Pf-snp-FIP and the reverse Pf-snp-BIP matched to the SNP associated with antifolate resistant, a SNP substitution from an adenine (A) to a thymine (T) at position 152. The bold nucleotide represents changes in the oligonucleotides that were changed to optimize the thermodynamic properties of the primer. Primers and probe
Pf-snp-F3 Pf-snp-B3 Pf-snp-FIP Pf-snp-BIP Pf-FITC-probe
Sequence primers (5′-3′)
GATGGAACAAGTCTGCGACG GCTTTCCCAGCTTGTTCTTCC ATACATTTCCATGGTAATACTCTTT-TT-CTACACATTTAGAGGTC TTTCCCTAGATACGACATATTTTT-CAATTTTCCATATTTCGATTCATTC FITC-GTGCAGTTACAACATATGTGAATG
Length (bp)
20 21 44 49 24
that is not only simple and inexpensive, but also demonstrated sensitivity and specificity comparable to PCR method [21–23]. Indeed, LAMP method has been developed for allele specific detection or single nucleotide polymorphism (SNP) [24]. In this study, we report the development of PfSNP-LAMP to detect nucleotide polymorphism in the dhfr gene, position N51I mutation, associated with the antifolate resistance. The PfSNP-LAMP method was validated with genomic DNA samples and parasite lysates prepared from sensitive and pyrimethamine resistant strains of P. falciparum.
% GC
55 52 32 29 38
Tm (°C)
59 61 73 79 66
ΔG
−33.68 −37.07 −68.07 −82.66
End stability (kcal/mol)
Dimer
Hairpin
3′end
5′end
Found ΔG Found ΔG (kcal/mol) (kcal/mol)
−10.14 −8.19 −7.58 −6.95
−8.07 −8.63 −5.73 −8.53
5 1 3 7
−3.92 −6.34 −11.52 −6.76
None 1 1 None
−0.34 −0.17 −1.21
2.2. Parasite culture P. falciparum strains TM4/8.2 and V1/S were maintained in vitro culture by Trager and Jansen method previously reported [27]. Briefly, parasites are grown in human red blood cells (5% hematocrit) in RPMI1640 medium (Invitrogen, Carlsbad, CA, USA) that were supplemented with 0.3 g/L, L-glutamine, 5 g/L hypoxanthine, and 10% heat-inactivated human serum under 1% O2 and 5% CO2, at 37 °C. Percent parasitemia was determined by examination of thin-blood film stained with Giemsa and then examined under microscopy at 100× magnification to count the number of infected red blood cells (RBCs) per 1000 total RBCs.
2. Material and methods 2.3. Preparation of genomic DNA samples 2.1. Recombinant plasmid construction The respective wildtype (TM4/8.2) and quadruple mutant (V1/S; N51I + C59R + S108N + I164L) version of the P. falciparum dhfr-ts (Pfdhfr-ts) genes were cloned into pUC18 vector, to generate pUC18Pfdhfr-V1/S and pUC18-Pfdhfr-TM4/8.2, as previously described [25]. The pET17b-Pfdhfr-ts-V1/S containing quadruple mutant Pfdhfr was a gift from Dr. Penchit Chitnumsub et al. [26]. The Pfdhfr gene was released from the pET17b-Pfdhfr-ts-V1/S by double restriction digestion with HindIII and KpnI. The released fragments were separated by agarose gel electrophoresis, to cut out the desired band, and then purified using gel extraction kit according to manufacturer's protocol (Geneaid Biotech, Ltd., Taipei, Taiwan). The purified fragment was cloned into pUC18 at the HindIII and KpnI sites at the 5′ and 3′ ends, respectively.
Parasites were harvested for genomic DNA extraction [28]. Briefly, infected RBCs were lysed following treatment with 0.15% saponin and washed in PBS. Parasite pellet was resuspended in 20 mM Tris-HCl pH 7.5, 1 mM EDTA, 10% SDS, and 50 μg/mL Proteinase K, and allowed to incubate for 4 h at 50 °C. Following phenol:chloroform extraction, DNA was ethanol precipitated and washed with 70% ethanol and finally resuspended in 1 × TE buffer (10 mM Tris-HCl pH 7.5, 1 mM EDTA). Preparation of crude parasite lysates was prepared as previous [25]. 2.4. Preparation of parasite lysate or simplified parasite sample preparation Approximately 50 to 100 μL of an infected blood sample was collected. Each infected sample was diluted in equal volume of GuSCN
Fig. 1. A partial of Pfdhfrts gene (+1 to 360) which showed the position of 6 unique sequences of the SNP-LAMP primer set to detect the single nucleotide polymorphism at the position 152 (bold and underline). The nucleotides in bold only represent the positions where the thymine were changed to either a cytosine or guanine in the SNP-LAMP primer set to improve the melting temperature (Tm) and thermodynamic properties.
