Slp4-a/Granuphilin-a Regulates Dense-core Vesicle Exocytosis in ...

THE JOURNAL OF BIOLOGICAL CHEMISTRY © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 277, No. 42, Issue of October 18, pp. 39673–39678, 2002 Printed in U.S.A.

Slp4-a/Granuphilin-a Regulates Dense-core Vesicle Exocytosis in PC12 Cells* Received for publication, May 30, 2002, and in revised form, July 22, 2002 Published, JBC Papers in Press, August 9, 2002, DOI 10.1074/jbc.M205349200

Mitsunori Fukuda‡, Eiko Kanno, Chika Saegusa, Yukie Ogata, and Taruho S. Kuroda From the Fukuda Initiative Research Unit, RIKEN (The Institute of Physical and Chemical Research), 2-1 Hirosawa, Wako, Saitama 351-0198, Japan

Synaptotagmin-like protein 4-a (Slp4-a)/granuphilin-a was originally identified as a protein specifically associated with insulin-containing vesicles in pancreatic ␤-cells (Wang, J., Takeuchi, T., Yokota, H., and Izumi, T. (1999) J. Biol. Chem. 274, 28542–28548). Previously, we showed that the N-terminal Slp homology domain of Slp4-a interacts with the GTP-bound form of Rab3A, Rab8, and Rab27A both in vitro and in intact cells (Kuroda, T. S., Fukuda, M., Ariga, H., and Mikoshiba, K. (2002) J. Biol. Chem. 277, 9212–9218). How Slp4-a䡠Rab complex controls regulated secretion, and which Rab isoforms dominantly interact with Slp4-a in vivo, however, have remained unknown. In this study, we showed by immunocytochemistry and subcellular fractionation that three Rabs, Rab3A, Rab8, and Rab27A, and Slp4-a are endogenously expressed in neuroendocrine PC12 cells and localized on dense-core vesicles, and we discovered that the Slp4-a䡠Rab8 and Slp4-a䡠Rab27A complexes, but not Slp4-a䡠Rab3A complexes, are formed on dense-core vesicles in PC12 cells, although the majority of Rab8 is present in the cell body and is free of Slp4-a. We further showed that expression of Rab27A, but not of Rab8, promotes high KCl-dependent secretion of neuropeptide Y (NPY) in PC12 cells, whereas expression of Slp4-a, but not of an Slp4-a mutant incapable of Rab27A binding, inhibits NPY secretion in PC12 cells. In contrast, expression of Slp3-a, but not of Slp3-b lacking an N-terminal Rab27A-binding domain, promotes NPY secretion. These findings suggest that the Slp family controls regulated dense-core vesicle exocytosis via binding to Rab27A. The synaptotagmin-like protein (Slp)1 family was originally identified as proteins that share homology to tandem C2 domains of the synaptotagmin (Syt) family (1), and it was subsequently defined as proteins that contain a unique N-terminal Slp homology domain (SHD) (2) and C-terminal tandem C2 domains (known as the C2A domain and C2B domain), which are putative Ca2⫹-binding motifs (2). To date, five members of the Slp family (Slp1/Jfc1, Slp2-a, Slp3-a, Slp4-a/granuphilin-a, and Slp5) have been described in the mouse and human (1–5), and several alternative splicing isoforms have been identified in Slp2, Slp3, and Slp4 (2, 4). * This work was supported in part by grants from the Science and Technology Agency to Japan (to M. F.) and Grant 13780624 from the Ministry of Education, Science, and Culture of Japan (to M. F.). ‡ To whom correspondence should be addressed. Tel.: 81-48-4624994; Fax: 81-48-462-4995; E-mail: [email protected]. 1 The abbreviations used are: Slp(s), synaptotagmin-like protein(s); GST, glutathione S-transferase; HRP, horseradish peroxidase; NPY, neuropeptide Y; SHD, Slp homology domain; Slac2, Slp homologue lacking C2 domains; Syt, synaptotagmin; GTP␥S, guanosine 5⬘-O(3-thiotriphosphate). This paper is available on line at http://www.jbc.org

