staphylococcal cassette chromosome mec (sccmec) - wjpps

WORLD JOURNAL OF PHARMACY AND PHARMACEUTICAL SCIENCES

Okwu et al.

World Journal of Pharmacy and Pharmaceutical Sciences

SJIF Impact Factor 6.041

Volume 5, Issue 7, 91-103.

Research Article

ISSN 2278 – 4357

STAPHYLOCOCCAL CASSETTE CHROMOSOME MEC (SCCMEC) TYPING OF METHICILLIN-RESISTANT STAPHYLOCOCCI OBTAINED FROM CLINICAL SAMPLES IN SOUTH-SOUTH, NIGERIA. Maureen Uchechukwu Okwu (PhD)*1, Olley Mitsan (M.Sc)2, Bankole Oladeinde (M.Sc)3, Ilse Palmans (Ing)4,5 and Patrick Van Dijck (PhD)4,5 1

Department of Biological Sciences (Microbiology), College of Natural and Applied Sciences, Igbinedion University, Okada, Edo State, Nigeria. 2

3

Department of Pathology, Igbinedion University Teaching Hospital, Okada.

Department of Medical Microbiology, College of Health Sciences, Igbinedion University, Okada. 4

5

VIB Department of Molecular Microbiology, KU Leuven, Flanders, Belgium.

Laboratory of Molecular Cell Biology, Institute of Botany and Microbiology, KU Leuven, B-3001 Leuven, Belgium.

Article Received on 13 April 2016,

ABSTRACT Molecular

typing

techniques

have

been

employed

in

the

Revised on 03 May 2016, Accepted on 23 May 2016

epidemiological study of methicillin-resistant S. aureus (MRSA) and

DOI: 10.20959/wjpps20167-7110

methicillin-resistant coagulase-negative staphylococci (MRCoNS) to identify the staphylococcal cassette chromosome mec (SCCmec) elements. The aim of this study was to determine the prevalence and

*Corresponding Author Maureen Uchechukwu

diversity of SCCmec types in the isolates obtained from four hospitals in south-south, Nigeria. A total of 149 staphylococcal isolates were

Okwu Department of Biological

obtained from clinical samples from March through September, 2015.

Sciences (Microbiology),

They were identified and SCCmec typing was done using single-target

College of Natural and

PCR. The prevalence of methicillin-resistant staphylococci (MRS) in

Applied Sciences, Igbinedion University, Okada, Edo State, Nigeria.

this study was 53.7%. SCCmec type II was the most prevalent with 43.0% while for cassette chromosome recombinases (ccr) typing, ccrC (type5) was the predominant with 44.2%. Nineteen (22.1%) of the

MRS isolates were non-typeable for both ccr and mec gene complexes. There is a need to curb the spread of MRS in south-south, Nigeria. www.wjpps.com

Vol 5, Issue 7, 2016.

91

Okwu et al.


KEYWORDS: Methicillin-resistant Staphylococcus aureus, Polymerase chain reaction, Molecular typing. INTRODUCTION Staphylococcus aureus, a common and important human pathogen causing nosocomial and community-acquired infections can colonize the anterior nares and skin in both adults and children. The infections of the bacterium cause significant morbidity and mortality in both the community and hospital settings. The infections range from superficial skin and soft tissue infections to bacteremia, endocarditis, osteomyelitis, etc.[1] Methicillin-resistant S. aureus (MRSA) strains are characterized by the presence of a large heterologous mobile genetic element called staphylococcal cassette chromosome mec (SCCmec) which includes the mecA gene, the central element of methicillin resistance. Besides the mec gene complex (consists of mecA gene and its regulators, mecI and mecR1), SCCmec contains the cassette chromosome recombinases (ccr) gene complex. The ccr genes (composed of ccrC or a pair of ccrA and ccrB) encode recombinases mediating integration and excision of SCCmec into or from the chromosome. The ccr genes and surrounding genes form the ccr gene complex.[2] In addition to ccr and mec gene complexes, SCCmec contains a few other genes and various other mobile genetic elements such as: insertion sequences, transposons and plasmids.[3] The presence of mecA causes the resistance of S. aureus to methicillin. Penicillin binding protein 2a (PBP2a) encoded by mecA has a low affinity for all β-lactam antibiotics compared to other PBPs. In the presence of a β-lactam antibiotic, the peptidoglycan layer with PBP2a is not disrupted and the resistant bacterium can survive.[4,5] Coagulase-negative staphylococci (CoNS) comprise a variety of Staphylococcus species and they are opportunistic pathogens commonly associated with infections in patients with indwelling devices or being immunocompromised. CoNS are usually resistant to methicillin due to the presence of SCCmec.[3] Methicillin-resistant CoNS (MRCoNS) serve as a large reservoir of SCCmec. Characterization of SCCmec in MRCoNS can generate useful information on the mobilization and evolution of this element.[3] Various molecular typing techniques were used in the epidemiological study of MRSA and MRCoNS to identify the SCCmec elements based on the combination of the two essential components, the mec and ccr gene complexes. To date eleven different types of SCCmec (I-

www.wjpps.com

Vol 5, Issue 7, 2016.