966
S. Yongkiettrakul et al. / Parasitology International 66 (2017) 964–971
extraction solution (2 M guanidine thiocyanate, 80 mM Tris-HCl pH 6.4, 35.2 mM EDTA pH 8.0, 2% Triton X-100). Mix well by vortex and allow to incubate at room temperature for 5 min. To collect the parasite lysate and remove cellular debris, samples were pelleted by microfuge centrifugation at 5000 rpm for 1 min. Supernatant was carefully collected as not to disturb the pelleted cell debris and transferred to a new microfuge tube. To prepare the stock samples of parasite lysate, 50 μL of parasite lysate were added to 450 μL distilled water (1:10 dilution). Serial dilutions of the stock samples were prepared to determine the lower detection limit of SNP-LAMP assay. In our experience, freshly collected inflected blood samples can be kept at 4 °C between 4 and 7 days. Based on our observation, once the parasite lysates are prepared, samples should be kept at −20 °C no more than 15 days. 2.5. Primer design The wildtype Pfdhfr sequence (TM4/8.2, accession number J03772.1) and the mutated Pfdhfr sequence (V1/S) were compared and used to design the specific primer sets to detect SNPs associated with antifolate resistance. Based on our previous experience with detection of malaria
LAMP using Pfdhfr gene, the high A–T rich sequences of the P. falciparum genome required manual design of the primer set [25]. The primer design processes needed to consider the physical and thermodynamic properties of individual primers as a concerted primer set that would work together to specifically recognized the SNP for subsequence selective amplification. The positions of primers to each other had to be within the specific range of distance apart from each other for efficient amplification of LAMP products as previously described [29,30]. The design also took in consideration to make sure that each primer pair, F3 versus B3 and FIP versus BIP, were relative comparable in length (basepair, bp), % G–C contents, and melting temperatures (Tm). Thermodynamic properties of the primers were also evaluated for optimal binding by comparing the ΔG, ΔH, and Δ S of each primer, calculated using Primer Premier (Premier Biosoft, Palo Alto, CA) (see Table 1). Care was also taken to avoid long stretches of nucleotide runs that could form primer dimers. Since the objective was to design primer set that can detect the SNP at position 152, the sequences spanning the Pf-snp-F1C and Pf-snp-B1C were designed first. The other primer sequence positions were adjusted accordingly. In some cases, specific nucleotide position had to be changed from thymine or adenine to
Fig. 2. (A) Approximate 4 μL of amplified SNP-LAMP were resolved on 2% agarose gel electrophoresis and stained in ethidium bromide. Lane M indicates DNA marker. Lane Neg indicates negative control or water control. The pUC18-Pfdhfr-TM4/8.2 (wildtype) was diluted at 610 ng, 400 ng, 300 ng, 200 ng, 20 ng, Lanes 1–5, respectively. The pUC18-Pfdhfr-V1/S (quadruple mutant) were diluted at 610 ng, 400 ng, 400 ng, 200 ng, 20 ng, 0.2 ng, 0.02 ng, and 0.002 ng, Lanes 6 to 14, respectively. (B) Amplified SNP-LAMP products were allowed to incubate with FITC probes for 5 min, then 8 μL of each product were transferred to a new microfuge-tube containing 120 assay buffer. The LFD strip was dipped into each tube to allow the buffer to transfer on to the strip in the direction of the arrow for approximately 5 min or until the signal appeared on the control line. For positive results, both the control and test lines must appear on the strip. For negative results, only the control line would appear. If no signal appears then the result is invalidated. Prior to applying samples to SNP-LAMP reaction, all DNA templates were subjected to PCR amplification of the dhfr gene product using conserved outer LAMP primer pairs to ensure sample quality (data not shown).