The SHD consists of two conserved domains, referred to as SHD1 and SHD2 (2). The SHD1 and SHD2 of Slp3-a, Slp4-a, and Slp5 are separated by a sequence containing two zincfinger motifs, whereas Slp1 and Slp2-a lack such zinc-finger motifs, and their SHD1 and SHD2 are linked (2). The SHD has also been found in other proteins, including Slac2-a (Slp homologue lacking C2 domains-a)/melanophilin (2, 6, 7), Slac2-b/ KIAA0624 (8, 9), and Slac2-c/MyRIP (10).2 We recently discovered that the SHD of the Slp family and Slac2 functions as an effector domain for specific Rab (7, 9), a small GTP-binding protein believed to be essential for membrane trafficking in eukaryotic cells (reviewed in Refs. 11–13). All SHDs directly interact with the GTP-bound form of Rab27A (and possibly Rab27B), both in vitro and in intact cells (5, 7, 9, 10, 14 –16), but the Slp4-a SHD is exceptional because it can also interact with Rab8 and Rab3A (9, 16), whereas the others only recognize Rab27 isoforms among the Rabs we have tested (more than 20 Rabs) (5, 7, 9).2 Since mutations in the rab27A gene cause defects in granule exocytosis in cytotoxic T lymphocytes and melanosome transport in human Griscelli syndrome and ashen mice (17–22), we hypothesized previously that the Slp family and Slac2 are involved in such membrane trafficking (9). Consistent with this, Slac2-a has recently been identified as a “missing link” between Rab27A in the melanosome and myosin Va, an actinbased motor, indicating that formation of a tripartite protein complex (Rab27A䡠Slac2-a䡠myosin Va) is crucial for melanosome transport (7, 16, 23–25). In contrast, however, functional involvement of the Slp family in Rab27-dependent membrane trafficking (especially in regulated granule exocytosis) remained to be clarified. In this study, we demonstrated that the Slp4-a䡠Rab27A complex is formed on dense-core vesicles in vivo and controls regulated secretion (high KCl-dependent neuropeptide Y (NPY) secretion) by using PC12 cells in which Slp4-a, Rab3A, Rab8, and Rab27A were endogenously expressed. Based on our findings, we discuss the function of the Slp family as effectors for Rab27A in regulated dense-core vesicle exocytosis. EXPERIMENTAL PROCEDURES

Antibody Production—cDNA encoding the C2B domain of mouse Slp4-a/granuphilin-a (amino acids 489 – 673) (4, 9) was amplified by the conventional PCR and subcloned into the pGEX-4T-3 vector (named pGEX-Slp4-a-C2B) (Amersham Biosciences), as described previously (26). GST (glutathione S-transferase) fusion proteins were expressed and purified on glutathione-Sepharose beads by the standard method (27). New Zealand White rabbits were immunized with purified GSTSlp4-a-C2B, and anti-Slp4-a antibody was affinity-purified by exposure to antigen-bound Affi-Gel 10 beads (Bio-Rad), as described previously (28). The specificity of the antibody was checked by immunoblotting

