Stable Isotope and Metagenomic Profiling of a Methanogenic ... - MDPI

Recommend Documents

Stable Carbon Isotope Fractionation by Methylotrophic Methanogenic ...

in all three methylotrophic archaea (M. acetivorans, M. barkeri, and M. zinderi) .... ane involves only two enzymes (methanol:coenzyme M methyl- transferase ...

Integration of Metagenomic and Stable Carbon Isotope Evidence ...

Feb 3, 2017 - Russia. *Correspondence: James J. Moran [email protected] ... Beam JP, Whitmore LM, Kozubal MA,. Kreuzer HW and Inskeep WP ...

Carbon Stable-Isotope and Physicochemical Data as a ... - MDPI

Jun 6, 2018 - evaluated (pH; moisture; free, lactonic and total acidity; and sugar content), according to the Codex. Alimentarius Commission [17] or ...

Supplementary Materials: Stable Isotope-Assisted Evaluation ... - MDPI

Mass. Î ppm. Number of. Carbon. Atoms. Name or Substance Class. Molecular. Formula. Exact. Mass. Number of db. Hits. Detected in All Extraction Mixtures.

Metagenomic Profiling of Microbial Composition and Antibiotic ...

Oct 29, 2012 - Citation: Port JA, Wallace JC, Griffith WC, Faustman EM (2012) .... people from urban population centers such as Seattle, Tacoma,. Olympia and ...

Oxygen and Carbon Stable Isotope Composition of Cretaceous ... - MDPI

Sep 3, 2018 - 5741â5762. ... Jin, Z.; Yang, M.; Lu, X.; Sun, D.; Tang, X.; Peng, G.; Lei, G. The tectonic and petroleum system of the Qiulitagh fold and thrust belt ...

A compound-specific stable isotope

Hari Ram Upadhayay a,d,â, Hugh G. Smith b, Marco Griepentrog a,c, ...... Acharya, G.P., Tripathi, B.P., Gardner, R.M., Mawdesley, K.J., McDonald, M.A., 2008.

A Stable-Isotope Mass Spectrometry-Based Metabolic ... - MDPI

Oct 29, 2013 - empirical formula, a critical first step in their identification. ... Phytoplankton exude large amounts of organic compounds to the .... Page 8 ...

combining stable isotope and - BioOne

Sitio de Parada en la Costa del Golfo: Una CombinaciÃ³n de Herramientas de ... dentro de una banda latitudinal especÄ±fica. ...... 5th ed. Prentice Hall, Englewood.

a stable isotope approach - Department of Biology

NATHANIEL E. OSTROM,1 LARS O. HEDIN,2 JOSEPH C. VON FISCHER,2 AND G. ... tending 4 m inland from Smith Creek, a southwestern Michigan stream, ...

Pathophysiological Stable Isotope Fractionation

(Chowang et al. 1988; Soliman et al. ...... gratitude goes to Dr. Jason Laffoon (VU Amsterdam ...... Sarrai, Mona, Herold Duroseau, Jean D'Augustine, Sabita Mok-.

Stable Isotope Ecology [PDF]

2006 Springer Science+Business Media, LLC. All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Springer Science+Business Media, LLC, 233 Spring Street,. New York, NY 1001

Stable isotope

Mar 13, 2012 - Mark Brenner, William F. Kenney & .... 1997), document historical eutrophi- ...... FloridaâSt. Johns River Water Management District's.

DNA Stable-Isotope Probing

Jun 17, 2010 - $1200 per g. Xylose. $800 per g. Cellobiose. $5000 per g. Sigma Aldrich. Cambridge Isotope Laboratories. Omicron Biochemicals Inc. 2 ...

Functional Metagenomic Profiling of Nine Biomes

Mar 12, 2008 - To test the hypothesis that each environment has a distinguishing metabolic profile, a ..... Metagenomes were collected to answer broad ecological questions such as viral community ...... tein E /ATPase PilB. 0.010. 0.002.

RESEARCH PAPER Metagenomic profiling of the ...

1Department of Biotechnology and Microbiology, Faculty of Biology, University of Plovdiv,. Plovdiv, Bulgaria. 2Department of Plant Physiology and Molecular ...

Stable Isotope Analysis Reveals the Importance of Riparian ... - MDPI

Sep 12, 2018 - Keywords: river impoundment; basal carbon source; stable isotope; Three Gorges Reservoir .... The upstream is 5â10 m wide and 1â3 m deep at low-flow periods, with ... Figure 1. The location of the Three Gorges Reservoir Region and

Metagenomic Profiling: Microarray Analysis of an Environmental ...

Mar 3, 2003 - ... B. A. Lynch, T. Phillips, S. Narula, R. Sundaramoorthi, A. Tyler, .... In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman,.

Application of Stable Isotope-Assisted Metabolomics for Cell ... - MDPI

Mar 31, 2014 - chromatography-mass spectrometry (GC-MS) for broad-scope metabolism studies. .... are used to separate low abundant and unstable free metabolites. ...... F. Interpretation of Mass Spectra, 4th ed.; University Science Books:.

Use of Hydrochemistry, Stable Isotope, Radiocarbon, 222Rn ... - MDPI

Apr 29, 2016 - This study identifies the origin, geochemical evolution and mode of ..... quadrupole mass spectrometer with cryogenic separation (Poole et al. ...... University: Status Report on the Single Stage AMS; Nuclear Instruments and ... Gardne

Application of Stable Isotope Tracer to Study Runoff ... - MDPI

Apr 24, 2018 - variation of precipitation during typhoon and plum rain events in the ..... water vapor: the marine air parcels of plum rain experience a long time.