S. Yongkiettrakul et al. / Parasitology International 66 (2017) 964–971
cytosine in the final primer design to improve the thermodynamic properties for more efficient amplification of specific SNP-LAMP products. The SNP-LAMP primers consisted of 4 primers spanning across 6 unique sequences on the Pfdhfr-ts gene as shown in Fig. 1. The SNPLAMP primer set were designed to detect the SNP associated with the antifolate resistance where the asparagine (AAT) at residue 51 has been substituted with isoleucine (ATT). The outer primer pairs included the forward primer spanning the nucleotide positions +3 to +22 (Pfsnp-F3) and the reverse primer spanning the nucleotide positions + 313 to + 333 (Pf-snp-B3). The inner primer pairs consisted of the two tandem primers, Pf-snp-FIP and Pf-snp-BIP. The Pf-snp-FIP primer spanned two unique sequences, the forward snp-F2 sequence (nucleotide positions + 102 to + 118) and the reverse sequences Pf-snp-F1C (nucleotide positions +130 to +152). The Pf-snp-BIP primer spanned two unique sequences, the reverse snp-B2 sequence (nucleotide positions +195 to +219) and the forward sequences Pf-snp-B1C (nucleotide position + 152 to + 170). The DNA probe was conjugated with FITC at the 5′ end and spanned from nucleotide position + 176 to + 199 which would recognized the complementary sequences in the
967
loop region in the amplified SNP-LAMP products. These sequence modification in the primer sequences are highlighted in bold letters in Fig. 1 and Table 1. 2.6. SNP-LAMP-LFD conditions SNP-LAMP reactions were performed for 60 min at 63 °C in a 25 μL reaction mixture which contained the following components: 2 μM each of Pf-snp-FIP and Pf-snp-BIP primers, 0.2 μM each of Pf-snp-F3 and Pf-snp-B3 primers, 1 × thermopol-supplied reaction buffer (20 mM Tris-HCl, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 0.1% Triton X-100, pH 8.8), 0.4 M betaine (USB Corporation, Cleveland, OH, USA), 8 mM MgSO4 (Sigma-Aldrich, St. Louis, MO, USA), 1.4 mM dNTP mix (Promega, Madison, WI, USA), 8 units of Bst DNA polymerase (New England Biolab, Ipswich, MA, USA), 2 μL of template, DNA sample. To detect the amplified SNP-LAMP products, 20 picomole (pmol) PfFITC-probes were added directly to the SNP-LAMP reaction tube and allowed to incubate at 63 °C for 5 min to allow the probe to hybridize to the SNP-LAMP products. Then in a new tube, 8 μL of the hybridized
Fig. 3. Results from SNP-LAMP assay on genomic DNA (gDNA) extracted from P. falciparum cultures strains TM4/8.2 or V1/S. (A) Amplified SNP-LAMP were resolved on 2% agarose gel electrophoresis and stained with ethidium bromide. Lane M indicates DNA marker. Lane Neg indicates negative control or water control. (B) Results from SNP-LAMP assays from gDNA samples visualized by LFD strip. Lane Neg indicates negative control or water control. Lane 1 indicates 200 ng of pUC18-Pfdhfr-TM4/8.2. Lane 2 indicates 200 ng of pUC18-PfdhfrV1/S. Lanes 3 indicates 200 ng of gDNA from TM4/8.2. Lanes 4 to 10 indicate gDNA from V1/S diluted at 300 ng, 200 ng, 20 ng, 2 ng, 0.2 ng, 0.02 ng, and 0.002 ng, respectively. All gDNA samples were subjected to PCR amplification of the Pfdhfr gene using conserved outer LAMP primer pair to confirm samples quality prior to usage in SNP-LAMP (data not shown).
968
S. Yongkiettrakul et al. / Parasitology International 66 (2017) 964–971
SNP-LAMP-probe were transferred into a new Eppendorf tube containing 120 μL of assay buffer that has been pre-warmed at room temperature. Dip the LFD strip into the assay buffer (Milenia® GenLine HybriDetect, GieBen, Germany) and allowed the solution to migrate on the LFD strip by chromatography effect for approximately 5 min or until the positive purple-red band appear on the LFD strip. 3. Results 3.1. SNP-LAMP primer design and validation with recombinant clones of wildtype (TM4/8.2) and quadruple mutant (V1/S) Pfdhfr-ts The optimal condition for SNP-LAMP assay was determined to be at 63 °C for 60 min by varying the reaction temperatures and the reaction times (data not shown). The SNP-LAMP primer set, under optimal reaction conditions, could demonstrate specific detection of Pfdhfr SNP associated with antifolate resistance. Recombinant clones of either the TM4/
8.2 or V1/S Pfdhfr genes were serially diluted and subjected to SNPLAMP assay. In Fig. 2A, an agarose gel electrophoresis showed the results from SNP-LAMP assay where the SNP-LAMP (resistant) primer set could detect the characteristic ladder pattern normally observed in successfully LAMP reactions. The amplified SNP-LAMP results can only be observed in the lanes with pUC18-Pfdhfr-V1/S, but no SNP-LAMP produce could be observed in lanes with pUC18-Pfdhfr-TM4/8.2 samples. The detection limit for SNP-LAMP appears to be 0.02 ng of pUC18-Pfdhfr-V1/S. For detection by LFD, the SNP-LAMP products were incubated with specific FITC-labelled DNA probes that recognize the sequences of both wildtype and antifolate resistant Pfdhfr-sequences. In Fig. 2B, the DNA probes were able to detect positive testlines in pUC18-Pfdhfr-V1/ S samples up to 0.02 ng. The lack of positive testlines in the pUC18Pfdhfr-TM4/8.2 lanes can be explained by the lack amplified SNPLAMP products. These LFD results were in agreement with the results observed in the gel agarose electrophoresis.