2 M. Fukuda and T. S. Kuroda (2002) J. Biol. Chem. 10.1074/ jbc.M203862200.

39673

39674

Slp4-a Functions as a Rab27A Effector in PC12 Cells

with recombinant T7-tagged Slp1, Slp2-a, Slp3-a, Slp4-a, Slp5, rabphilin, and Syt I expressed in COS-7 cells (29, 30) (see Fig. 1B). Anti-Rab3A rabbit polyclonal antibody was obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Anti-Rab3A, anti-Rab8, and anti-Rab27A mouse monoclonal antibodies were from Transduction Laboratories (Lexington, KY). Horseradish peroxidase (HRP)-conjugated anti-FLAG tag and anti-synaptophysin mouse monoclonal antibodies were from Sigma. HRP-conjugated anti-T7 tag antibody was from Novagen (Madison, WI). Construction of Expression Vectors and Transfections—pEF-T7-Slp4a-⌬SHD (amino acids 144 – 673), pEF-T7-GST-Slp4-a, and pEF-T7-GST vectors were constructed by PCR essentially as described previously (7). pEF-FLAG-Rab27A mutants (E14A, I18A, V21A, or D32A) were similarly constructed by PCR using the following mutagenic oligonucleotides with appropriate restriction enzyme sites (underlined below): 5⬘CGGATCCATGTCGGAGATACTAGACCTCTCTTTTCTGTCCGAGATGGCAAGG-3⬘ (E14A primer), 5⬘-GGATCCATGTCGGAGATACTAGACCTCTCTTTTCTGTCCGAGATGGAAAGGGATTTGGCCCTC-3⬘ (I18A primer), 5⬘-ATCTCTCTGCAGAGCACCGA-3⬘ (V21A primer), and 5⬘-GAGCTCATTCTTCAGTCGCCGAATCCTTTTCTCAGCTGC-3⬘ (D32A primer). pEF-FLAG-Rab27A(T23N) and -Rab27A(Q78L) were prepared as described elsewhere.2 Other expression vectors (pEF-T7-Slp1, -Slp2-a, -Slp3-a, -Slp4-a, -Slp5, -rabphilin, -Syt I, pEF-FLAG-Rab3A, -Rab8, and -Rab27A) were prepared as described previously (2, 5, 9, 26, 31). A 4-␮g amount of each plasmid was transfected into COS-7 cells (7.5 ⫻ 105 cells, the day before transfection/10-cm dish) or PC12 cells (3 ⫻ 106 cells, the day before transfection/6-cm dish coated with collagen type I) by using LipofectAMINE Plus or LipofectAMINE 2000 reagent (Invitrogen), respectively, according to the manufacturer’s notes (28, 32, 33). Immunoprecipitation and Immunoblotting—PC12 cells (two confluent 10-cm dishes) were homogenized in a buffer containing 1 ml of 50 mM HEPES-KOH, pH 7.2, 150 mM NaCl, 0.5 mM GTP␥S, and protease inhibitors (0.1 mM phenylmethylsulfonyl fluoride, 10 ␮M leupeptin, and 10 ␮M pepstatin A) in a glass Teflon Potter homogenizer with 10 strokes at 900 –1000 rpm, and proteins were solubilized with 1% Triton X-100 at 4 °C for 1 h. After removal of insoluble materials by centrifugation at 15,000 rpm for 10 min, the supernatant was incubated with either anti-Slp4-a-C2B IgG or control rabbit IgG (10 ␮g/ml) for 1 h at 4 °C and then incubated with protein A-Sepharose beads (Amersham Biosciences) for 1 h at 4 °C. After washing the beads five times with 50 mM HEPES-KOH, pH 7.2, 150 mM NaCl, 0.2% Triton X-100, and protease inhibitors, the immunoprecipitates were subjected to 10% SDS-PAGE followed by immunoblotting with anti-Rab3A rabbit antibody (1⁄200 dilution), anti-Rab3A (1⁄500 dilution), anti-Rab8 (1⁄1000 dilution), antiRab27A (1⁄250 dilution) mouse monoclonal antibodies, or anti-Slp4-a antibody (1 ␮g/ml dilution), as described previously (31). The blots shown in this study are representative of at least two or three independent experiments. Three days after transfection, PC12 cells (6-cm dish) expressing either T7-GST-Slp4-a or T7-GST, as a control, were harvested and homogenized in 1 ml of the homogenization buffer described above. After solubilization with 1% Triton X-100, insoluble materials were removed by centrifugation, and the expressed GST fusion proteins were affinity-purified on glutathione-Sepharose beads (wet volume, 20 ␮l; Amersham Biosciences) according to the manufacturer’s notes. After extensively washing the beads with 10 mM HEPES-KOH, pH 7.2, 150 mM NaCl, and 0.2% Triton X-100, proteins bound to the beads were analyzed by 10% SDS-PAGE followed by immunoblotting with anti-Rab antibodies or HRP-conjugated anti-T7 tag antibody (1⁄10,000 dilution). Miscellaneous Procedures—NPY-T7-GST secretion assay in PC12 cells was performed as described previously (34). Subcellular fractionation of PC12 cells by a linear sucrose gradient (0.6 –1.8 M) was performed as described previously (35, 36). The distribution of dense-core vesicles and synaptic-like microvesicles was determined by using antiSyt IX (1 ␮g/ml) (29) and anti-synaptophysin (1⁄4000 dilution) antibodies, respectively. Immunocytochemical analysis of nerve growth factor-differentiated PC12 cells was also performed as described previously (28, 33). T7-tagged Slp4-a mutants and FLAG-tagged Rab (Rab3A, Rab8, or Rab27A) were co-expressed in COS-7 cells, and the association of these two proteins was evaluated by immunoprecipitation as described previously (7, 31). RESULTS

Expression of Rab3A, Rab8, Rab27A, and Slp4-a in PC12 Cells—Our previous in vitro GST pull-down assay showed that the SHD of Slp4-a preferentially binds Rab8 and Rab27A and

FIG. 1. Expression of Rab3A, Rab8, Rab27A, and Slp4-a in PC12 cells. A, expression of Rab3A, Rab8, and Rab27A in PC12 cells. The same amounts of recombinant FLAG-tagged Rab3A, Rab8, or Rab27A expressed in COS-7 cells (lanes 1–3) and total homogenates of PC12 cells (20 ␮g; lane 4) were loaded on 10% SDS-PAGE and immunoblotted with HRP-conjugated anti-FLAG (bottom panel), anti-Rab3A, -Rab8, or -Rab27A-specific antibody. Immunoreactive bands were captured by Gel Print 2000i/VGA and analyzed with Basic Quantifier Software (Bio Image). The intensities of three Rabs in PC12 cells were calibrated by FLAG-tagged recombinant proteins (Rab8:Rab3A:Rab27A is ⬃1:0.4:⬍ 0.1). B, expression of Slp4-a in PC12 cells (lane 8). The specificity of anti-Slp4-a antibody was confirmed by using recombinant T7-Slp1–5, -rabphilin, and -Syt I expressed in COS-7 cells (lanes 1–7). The positions of the molecular weight markers (⫻ 10⫺3) are shown on the left.