92

Okwu et al.


XI) and five allotypes of the ccr gene complexes (ccrAB1, ccrAB2, ccrAB3, ccrAB4 and ccrC) have been reported.[4,3,6] Generally, SCCmec types I, II, III, VI and VIII are called hospital-acquired MRSA or (HA-MRSA). Types IV, V and VII are named as communityacquired (CA-MRSA) while types IX, X and XI are named as livestock-associated MRSA (LA-MRSA).[6,7] Several studies have been conducted globally to determine the prevalence of various SCCmec types in different regions of the world. SCCmec types I-V are globally distributed, whilst others appear to exist as local strains in the country of origin.[8,4,9] In Nigeria, available data on SCCmec types in our hospital environments are still relatively limited or absent in some regions when compared to information from developed countries. The present study was designed and carried out to determine the prevalence and diversity of SCCmec types in MRSA and MRCoNS isolates obtained from tertiary health institutions in south-south, Nigeria. MATERIALS AND METHODS Sample collection A total of 149 staphylococcal isolates were collected from clinical samples in four tertiary hospitals (Igbinedion University Teaching hospital, Okada, Edo state; University of Benin Teaching hospital, Benin, Edo state and two tertiary hospitals in Warri and Abraka in Delta state) in south-south, Nigeria. The samples were collected from eyes, ear, urethra, wound, mouth, vagina, semen, stool, sputum, urine and synovial fluid of patients from March through September, 2015. Each hospital ethics committee approval was received. The samples were directly inoculated onto blood and mannitol salt agar for 24 - 48 hours at 37oC. Bacterial isolates All the staphylococcal isolates obtained in this study were identified using standard microbiological methods which included: colonial morphology, Gram staining, DNase, catalase, coagulase and mannitol fermentation tests.[10] Methicillin-resistant staphylococcal isolates were identified by resistance to oxacillin disc (5 µg; Oxoid, United Kingdom) as described by Okwu, et al.,[11] Control strains used were S. aureus USA300 as methicillin-resistant and SH1000 as methicillin-susceptible S. aureus.

www.wjpps.com

Vol 5, Issue 7, 2016.

93

Okwu et al.


DNA Extraction Extraction was carried out using DNeasy blood and tissue kit (Qiagen, Germany) according to manufacturer’s instructions. The enzyme lysostaphin (200µl/ml) was included. The DNA concentrations in the final eluates were measured with a spectrophotometer nanodrop (Isogen, ND1000). Polymerase Chain Reaction (PCR) assay To confirm the identity of S. aureus, CoNS, methicillin-resistant staphylococci, SCCmec and ccr types of the isolates, single-target PCR assay was performed using 17 different sets of primers (Table 1) specific for the target genes and S. aureus control strains USA300, JCSC4469, WIS, Q2314, 8/6-3P, COL, BK2464, ANS46, MW2 and HDE288. PCR thermal cycling conditions included initial denaturation at 94oC for 4 minutes, followed by 30 cycles of 94oC for 30 seconds, 53oC - 60oC for 30 - 45 seconds, 72oC for 1 minute and ending with a final extension step at 72oC for 10 minutes, followed by a hold at 10oC. PCR reagent used in this study was TaKaRa Ex Taq (Japan, Cat. No. RR001A). Gel electrophoresis of PCR product was carried out by using 1% agarose gel containing 0.05µl/ml SYBR safe in 0.5X TAE buffer at 135V for 23 minutes. The DNA bands were visualized with a gel documentation system. The sizes of the bands were determined by comparison with a DNA ladder (Gene Ruler TM, 1kb). Statistical analysis Percentages, chi square and fisher’s exact tests using SPSS version 16.0 were applied for the analysis of data obtained in this study. A p value < 0.05 was considered as statistically significant. RESULT A total of 149 staphylococcal isolates were obtained from clinical samples of patients from four tertiary hospitals in south-south, Nigeria. Of the 71 (47.7%) staphylococcal isolates obtained from male subjects, 39 (26.2%) were methicillin-resistant staphylococci (MRS) while 75 (50.3%) staphylococci and 40 (26.8) MRS isolates were from female subjects (Table 2). The prevalence of the MRS (MRSA and MRCoNS) isolates in this study was 53.7%. The distribution of staphylococci and MRS isolates were highest in the age group of 20 – 29 years with 34.9 and 16.8 respectively; followed by 30 – 39 years with 18.1% and

www.wjpps.com

Vol 5, Issue 7, 2016.