Fig. 4. SNP-LAMP assay results with uninfected blood spiked with purified gDNA from either V1/S or TM4/8.2 parasites at varied concentration. (A) SNP-LAMP amplified products resolved on 2% agarose gel electrophoresis and then stained with ethidium bromide. Lane M is the DNA marker. (B) SNP-LAMP amplified products were hybridized with labelled probed and applied to the LFD strips for visualization. Lane N1 is negative water control. Lane N2 is negative control with red blood cell lysate. Lane 1 is positive control, 20 ng of pUC18-Pfdhfr-V1/S. Lane 2 is negative control, 20 ng of pUC18-Pfdhfr-TM4/8.2. Lanes 3–8 are gDNA V1/S diluted in red blood cell lysates in the amount of 100 ng, 20 ng, 2 ng, 0.2 ng, 0.02 ng, and 0.002 ng. Lanes 9–14 are gDNA TM4/8.2 diluted in red blood cell lysates in the amount of 100 ng, 20 ng, 2 ng, 0.2 ng, 0.02 ng, 0.002 ng.
S. Yongkiettrakul et al. / Parasitology International 66 (2017) 964–971
3.2. Validation of SNP-LAMP to detect N51I mutation from genomic DNA extracted from V1/S strain of P. falciparum Genomic DNA was extracted from in vitro parasite culture of TM4/ 8.2 and V1/S strains of P. falciparum grown to be used as template for SNP-LAMP protocol. Approximately 100 μL of parasite culture of 2% parasitemia was collected for genomic DNA preparation. Genomic DNA concentration was determined by UV spectrophotometer at absorbance 260 nm. The genomic DNA samples were serially diluted to
969
determine the detection limit which was observed to be 0.2 ng of V1/S genomic DNA (Fig. 3A). The SNP-LAMP amplification is specific as products could not be amplified when either genomic DNA TM4/8.2 samples were used as templates. When SNP-LAMP were combined the detection by LFD, the results were consistent with agarose gel electrophoresis (Fig. 3B). In order to determine if the parasite lysates would interfere with the efficiency of the SNP-LAMP detection, we spiked the purified genomic DNA in red blood cell lysate that was prepared by simple dilution of
Fig. 5. SNP-LAMP assays were performed on parasite lysates prepared from in vitro culture of V1/S and TM4/8.2 strains of P. falciparum, and the results are visualized by (A) agarose gel electrophoresis or by (B) LFD strip. Lane M is DNA marker. Lane N1 is negative water control and Lane N2 is negative red blood cell lysate. Lane 1 is positive control, 20 μg of pUC18-PfdhfrV1/S. Lane 2 is negative control, 20 μg of pUC18-Pfdhfr-TM4/8.2. Lanes 3–6 are diluted parasite lysates prepared from in vitro culture of Pf V1/S strain. Lanes 7–9 are diluted parasite lysates prepared from in vitro culture of Pf TM4/8.2 strain. The experiments were repeated two more times on different preparation of parasite cultures where each parasite lysate sample was subjected to quality check by PCR amplification of the Pfdhfr gene using conserved primer pair (data not shown).
970
S. Yongkiettrakul et al. / Parasitology International 66 (2017) 964–971
distilled water. The diluted genomic DNA spiked cell lysates was then used as template in the SNP-LAMP reactions. The result suggested that the genomic DNA spiked cell lysates showed specific but lowered SNP-LAMP assay efficiency by 10 folds with the detection limit at 2 ng of V1/S genomic DNA (Fig. 4A), when compared to the previous results (Fig. 3A). SNP-LAMP was applied to LFD strip readout which confirmed the results (Fig. 4B). 3.3. Validation of SNP-LAMP to detect N51I mutation from parasite lysates from V1/S strain of P. falciparum While we could demonstrate SNP-LAMP protocol to specifically detect the ATT polymorphism, corresponding to an isoleucine substitution at position 51 using purified genomic DNA diluted in distilled water or red cell lysate, ideally we would want to avoid genomic DNA extraction for more adaptable use outside of the laboratory. In our previous report, adding equal volume of water was sufficient to release the DNA content for efficient amplification and detection of species specific of either Pfdhfr or Pvdhfr by LAMP-LFD [25]. However, in this report, the addition of distilled water alone did not sufficiently lyse the infected