weakly interacts with Rab3A, whereas other SHDs specifically bind Rab27A (9). To attempt to determine which Rabs are in vivo binding partners of Slp4-a, we used specific antibodies to search for cell line(s) in which these three Rabs and Slp4-a are endogenously expressed. The specificity of each antibody used in this study (anti-Rab3A, anti-Rab8, anti-Rab27A, and antiSlp4-a antibodies) was confirmed by immunoblotting with recombinant FLAG-Rabs and recombinant T7-Slps, rabphilin,

Slp4-a Functions as a Rab27A Effector in PC12 Cells and Syt I (Fig. 1A, lanes 1–3 and Fig. 1B, lanes 1–7). The anti-Slp4-a antibody only recognized T7-Slp4-a, not the other Slps, including Slp5, a close homologue of Slp4-a (5). PC12 cells were found to express all four proteins (Fig. 1A, lane 4, and 1B, lane 8). Quantitative analysis indicated that the ratio of the amounts of the three Rabs in descending order was Rab8: Rab3A:Rab27A ⫽ 1:0.4:⬍ 0.1 (Fig. 1A). The level of expression of Slp4-a was lower than in the pancreas (i.e. pancreatic ␤-cells; data not shown). To investigate whether Slp4-a䡠Rab complex is actually formed in vivo, an immunoprecipitation experiment was performed using anti-Slp4-a-specific antibody (Fig. 2A, lane 3). Consistent with our previous in vitro binding experiments (9), Rab8 and Rab27A were found to co-immunoprecipitate with Slp4-a, whereas hardly any Rab3A was detected in the anti-Slp4-a IgG immunoprecipitates (Fig. 2A, lane 3). In contrast, none of the Rabs were detected in the control IgG immunoprecipitates (Fig. 2A, lane 2). Since the amounts of bound Rab8 and Rab27A were significantly reduced in the absence of GTP␥S, Slp4-a should recognize the GTP-bound form of Rab8 and Rab27A even under the in vivo conditions (data not shown). Similar results were obtained when exogenously expressed GST-Slp4-a was used (Fig. 2B, lane 2): GSTSlp4-a bound both Rab8 and Rab27A but only a trace amount of Rab3A. Although the relative amount of Rab27A was less than 10% of that of Rab8 in PC12 cells, Slp4-a efficiently co-immunoprecipitated with Rab27A, indicating that Slp4-a prefers Rab27A to Rab8 or Rab3A as an in vivo binding partner. Slp4-a䡠Rab8 and Slp4-a䡠Rab27A Complexes on Dense-core Vesicles in PC12 Cells—PC12 cells contain two types of secretory vesicles, i.e. dense-core vesicles and synaptic-like microvesicles, and they are often utilized for analysis of regulated secretion. Since Slp4-a/granuphilin-a was first identified as a protein that specifically associated with insulin-containing dense-core vesicles (4), we next investigated whether Slp4-a and three Rabs are localized on the dense-core vesicles of PC12 cells. As shown in Fig. 3, Rab3A (Fig. 3A, green), Rab8 (Fig. 3D, green), Rab27A (Fig. 3G, green), and Slp4-a (Fig. 3, B, E, and H, red) were found to be predominantly localized in the distal portion of neurites, where dense-core vesicles were enriched (Fig. 3, C, F, and I, yellow). Dotted signals for Rab8 were found throughout the cell body in addition to the neurites (Fig. 3D), whereas the others were almost exclusively expressed in the distal portion of the neurites. Similar expression patterns were observed when Slp4-a or Rabs were exogenously expressed in PC12 cells (data not shown). A subcellular fractionation study was performed to further confirm the presence of Slp4-a and the three Rabs on densecore vesicles (Fig. 4). As expected, Rab3A, Rab27A, and Slp4-a were co-distributed with Syt IX (dense-core vesicle marker (DCV); fractions 5– 8) but not with synaptophysin (synapticlike microvesicle marker (SLMV); fractions 2– 4) (29, 35, 36). In contrast, Rab8 was also detected in lighter fractions in addition to the dense-core vesicle-enriched fractions, consistent with the immunocytochemical analysis (Fig. 3D). We therefore concluded that the Slp4-a䡠Rab8 and Slp4-a䡠Rab27A complexes are indeed formed on dense-core vesicles in intact PC12 cells. Opposite Effects of Slp4-a and Rab27A on Regulated Secretion in PC12 Cells—Finally, we used an NPY-T7-GST secretion assay to investigate whether the Slp4-a䡠Rab8 and/or Slp4a䡠Rab27A complexes control regulated exocytosis in PC12 cells (see ref. 34 for details). When Rab27A was transiently coexpressed with NPY in PC12 cells, high KCl-dependent NPY secretion was significantly promoted (Fig. 5A, closed bar), but the Rab27A expression had no effect on low KCl-dependent NPY secretion (data not shown). The effect of Rab27A should be GTP-dependent because expression of Rab27A(T23N), a domi-