94

Okwu et al.


10.7% respectively (Table 3). There was no significant difference (p > 0.05) in the distribution of staphylococci and MRS isolates with respect to sex (p = 0.53) and age (p = 0.84) in this study. Of the 104 staphylococcal isolates selected for screening for mecA gene using single-target PCR assay, 86 (82.7%) were mecA positive, 15 (14.4%) were mecA negative while 3 (2.9%) were non-typeable. For oxacillin disc diffusion test, 76 (73.1%) were oxacillin positive, 23 (22.1%) were negative while 5 (4.8%) were intermediate (Table 4). There was no statistically significant difference between the two methods used in this study for screening for MRS isolates. As shown in Table 5, Figures 1 and 2, of the 86 mecA gene positive (MRS) isolates, 61 (70.9%) were MRSA while 25 (29.1%) were MRCoNS isolates. Six SCCmec types (II, III, IVa, IVc, V and VI) and four ccr (ccrAB1, ccrAB2, ccrAB3 and ccrC) types were identified among the MRSA and MRCoNS isolates in this study. SCCmec type II was the most prevalent with 37 (43.0%) isolates followed by type III with 10 (11.6%), then type IVa with 4 (4.7%). SCCmec types IVc, V and VI were each 2.3%. For ccr typing, ccrC (type 5) was observed to be predominant with 38 (44.2%) isolates, followed by ccrAB2 (type 2) with 19 (22.1%), then ccrAB1 (type 1) with 4 (4.7%) and the least was ccrAB3 (type 3) with 3 (3.5%). ccrAB4 (type 4) was not identified in the study and 22 (25.6%) of the MRS isolates were nontypeable for ccr gene complex. Of the SCCmec type II MRS isolates, 22 (25.6%) carried ccrC complex; 9 (10.5%) carried ccrAB2 complex; 3 (3.5%) which were only MRSA isolates carried ccrAB1 complex while 3.5%, were non-typeable for ccr gene complex. In this study, only the MRSA isolates carried SCCmec type III with ccrC complexes. No MRCoNS isolates with SCCmec III and IVa types were observed. All the MRS isolates with SCCmec IVa and IVc had ccrAB2 type only. Types V and VI were only found in MRCoNS isolates. For type V isolates, 1.2% carried either ccrAB3 or ccrC type each while the type VI isolates carried the ccrAB3 type only. In this study, 10 (11.6%) of the MRS isolates could only be assigned the ccr but not the SCCmec types while 19 (22.1%) were non-typeable (for both the mec and ccr gene complexes).

www.wjpps.com

Vol 5, Issue 7, 2016.

95

Okwu et al.


Table 1. Primers and control strains used in this study Primer 16S rRNA-F 16S rRNA-R femA-F femA-R mecA-F mecA-R Type I-F Type I-R KDP F1 KDP R1 RIF5 F10 RIF5 R13 Type IVa-F Type IVa-R Type IVb-F Type IVb-R Type IVc-F Type IVc-R Type IVd-F5 Type IVd-R6 Type V-F Type V-R DCS F2 DCS R1 βc α1 α2 α3 α4.2 β4.2 γR γF

Specificity All Staph

Sequence (5' Size (bp) GCAAGCGTTATCCGGATTT 597 CTTAATGATGGCAACTAAGC S. aureus CGATCCATATTTACCATATCA 450 ATCACGCTCTTCGTTTAGTT MRSA ACGAGTAGATGCTCAATATAA 293 CTTAGTTCTTTAGCGATTGC SCCmec I GCTTTAAAGAGTGTCGTTACAGG 613 GTTCTCTCATAGTATGACGTCC SCCmec ll AATCATCTGCCATTGGTGATGC 284 CGAATGAAGTGAAAGAAAGTGG SCCmec III TCTTAAGTACACGCTGAATCG 414 ATGGAGATGAATTACAAGGG SCCmec IVa GCCTTATTCGAAGAAACCG 776 CTACTCTTCTGAAAAGCGTCG SCCmec IVb TCTGGAATTACTTCAGCTGC 493 AAACAATATTGCTCTCCCTC SCCmec IVc ACAATATTTGTATTATCGGAGAGC 200 TTGGTATGAGGTATTGCTGG SCCmec IVd CTCAAAATACGGACCCCAATACA 881 TGCTCCAGTAATTGCTAAAG SCCmec V GAACATTGTTACTTAAATGAGCG 325 TGAAAGTTGTACCCTTGACACC SCCmec I, II, IV & VI CATCCTATGATAGCTTGGTC 342 CTAAATCATAGCCATGACCG ccrB ATTGCCTTGATAATAGCCITCT ccrA1 AACCTATATCATCAATCAGTACGT 695 ccrA2 TAAAGGCATCAATGCACAAACACT 937 ccrA3 AGCTCAAAAGCAAGCAATAGAAT 1,791 ccrAB 4 GTATCAATGCACCAGAACTT 1,287 TTGCGACTCTCTTGGCGTTT ccrC CCTTTATAGACTGGATTATTCAAAATAT 518 CGTCTATTACAAGATGTTAAGGATAAT