parasite samples for efficient SNP-LAMP amplification (data not shown). This observation suggested that an efficient lysis of infected red blood cells appeared to be one of the key factors for successful amplification of SNP-LAMP products. We utilized a simplified protocol to prepare parasite lysate from fresh or frozen parasite samples that avoided the saponin treatment and subsequent nucleic acid purification steps. Serial dilutions of the stock samples were prepared to determine the lower detection limit of SNP-LAMP assay. Fig. 5A shows the lower detection limit of SNPLAMP to be 0.5% parasitemia (%P) of Pf V1/S parasite lysate, or equivalent to approximately 25,000 infected (or parasitized) RBCs. Fig. 5B shows the LFD readouts to be consistent the SNP-LAMP results in Fig. 5A. No cross-reaction of SNP-LAMP assays with TM4/8.2 samples was observed due to the specific primer design. 4. Discussion Mechanism of drug resistance in P. falciparum has been linked to SNPs in the corresponding parasite genes including mutation K76T in the chloroquine resistant transporter (Pfcrt) gene associated with chloroquine [31–33], and Y268S/N in the cytochrome b gene atovaquone resistance [34,35], mutation N86Y in the multi-drug resistance 1 (Pfmdr1) gene associated with resistance to mefloquine and amino quinolines [36], mutations S436A, A437G, K540E, A581G, and A613S/T in the dihydropteroate synthetase (Pfdhps) gene associated with sulfadoxine resistance [37,38], and mutations N51I, C59R, S108 N/T, and I164L in the Pfdhfr gene associated with pyrimethamine resistance [4,5,11]. Various molecular detection methods for SNP analysis in Pfdhfr gene have been described including allele-specific PCR [39], PCR-restriction fragment length polymorphism (RFLP) analysis [40,41], multiplex PCR (mPCR)-RFLP [42], dot blot hybridization method [43], molecular beacon method [20], real-time PCR [44], PCR-enzyme-linked immunosorbent assay [45], DNA sequencing and pyrosequencing [46], and multiplex PCR and DNA chip [47]. The SNP-LAMP was demonstrated that it can be used for SNP typing of CYP2C19 gene in human [24]. Another more recent study demonstrated the use of LAMP to detect specific allele associated with kdr-w mutation responsible for pyrethroid resistance in Anopheles gambiae s.l., a major vector for transmission of the human malaria parasite [48]. In this study, a method was developed to detect the specific allele associated with pyrimethamine resistance in P. falciparum. The method includes primer and probe designs, protocols for sample preparation and SNP-LAMP reaction, and LFD detection. Of note, attempts were made to design SNP-LAMP primers for S108N detection. However, the nearby sequences on either side of the S108N position are rich in A–T sequences and polynucleotide repeats. Several SNP-LAMP primer sets
were designed but could not distinguished between wildtype (S108) and quadruple mutant (N108) dhfr gene (data not shown). The N51I mutation is commonly reported in parasites with highly resistant to pyrimethamine. The current PfSNP-LAMP method showed 100% specificity, while further optimization of the PfSNP-LAMP method may improve the detection limit of the assay and make the method more useful as surveillance or diagnostic tools. For example, the addition of 1 or 2 loop primers can increase amplification efficiency of LAMP and improve detection limit of the assay as seen in Pfdhfr-LAMP [25]. Peptide nucleic acid (PNA) oligonucleotides have been shown to enhance preferential PCR amplification of small allelic products by binding and blocking amplification of the non-target allele [49]. The usefulness of PNA oligonucleotide is currently being explored to improve SNP-LAMP amplification, and thereby allowing for more flexibility during the design of SNPLAMP primers particularly for genes with high A–T content or tandem repeat of purine nucleotides. The key features that can make successful development of PfSNPLAMP method are good primer designs and simple sample preparation. As a proof of concept, the results demonstrated that SNP-LAMP method can be developed with