39675

FIG. 2. In vivo formation of Slp4-a䡠Rab complex in PC12 cells. A, in vivo formation of Slp4-a䡠Rab8 and Slp4-a䡠Rab27A in PC12 cells. Anti-Slp4-a IgG, but not control IgG, immunoprecipitated Rab8 and Rab27A, but no Slp4-a䡠Rab3A complex was detected under our experimental conditions (lane 3). The asterisk indicates the light chain of IgG. B, exogenously expressed T7-GST-Slp4-a, but not T7-GST alone, preferentially interacts with Rab8 and Rab27A but essentially not with Rab3A (lane 2). In both panels, input means 1⁄80 volume of the reaction mixture used for immunoprecipitation. The positions of the molecular weight markers (⫻ 10⫺3) are shown on the left.

nant negative form that mimics the GDP-bound state, did not promote NPY secretion, consistent with the previous report (14) (data not shown). In contrast, expression of Rab8 had no significant effect on high KCl-dependent NPY secretion (Fig. 5A, open bar). The slight effect of Rab8 on regulated secretion was not due to its expression levels in PC12 cells because

39676


FIG. 3. Colocalization of Rab3A, Rab8, and Rab27A with Slp4-a in the distal portion of the neurites of PC12 cells. PC12 cells were fixed, permeabilized, and stained with anti-Rab3A (A, green), anti-Rab8 (D, green), anti-Rab27A (G, green), and anti-Slp4-a (B, E, and H, red) antibodies. Note that Slp4-a and three Rabs were colocalized in the distal portion of the neurites, where dense-core vesicles are enriched (C, F, and I, yellow in merged images of Slp4-a and the Rabs), suggesting that Slp4-a and the three Rabs are present on the dense-core vesicles. Scale bar indicates 50 ␮m.

FIG. 4. Rab3A, Rab8, Rab27A, and Slp4-a are localized on dense-core vesicles in PC12 cells. PC12 cells were fractionated on a 0.6 –1.8 M sucrose gradient. The fractions were analyzed by immunoblotting with anti-Slp4-a (top panel), anti-Rab3A (second panel), antiRab8 (third panel), anti-Rab27A (fourth panel), anti-Syt IX (fifth panel; a marker for dense-core vesicles (DCV)), and anti-synaptophysin antibody (bottom panel; a marker for synaptic-like microvesicles (SLMV)). Note that Rab3A, Rab8, and Slp4-a were co-distributed with the densecore vesicle-enriched fractions (fractions 5– 8), the same as Syt IX, not with the synaptic-like microvesicle-enriched fractions (fractions 2– 4).

similar amounts of FLAG-Rab8 and -Rab27A were detected in PC12 cells by immunoblotting (Fig. 5A, inset). Similarly, expression of Rab3A did not promote NPY secretion, as described previously (14, 37–39) (data not shown). When Slp4-a was expressed in PC12 cells, high KCl-dependent NPY secretion was significantly reduced (Fig. 5B, open bar), but it had no effect on low KCl-dependent secretion (data not shown). Interestingly, expression of Slp3-a, a Rab27A-specific Slp exhibiting Ca2⫹-dependent phospholipid binding activity (1, 40), in PC12 cells strongly promoted high KCl-dependent NPY secretion (Fig. 5B, closed bar). To further determine whether the effect of Slp4-a (or Slp3-a) expression in high KCl-dependent NPY secretion is indeed Rab27A-dependent, an Slp4-a mutant incapable of Rab27A binding (⌬SHD) was ex-

FIG. 5. Effect of expression of Rab27A, Slp4-a, and Slp3-a on regulated secretion in PC12 cells. A, expression of Rab27A (closed bar), but not Rab8 (open bar), greatly promoted high KCl-dependent NPY secretion in PC12 cells (**, p ⬍ 0.05, Student’s unpaired t test). Cont, control. B, opposite effect of expression of Slp4-a or Slp3-a on regulated secretion in PC12 cells (**, p ⬍ 0.05, Student’s unpaired t test). The NPY-T7-GST secretion assay was performed as described previously (34). The results are expressed as percent of NPY-T7-GST secretion as compared with control samples (shaded bars) without expression of recombinant proteins. Bars indicate the means ⫾ S.E. of three determinations. The results shown are representative of three independent experiments. Insets in A and B show expressed recombinant proteins visualized with HRP-conjugated anti-FLAG and anti-T7 tag antibodies, respectively.