Spatial Variation in Leaf Stable Carbon Isotope Composition of ... - MDPI

May 25, 2018 - Leaf carbon isotope composition (Î´13C) provides comprehensive insight into ...... of the genus Caragana used in traditional Chinese medicine.

Stable Carbon Isotope Composition of the Lipids in Natural ... - MDPI

Sep 18, 2017 - For the samples of FMP, the Î´13C values of the four major fatty acids ...... Guo, L.X.; Xu, X.M.; Wu, C.F.; Lin, L.; Zou, S.C.; Luan, T.G.; Yuan, J.P.; ...

Petrography and stable isotope geochemistry of cretaceous ...

Mar 9, 2013 - Abstract. Some siliciclastic rock samples of the Orange Basin were subjected to diagenetic and reservoir quality evaluation; 33 core and side ...

Stable Isotope and Metagenomic Profiling of a Methanogenic ... - MDPI

Download PDF

1 downloads 0 Views 445KB Size Report

Comment

Culture. Courtney R. A. Toth, Carolina Berdugo-Clavijo, Corynne M. O'Farrell, Gareth M. Jones, Andriy. Sheremet, Peter F. Dunfield, and Lisa M. Gieg. Figure S1.

Stable Isotope and Metagenomic Profiling of a Methanogenic Naphthalene-Degrading Enrichment Culture Courtney R. A. Toth, Carolina Berdugo-Clavijo, Corynne M. O’Farrell, Gareth M. Jones, Andriy Sheremet, Peter F. Dunfield, and Lisa M. Gieg

Figure S1. Methane production from triplicate parent NDC microcosms amended with naphthalene (blue) relative to an unamended control (red). Adapted from Berdugo Clavijo et al., 2012. Table S1. Primer sets screened for the targeted detection of anaerobic functional genes in a methanogenic naphthalenedegrading enrichment culture. Primer name

Target gene

Target lineage

Primer sequence (5’ – 3’)

Expected amplicon bp

Amplification detected

References

FAE-B

7768f 8543r

bssA

Clostridial bssA, bssA s.l., nmsA

CAAYGATTTAACCRACGCCAT TCGTCRTTGCCCCAYTTNGG

775

-

(von Netzer et al., 2013)

FAE-N

7363f 7374f 8543r

nmsA

nmsA s. str.

TCGCCGAGAATTTCGAYTTG TTCGAYTTGACGGACAGCGT TCGTCRTTGCCCCAYTTNGG

1180 1169

-

(von Netzer et al., 2013)

Ncr2for Ncr2rev

Ncr

Deltaproteobacteria (NaphS2, N57)

TGGACAAAYAAAMGYACVGAT GATTCCGGCTTTTTTCCAAVT

320

-

(Morris et al., 2014)

benCarbfor benCarbrev

abcA

GTGGTCTTCGCACCGTTAAT TCTCCGGTAACTGGGTGTTC

495

-

(Fowler, 2014)

Table S2. Summary of draft genomes assembled from pooled 13C-labelled NDC SIP fractions. Draft (meta)genome

13 C-enriched

DNA metagenome of NDC Clostridium sp. Bin 1 Geobacter sp. Bin 1 Geobacter sp. Bin 2 Geobacter sp. Bin 3 Unclassified Rhodospirillales Bin 1 Desulfovibrio sp. Bin 1 Anaerolinea sp. Bin 1 Anaerolinea sp. Bin 2 Sphaerochaeta sp. Bin 1 Methanosaeta sp. Bin 1

IMG Genome ID

Genome size (bp)

Gene count

3300013290

68705674

104254

2724679696 2724679697 2724679723 2724679724

5438132 4390079 3876684 2526538

5424 4104 3546 2519

2724679720

3473168

3651

2724679721 2724679725 2724679726 2724679727 2724679722

3088242 2333788 2271625 1750954 2683322

2959 2249 2153 1956 2798

Protein coding genes with COGs (%)

64.54

Scaffolds containing ≥1 PAHdegrading gene orthologs 804

Scaffolds containing ≥3 PAHdegrading gene orthologs 73

68.31 56.80 62.15 65.58 60.81

260 90 79 58 88

28 9 9 7 2

65.12 56.87 57.50 51.74 58.26

71 52 34 41 31

7 4 4 0 3

References 1. 2. 3. 4.

Berdugo-Clavijo, C.; Dong, X.; Soh, J.; Sensen, C.W.; Gieg, L.M. Methanogenic biodegradation of two-ringed polycyclic aromatic hydrocarbons. FEMS Microbiol. Ecol. 2012, 81, 124–133. Fowler, S.J. Syntrophic hydrocarbon metabolism under methanogenic conditions. PhD Thesis. University of Calgary, Calgary, Alberta, 2014. Morris, B.E.; Gissibl, A.; Kummel, S.; Richnow, H.H.; Boll, M. A pcr-based assay for the detection of anaerobic naphthalene degradation. FEMS Microbiol. Lett. 2014, 354, 55–59. von Netzer, F.; Pilloni, G.; Kleindienst, S.; Kruger, M.; Knittel, K.; Grundger, F.; Lueders, T. Enhanced gene detection assays for fumarate-adding enzymes allow uncovering of anaerobic hydrocarbon degraders in terrestrial and marine systems. Appl. Environ. Microbiol. 2013, 79, 543–552.