sufficient sensitive and specific to distinguish single nucleotide polymorphism associated with drug resistant phenotype in the malaria parasites. Acknowledgements We are grateful to Dr. Yongyuth Yuthavong for his continuous support. We thank Dr. Penchit Chitnumsub for the pET17-Pfdhfr-ts V1/S plasmid. We thank Dr. Sumalee Kamchonwongpaisan for in vitro parasite culture sample. We also want to express our appreciation to the reviewers for their constructive and helpful suggestions on the manuscript. The authors have no conflict of interest to declare. This work was supported by the National Center for Genetic Engineering and Biotechnology (P-11-00646) and National Center for Science and Development Agency, Pathum Thani, Thailand. References [1] WHO, World Malaria Report, 2015. [2] A. Bjorkman, P.A. Phillips-Howard, The epidemiology of drug-resistant malaria, Trans. R. Soc. Trop. Med. Hyg. 84 (1990) 177–180. [3] C. Wongsrichanalai, A.L. Pickard, W.H. Wernsdorfer, S.R. Meshnick, Epidemiology of drug resistant malaria, Lancet Infect. Dis. 2 (4) (2002) 209–218. [4] A.F. Cowman, M.J. Morry, B.A. Biggs, G.A. Cross, S.J. Foote, Amino acid changes linked to pyrimethamine resistance in the dihydrofolate reductase-thymidylate synthase gene of Plasmodium falciparum, Proc. Natl. Acad. Sci. U. S. A. 85 (1988) 9109–9113. [5] D.S. Peterson, D. Walliker, T.E. Wellems, Evidence that a point mutation in dihydrofolate reductase-thymidylate synthase confers resistance to pyrimethamine in falciparum malaria, Proc. Natl. Acad. Sci. U. S. A. 85 (1988) 9114–9118. [6] Y. Yuthavong, T. Vilaivan, N. Chareonsethakul, S. Kamchonwongpaisan, W. Sirawaraporn, R. Quarrell, G. Lowe, Development of a lead inhibitor for the A16V + S108T mutant of dihydrofolate reductase from the cycloguanil-resistant strain (T9/94) of Plasmodium falciparum, J. Med. Chem. 43 (2000) 2738–2744. [7] A.C. Labbé, S. Patel, I. Crandall, K.C. Kain, A molecular surveillance system for global patterns of drug resistance in imported malaria, Emerg. Infect. Dis. 9 (2003) 33–36. [8] W. Sirawaraporn, S. Yongkiettrakul, R. Sirawaraporn, Y. Yuthavong, D.V. Santi, Plasmodium falciparum: asparagine mutant at residue 108 of dihydrofolate reductase is an optimal antifolate-resistant single mutant, Exp. Parasitol. 87 (1997) 245–252. [9] L.K. Basco, P. Eldin de Pécoulas, C.M. Wilson, J. Le Bras, A. Mazabraud, Point mutations in the dihydrofolate reductase-thymidylate synthase gene and pyrimethamine and cycloguanil resistance in Plasmodium falciparum, Mol. Biochem. Parasitol. 69 (1995) 135–138. [10] I. Khalil, A.M. RØnn, M. Alifrangis, H.A. Gabar, G.M. Satti, I.C. Bygbjerg, Dihydrofolate reductase and dihydropteroate synthase genotypes associated with in vitro resistance of Plasmodium falciparum to pyrimethamine, trimethoprim, sulfadoxine, and sulfamethoxazole, Am.J.Trop. Med. Hyg. 68 (2003) 586–589. [11] W. Sirawaraporn, T. Sathitkul, R. Sirawaraporn, Y. Yuthavong, D.V. Santi, Antifolateresistant mutants of Plasmodium falciparum dihydrofolate reductase, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 1124–1129. [12] S. Sridaran, S.K. McClintock, L.M. Syphard, K.M. Herman, J.W. Barnwell, V. Udhayakumar, Anti-folate drug resistance in Africa: meta-analysis of reported dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) mutant genotype frequencies in African Plasmodium falciparum parasite populations, Malar. J. 9 (2010) 247.
S. Yongkiettrakul et al. / Parasitology International 66 (2017) 964–971 [13] A. Nzila-Mounda, E.K. Mberu, C.H. Sibley, C.V. Plowe, P.A. Winstanley, W.M. Watkins, Kenyan Plasmodium falciparum field isolates: correlation between pyrimethamine and chlorcycloguanil activity in vitro and point mutations in the dihydrofolate reductase domain, Antimicrob. Agents Chemother. 