pressed in PC12 cells (Fig. 6A, lane 18). As expected, expression of Slp4-a-⌬SHD completely reversed the inhibitory effect (Fig. 6B, closed bar). A similar result was obtained for Slp3-b (2), an alternatively splicing isoform that lacks an N-terminal SHD (i.e. no significant effect on high KCl-dependent NPY secretion; Fig. 6B, closed bar). We therefore concluded that the observed effect of Slp4-a (or Slp3-a) expression in NPY secretion depends on the presence of the SHD (i.e. Rab27A-binding site). Since deletion of the SHD of Slp4-a also abrogated Rab3A and Rab8 binding (Fig. 6A, lanes 16 and 17), we could not completely rule out the possibility that the Slp4-a䡠Rab3A or Slp4-a䡠Rab8 complex, but not Slp4-a䡠Rab27A complex, has an inhibitory effect on high KCl-dependent NPY secretion. When Ala-based site-directed mutagenesis was performed to resolve this issue, a single amino acid substitution in the SHD1 was found to alter the Rab binding specificity of Slp4-a (Fig. 6A). Slp4-a(E14A) and Slp4-a(I18A) mutants specifically recognized Rab27A but not Rab3A and Rab8 (Fig. 6B, lanes 4 –9), whereas the Slp4-a(V21A) mutant recognized both Rab8 and Rab27A but not Rab3A (lanes 10 –12). In contrast, a D32A mutation had almost no effect on the Rab binding specificity of Slp4-a (lanes 13–15). If Slp4-a䡠Rab3A or Slp4-a䡠Rab8 complex plays a major role in inhibition of high KCl-dependent NPY secretion, expression of a I18A or V21A mutant should reverse the inhibitory effect. However, when these mutants of Slp4-a were expressed in PC12 cells, no difference in high KCl-dependent NPY secretion was detected between the wild-type and mutant Slp4-a (Fig. 6B, open bars). These results strongly indicated that Slp4-a modulates dense-core vesicle exocytosis via binding to Rab27A in PC12 cells. DISCUSSION

The Slp family (Slp1–5) was defined as proteins with an N-terminal SHD and C-terminal tandem C2 domains (1, 2). Previously, we showed that the SHD of the Slp family binds the GTP-bound form of Rab27A (5, 9), but involvement of the Slp family in Rab27A-dependent membrane trafficking (i.e. melanosome transport in melanocytes and granule exocytosis in cytotoxic T lymphocytes observed in type I human Griscelli syndrome and ashen mice (17–22)) has never been elucidated.


39677

FIG. 6. Effect of expression of Slp4-a mutants and Slp3-b on regulated secretion in PC12 cells. A, pEF-T7-Slp4-a one-point mutants (or pEF-T7-Slp4-a-⌬SHD) and pEF-FLAG-Rab (Rab3A, Rab8, or Rab27A) were cotransfected into COS-7 cells. Co-immunoprecipitated (IP) FLAGRabs and immunoprecipitated T7-Slp4-a proteins are shown in the middle panel (Blot, anti-FLAG; IP, anti-T7) and bottom panel (Blot, anti-T7; IP, anti-T7), respectively. The top panel indicates the total FLAG-Rabs expressed (1⁄80 volume of the reaction mixture; input) that were used for immunoprecipitation. Note that the E14A, I18A, and V21A mutations altered the Rab binding specificity of Slp4-a (lanes 4 –12), whereas deletion of the SHD completely abolished Rab binding activity (lanes 16 –18). B, effect of expression of Slp4-a mutants and Slp3-b on regulated secretion in PC12 cells (**, p ⬍ 0.01, Student’s unpaired t test). The NPY-T7-GST secretion assay was performed as described previously (34). The results are expressed as percentages of NPY-T7-GST secretion in control (Cont) samples (shaded bars) without expression of recombinant proteins. Bars indicate the means ⫾ S.E. of three determinations. The results shown are representative of three independent experiments. The inset shows expressed recombinant proteins visualized with anti-T7 tag antibody. Note that expression of Slp4-a-⌬SHD or Slp3-b had no effect on high KCl-dependent NPY secretion (closed bar), whereas expression of Slp4-a(I18A) (Rab27A-specific) and Slp4-a(V21A) (Rab8- and Rab27A-specific) inhibited NPY secretion, the same as the wild-type (WT) protein (open bars).

In this study, we demonstrated for the first time that Rab27A and its effector molecules (Slp4-a and Slp3-a) control densecore vesicle exocytosis in PC12 cells. Although Slp4-a has been found to interact with Rab3A, Rab8, and Rab27A in vitro and in overexpression studies (9, 16), endogenous Slp4-a in PC12 cells preferentially interacted with Rab27A on dense-core vesicles (Figs. 2– 4). The Slp4a䡠Rab8 complex was also observed on dense-core vesicles in PC12 cells, but the majority of Rab8 (especially in the cell body; Fig. 3F) was free of Slp4-a, and significant amounts of Slp4a䡠Rab3A were not detected. In addition, we discovered that expression of Rab27A, but not of Rab8, promoted high KCl-dependent NPY secretion in PC12 cells (Fig. 5A), whereas expression of Slp4-a and Slp3-a had opposite effects on NPY secretion (Fig. 5B). These effects should be Rab27A-dependent because Slp mutants incapable of Rab27A binding had no effect on NPY secretion (Fig. 6B). The opposite effects of Slp4-a and Slp3-a may be attributable to the different biochemical properties of their C2 domains (i.e. the Ca2⫹-independent phospholipid binding activity of Slp4-a (4) versus the Ca2⫹-dependent phospholipid binding activity of Slp3-a (40)) because Ca2⫹-dependent type Syt I and Ca2⫹-independent type Syt IV were found to have a positive effect and inhibitory effect, respectively, on transmitter secretion (41– 43). While this manuscript was being reviewed, an inhibitory effect of Slp4-a on dense-core vesi-

cle exocytosis has also been reported in pancreatic ␤-cell lines (44), strongly supporting our finding that the Slp4-a䡠Rab27A complex controls dense-core vesicle exocytosis. Although the function of Slp4-a䡠Rab8 in PC12 cells is unknown, we speculate that Slp4-a䡠Rab8 may have a function different from regulated secretion, in which Slp4-a䡠Rab27A plays a major role. One possible function of Slp4-a䡠Rab8 may be transport of dense-core vesicles (from the trans-Golgi network to the cell periphery) because Rab8 has been shown to regulate polarized membrane traffic (from the trans-Golgi network to the basolateral plasma membrane) in epithelial cells (45). The function of Slp4-a䡠Rab8 complex is now under investigation in our laboratory. In summary, this study is the first to demonstrate involvement of the Slp family and Rab27A in dense-core vesicle exocytosis in PC12 cells. It will be interesting to determine which Slps function in granule exocytosis in cytotoxic T lymphocytes as well as platelets, where granule exocytosis is known to be defective in Rab27A mutant animals (17, 18, 20, 21). REFERENCES 1. Fukuda, M., and Mikoshiba, K. (2001) Biochem. Biophys. Res. Commun. 281, 1226 –1233 2. Fukuda, M., Saegusa, C., and Mikoshiba, K. (2001) Biochem. Biophys. Res. Commun. 283, 513–519 3. McAdara Berkowitz, J. K., Catz, S. D., Johnson, J. L., Ruedi, J. M., Thon, V., and Babior, B. M. (2001) J. Biol. Chem. 276, 18855–18862

39678


4. Wang, J., Takeuchi, T., Yokota, H., and Izumi, T. (1999) J. Biol. Chem. 274, 28542–28548 5. Kuroda, T. S., Fukuda, M., Ariga, H., and Mikoshiba, K. (2002) Biochem. Biophys. Res. Commun. 293, 899 –906 6. Matesic, L. E., Yip, R., Reuss, A. E., Swing, D. A., O’Sullivan, T. N., Fletcher, C. F., Copeland, N. G., and Jenkins, N. A. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 10238 –10243 7. Fukuda, M., Kuroda, T. S., and Mikoshiba, K. (2002) J. Biol. Chem. 277, 12432–12436 8. Ishikawa, K., Nagase, T., Suyama, M., Miyajima, N., Tanaka, A., Kotani, H., Nomura, N., and Ohara, O. (1998) DNA Res. 5, 169 –176 9. Kuroda, T. S., Fukuda, M., Ariga, H., and Mikoshiba, K. (2002) J. Biol. Chem. 277, 9212–9218 10. El-Amraoui, A., Schonn, J. S., Kussel-Andermann, P., Blanchard, S., Desnos, C., Henry, J. P., Wolfrum, U., Darchen, F., and Petit, C. (2002) EMBO Rep. 3, 463– 470 11. Zerial, M., and McBride, H. (2001) Nat. Rev. Mol. Cell Biol. 2, 107–117 12. Segev, N. (2001) Curr. Opin. Cell Biol. 13, 500 –511 13. Pfeffer, S. R. (2001) Trends Cell Biol. 11, 487– 491 14. Yi, Z., Yokota, H., Torii, S., Aoki, T., Hosaka, M., Zhao, S., Takata, K., Takeuchi, T., and Izumi, T. (2002) Mol. Cell. Biol. 22, 1858 –1867 15. Zhao, S., Torii, S., Yokota-Hashimoto, H., Takeuchi, T., and Izumi, T. (2002) Endocrinology 143, 1817–1824 16. Strom, M., Hume, A. N., Tarafder, A. K., Barkagianni, E., and Seabra, M. C. (2002) J. Biol. Chem. 277, 25423–25430 17. Menasche, G., Pastural, E., Feldmann, J., Certain, S., Ersoy, F., Dupuis, S., Wulffraat, N., Bianchi, D., Fischer, A., Le Deist, F., and de Saint Basile, G. (2000) Nat. Genet. 25, 173–176 18. Wilson, S. M., Yip, R., Swing, D. A., O’Sullivan, T. N., Zhang, Y., Novak, E. K., Swank, R. T., Russell, L. B., Copeland, N. G., and Jenkins, N. A. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 7933–7938 19. Bahadoran, P., Aberdam, E., Mantoux, F., Busca, R., Bille, K., Yalman, N., de Saint-Basile, G., Casaroli-Marano, R., Ortonne, J. P., and Ballotti, R. (2001) J. Cell Biol. 152, 843– 850 20. Stinchcombe, J. C., Barral, D. C., Mules, E. H., Booth, S., Hume, A. N., Machesky, L. M., Seabra, M. C., and Griffiths, G. M. (2001) J. Cell Biol. 152, 825– 834 21. Haddad, E. K., Wu, X., Hammer, J. A., III, and Henkart, P. A. (2001) J. Cell Biol. 152, 835– 842 22. Hume, A. N., Collinson, L. M., Rapak, A., Gomes, A. Q., Hopkins, C. R., and Seabra, M. C. (2001) J. Cell Biol. 152, 795– 808