42 (1998) 164–169. [14] J.C. Reeder, K.H. Rieckmann, B. Genton, K. Lorry, B. Wines, A.F. Cowman, Point mutations in the dihydrofolate reductase and dihydropteroate synthetase genes and in vitro susceptibility to pyrimethamine and cycloguanil of Plasmodium falciparum isolates from Papua New Guinea, Am.J.Trop. Med. Hyg. 55 (1996) 209–213. [15] S.J. Foote, D. Galatis, A.F. Cowman, Amino acids in the dihydrofolate reductasethymidylate synthase gene of Plasmodium falciparum involved in cycloguanil resistance differ from those involved in pyrimethamine resistance, Proc. Natl. Acad. Sci. U. S. A. 87 (1990) 3014–3017. [16] D.S. Peterson, W.K. Milhous, T.E. Wellems, Molecular basis of differential resistance to cycloguanil and pyrimethamine in Plasmodium falciparum malaria, Proc. Natl. Acad. Sci. U. S. A. 87 (1990) 3018–3022. [17] A.M. McCollum, A.C. Poe, M. Hamel, C. Huber, Z. Zhou, Y.P. Shi, P. Ouma, J. Vulule, P. Bloland, L. Slutsker, J.W. Barnwell, V. Udhayakumar, A.A. Escalante, Antifolate resistance in Plasmodium falciparum: multiple origins and identification of novel dhfr alleles, J. Infect. Dis. 194 (2006) 189–197. [18] J.F. Cortese, A. Caraballo, C.E. Contreras, C.V. Plowe, Origin and dissemination of Plasmodium falciparum drug-resistance mutations in South America, J. Infect. Dis. 186 (2002) 999–1006. [19] P. Eldin de Pécoulas, L.K. Basco, B. Abdallah, M.K. Djé, J. Le Bras, A. Mazabraud, Detection of antifolate resistance by mutation-specific restriction enzyme digestion, Exp. Parasitol. 80 (3) (1995) 483–487. [20] R. Durand, J. Eslahpazire, S. Jafari, J.F. Delabre, A. Marmorat-Khuong, J.P. di Piazza, J. Le Bras, Use of molecular beacons to detect an antifolate resistance-associated mutation in Plasmodium falciparum, Antimicrob. Agents Chemother. 44 (2000) 3461–3464. [21] E.T. Han, R. Watanabe, J. Sattabongkot, B. Khuntirat, J. Sirichaisinthop, H. Iriko, L. Jin, S. Takeo, T. Tsuboi, Detection of four Plasmodium species by genus- and species-specific loop-mediated isothermal amplification for clinical diagnosis, J. Clin. Microbiol. 45 (2007) 2521–2528. [22] D.H. Paris, M. Imwong, A.M. Faiz, M. Hasan, E.B. Yunus, K. Silamut, S.J. Lee, N.P. Day, A.M. Dondorp, Loop-mediated isothermal PCR (LAMP) for the diagnosis of falciparum malaria, Am.J.Trop. Med. Hyg. 77 (2007) 972–976. [23] L.L. Poon, B.W. Wong, E.H. Ma, K.H. Chan, L.M. Chow, W. Abeyewickreme, N. Tangpukdee, K.Y. Yuen, Y. Guan, S. Looareesuwan, J.S. Peiris, Sensitive and inexpensive molecular test for falciparum malaria: detecting Plasmodium falciparum DNA directly from heat-treated blood by loop-mediated isothermal amplification, Clin. Chem. 52 (2006) 303–306. [24] M. Iwasaki, T. Yonekawa, K. Otsuka, H. Kanda, Validation of the loop-mediated isothermal amplification method for single nucleotide polymorphism genotyping with whole blood, Genome Lett. 2 (3) (2003) 119–126. [25] S. Yongkiettrakul, W. Jaroenram, N. Arunrut, W. Chareanchim, S. Pannengpetch, R. Suebsing, W. Kiatpathomchai, W. Pornthanakasem, Y. Yuthavong, D. Kongkasuriyachai, Application of loop-mediated isothermal amplification assay combined with lateral flow dipstick for detection of Plasmodium falciparum and Plasmodium vivax, Parasitol. Int. 63 (2014) 777–784. [26] P. Chitnumsub, J. Yuvaniyama, J. Vanichtanankul, S. Kamchonwongpaisan, M.D. Walkinshaw, Y. Yuthavong, Characterization, crystallization and preliminary X-ray analysis of bifunctional dihydrofolate reductase-thymidylate synthase from Plasmodium falciparum, Acta Crystallogr. D Biol. Crystallogr. 60 (2004) 780–783. [27] W. Trager, J.B. Jensen, Human malaria parasites in continuous culture, Science 193 (1976) 673–675. [28] K. Moll, I. Ljungström, H. Perlmann, A. Scherf, M. Wahlgren (Eds.), Methods in Malaria Research, 5thMR4/ATCC, Manassas, VA, 2008. [29] T. Notomi, H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Amino, T. Hase, Loop-mediated isothermal amplification of DNA, Nucleic Acids Res. 28 (2000), E63. [30] Eiken Chemical Co., Ltd., The principle of LAMP method, design of primers, http:// loopamp.eiken.co.jp/e/lamp/primer.html/2016 (accessed 22.05.16)31. [31] D.A. Fidock, T. Nomura, A.K. Talley, R.A. Cooper, S.M. Dzekunov, M.T. Ferdig, L.M. Ursos, A.B. Sidhu, B. Naudé, K.W. Deitsch, X.Z. Su, J.C. Wootton, P.D. Roepe, T.E. Wellems, Mutations in the P. falciparum digestive vacuole transmembrane protein PfCRT and evidence for their role in chloroquine resistance, Mol. Cell 6 (2000) 861–871.
971
[32] A. Djimdé, O.K. Doumbo, J.F. Cortese, K. Kayentao, S. Doumbo, Y. Diourté, D. Coulibaly, A. Dicko, X.Z. Su, T. Nomura, D.A. Fidock, T.E. Wellems, C.V. Plowe, A molecular marker for chloroquine-resistant falciparum malaria, N. Engl. J. Med. 344 (2001) 257–263. [33] D.J. Johnson, D.A. Fidock, M. Mungthin, V. Lakshmanan, A.B. Sidhu, P.G. Bray, S.A. Ward, Evidence for a central role for PfCRT in conferring plasmodium falciparum resistance to diverse antimalarial agents, Mol. Cell 15 (2004) 867–877. [34] M. Korsinczky, N. Chen, B. Kotecka, A. Saul, K. Rieckmann, Q. Cheng, Mutations in Plasmodium falciparum cytochrome b that are associated with atovaquone resistance are located at a putative drug-binding site, Antimicrob. Agents Chemother. 44 (2000) 2100–2108. [35] L. Musset, O. Bouchaud, S. Matheron, L. Massias, J. Le Bras, Clinical atovaquoneproguanil resistance of Plasmodium falciparum associated with cytochrome b codon 268 mutations, Microbes Infect. 8 (2006) 2599–2604. [36] M.B. Reed, K.J. Saliba, S.R. Caruana, K. Kirk, A.F. Cowman, Pgh1 modulates sensitivity and resistance to multiple antimalarials in Plasmodium falciparum, Nature 403 (2000) 906–909. [37] D.R. Brooks, P. Wang, M. Read, W.M. Watkins, P.F. Sims, J.E. Hyde, Sequence variation of the hydroxymethyldihydropterin pyrophosphokinase: dihydropteroate synthase gene in lines of the human malaria parasite, Plasmodium falciparum, with differing resistance to sulfadoxine, Eur. J. Biochem. 224 (1994) 397–405. [38] T. Triglia, A.F. Cowman, Primary structure and expression of the dihydropteroate synthetase gene of Plasmodium falciparum, Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 7149–7153. [39] J.W. Zolg, G.X. Chen, J.R. Plitt, Detection of pyrimethamine resistance in plasmodium falciparum by mutation-specific polymerase chain reaction, Mol. Biochem. Parasitol. 39 (1990) 257–265. [40] M.T. Duraisingh, J. Curtis, D.C. Warhurst, Plasmodium falciparum: Detection of polymorphisms in the dihydrofolate reductase and dihydropteroate synthetase genes by PCR and restriction digestion, Exp. Parasitol. 89 (1998) 1–8. [41] C.V. Plowe, J.F. Cortese, A. Djimde, O.C. Nwanyanwu, W.M. Watkins, P.A. Winstanley, J.G. Estrada-Franco, R.E. Mollinedo, J.C. Avila, J.L. Cespedes, D. Carter, O.K. Doumbo, Mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase and epidemiologic patterns of pyrimethamine-sulfadoxine use and resistance, J. Infect. Dis. 176 (1997) 1590–1596. [42] M.I. Veiga, P.E. Ferreira, A. BjÖrkman, J.P. Gil, Multiplex PCR-RFLP methods for pfcrt, pfmdr1 and pfdhfr mutations in plasmodium falciparum, Mol. Cell. Probes 20 (2006) 100–104. [43] A.M. Abdel-Muhsin, L.C. Ranford-Cartwright, A.R. Medani, S. Ahmed, S. Suleiman, B. Khan, P. Hunt, D. Walliker, H.A. Babiker, Detection of mutations in the plasmodium falciparum dihydrofolate reductase (dhfr) gene by dot-blot hybridization, Am.J.Trop. Med. Hyg. 67 (2002) 24–27. [44] P.E. Wilson, A.P. Alker, S.R. Meshnick, Real-time PCR methods for monitoring antimalarial drug resistance, Trends Parasitol. 21 (2005) 278–283. [45] M. Alifrangis, S. Enosse, R. Pearce, C. Drakeley, C. Roper, I.F. Khalil, W.M. Nkya, A.M. RØnn, T.G. Theander, I.C. Bygbjerg, A simple, high-throughput method to detect plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. Falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent assay-based technology, Am.J.Trop. Med. Hyg. 72 (2005) 155–162. [46] Z. Zhou, A.C. Poe, J. Limor, K.K. Grady, I. Goldman, A.M. McCollum, A.A. Escalante, J.W. Barnwell, V. Udhayakumar, Pyrosequencing, a high-throughput method for detecting single nucleotide polymorphisms in the dihydrofolate reductase and dihydropteroate synthetase genes of Plasmodium falciparum, J. Clin. Microbiol. 44 (2006) 3900–3910. [47] G.Q. Zhang, Y.Y. Guan, H.H. Sheng, B. Zheng, S. Wu, H.S. Xiao, L.H. Tang, Multiplex PCR and oligonucleotide microarray for detection of single-nucleotide polymorphisms associated with Plasmodium falciparum drug resistance, J. Clin. Microbiol. 46 (2008) 2167–2174. [48] A. Badolo, K. Okado, W.M. Guelbeogo, H. Aonuma, H. Bando, S. Fukumoto, N. Sagnon, H. Kanuka, Development of an allele-specific, loop-mediated, isothermal amplification method (AS-LAMP) to detect the L1014F kdr-w mutation in Anopheles gambiae s.l, Malar. J. 11 (2012) 227. [49] D.B. Demers, E.T. Curry, M. Egholm, A.C. Sozer, Enhanced PCR amplification of VNTR locus D1S80 using peptide nucleic acid (PNA), Nucleic Acids Res. 23 (1995) 3050–3055.