23. Wu, X. S., Rao, K., Zhang, H., Wang, F., Sellers, J. R., Matesic, L. E., Copeland, N. G., Jenkins, N. A., and Hammer, J. A., III (2002) Nat. Cell Biol. 4, 271–278 24. Hume, A. N., Collinson, L. M., Hopkins, C. R., Strom, M., Barral, D. C., Bossi, G., Griffiths, G. M., and Seabra, M. C. (2002) Traffic 3, 193–202 25. Provance, D. W., Jr., James, T. L., and Mercer, J. A. (2002) Traffic 3, 124 –132 26. Fukuda, M., Aruga, J., Niinobe, M., Aimoto, S., and Mikoshiba, K. (1994) J. Biol. Chem. 269, 29206 –29211 27. Smith, D. B., and Johnson, K. S. (1988) Gene (Amst.) 67, 31– 40 28. Fukuda, M., and Mikoshiba, K. (1999) J. Biol. Chem. 274, 31428 –31434 29. Fukuda, M., Martin, T. F. J., Kowalchyk, J. A., Zhang, X., and Mikoshiba, K. (2002) J. Biol. Chem. 277, 4601– 4604 30. Zhang, X., Kim-Miller, M. J., Fukuda, M., Kowalchyk, J. A., and Martin, T. F. J. (2002) Neuron 34, 599 – 611 31. Fukuda, M., Kanno, E., and Mikoshiba, K. (1999) J. Biol. Chem. 274, 31421–31427 32. Fukuda, M., Kanno, E., Ogata, Y., and Mikoshiba, K. (2001) J. Biol. Chem. 276, 40319 – 40325 33. Fukuda, M., Ibata, K., and Mikoshiba, K. (2001) J. Neurochem. 77, 730 –740 34. Fukuda, M., Katayama, E., and Mikoshiba, K. (2002) J. Biol. Chem. 277, 29315–29320 35. Fukuda, M., Ogata, Y., Saegusa, C., Kanno, E., and Mikoshiba, K. (2002) Biochem. J., 365, 173–180 36. Saegusa, C., Fukuda, M., and Mikoshiba, K. (2002) J. Biol. Chem. 277, 24499 –24505 37. Chung, S. H., Joberty, G., Gelino, E. A., Macara, I. G., and Holz, R. W. (1999) J. Biol. Chem. 274, 18113–18120 38. Weber, E., Jilling, T., and Kirk, K. L. (1996) J. Biol. Chem. 271, 6963– 6971 39. Johannes, L., Lledo, P. M., Roa, M., Vincent, J. D., Henry, J. P., and Darchen, F. (1994) EMBO J. 13, 2029 –2037 40. Fukuda, M. (2002) Biochem. J. 366, 681– 687 41. Littleton, J. T., Serano, T. L., Rubin, G. M., Ganetzky, B., and Chapman, E. R. (1999) Nature 400, 757–760 42. Fukuda, M., Kojima, T., and Mikoshiba, K. (1996) J. Biol. Chem. 271, 8430 – 8434 43. von Poser, C., Ichtchenko, K., Shao, X., Rizo, J., and Su¨ dhof, T. C. (1997) J. Biol. Chem. 272, 14314 –14319 44. Coppola, T., Frantz, C., Perret-Menoud, V., Gattesco, S., Hirling, H., and Regazzi, R. (2002) Mol. Biol. Cell 13, 1906 –1915 45. Huber, L. A., Pimplikar, S., Parton, R. G., Virta, H., Zerial, M., and Simons, K. (1993) J. Cell Biol. 123, 35– 45