Control strain USA300 USA300 USA300

References 2, 12 2, 12 2,12

COL

2, 8

BK2464

2, 23

ANS46 MW2

2, 23 2, 8

8/6-3P

2, 8

Q2314

2, 8

JCSC4469

2, 8

WIS

2, 8

HDE288

2, 8

COL BK2464 ANS46 HDE288

6 2, 6 2, 6 2, 6 2, 6

WIS

2, 6

Key: F= forward; R= reverse; I= inosine. Table 2. Distribution of staphylococci and MRS in male and female subjects Sex Male Female SNA Total

Frequency/Percentage (%) Staph MRS 71 (47.7) 39 (26.2) 75 (50.3) 40 (26.8) 3 (2.0) 1 (0.7) 149 (100) 80 (53.7)

P = 0.53 Key: staph = staphylococci; MRS = methicillin-resistant staphylococci; SNA = Sex not assigned.

www.wjpps.com

Vol 5, Issue 7, 2016.

96

Okwu et al.


Table 3. Distribution of staphylococci and MRS in different age ranges Age range 0–9 10 – 19 20-29 30-39 40-49 50-59 60-79 70-79 Ad Total

Frequency/Percentage(%) Staph MRS 12 (8.1) 3 (2.0) 13 (8.7) 9 (6.0) 52 (34.9) 25 (16.8) 27 (18.1) 16 (10.7) 11 (7.4) 7 (4.7) 7 (4.7) 4 (2.7) 1 (0.7) 1 (0.7) 5 (3.4) 1 (0.7) 21 (14.1) 14 (9.4) 149 (100) 80 (53.7)

P = 0.84 Key: staph = staphylococci; MRS = methicillin-resistant staphylococci; Ad = Adult. Table 4. Comparison of two methods for the detection of MRS isolates Frequency/Percentage (%) No. of isolates oxacillin PCR mecA gene Positive/Resistant 76 (73.1) 86 (82.7) Negative/Sensitive 23 (22.1) 15 (14.4) Intermediate 5 (4.8) 0 Non-typeable 0 3 (2.9) Total 104 (100) 104 (100) P = 0.09 Table 5. Frequency of SCCmec typed MRS isolates with their ccr elements SCCmec type II II II II III IVa IVc V V VI – – – –

ccr type

www.wjpps.com

– 1 2 5 5 2 2 3 5 3 1 2 5 –

No. of MRSA/MRCoN isolates 3/3/7/2 13 / 9 10 / 4/1/1 –/1 –/1 –/2 –/1 3/1 5/– 12 / 7 Total = 61/25

No./ (%)

MRS type

3 (3.5) 3 (3.5) 9 (10.5) 22 (25.6) 10 (11.6) 4 (4.7) 2 (2.3) 1 (1.2) 1 (1.2) 2 (2.3) 1 (1.2) 4 (4.7) 5 (5.8) 19 (22.1) 86 (100)

HA-MRSA HA-MRSA HA-MRSA/HA-MRCoNS HA-MRSA/HA-MRCoNS HA-MRSA CA-MRSA CA-MRSA/CA-MRCoNS CA-MRCoNS CA-MRCoNS HA-MRCoNS Non-typeable Non-typeable Non-typeable Non-typeable

Vol 5, Issue 7, 2016.

97

Okwu et al.


Sccmec = staphylococcal cassette chromosome mec; MRSA= methicillin-resistant S. aureus; MRCoNS=methicillin-resistant coagulase negative staphylococci; HA= hospital-associated; CA= community-associated.

Figure 1. Single-target PCR SCCmec II typing of MRS isolates. Lane1, 1 kb DNA ladder; Lanes 7,10,14, 16, 17, 21, 26, 28, 31, 34, 35, 39, 41, 42, and 43 were SCCmec type ll positive(284 bp); Lane 46, negative control(MW2); Lane 47, positive control(BK2464)

Figure 2. Single-target PCR ccrC typing of MRS isolates. Lane1, 1 kb DNA ladder; Lanes 1,2,3,4,7,8,10,12,13,15, 16, 17,20,... and 46 were ccrC positive(518 bp); Lane 47, negative control(MW2); Lane 48, positive control(WIS)

www.wjpps.com

Vol 5, Issue 7, 2016.

98

Okwu et al.


L= Lane; bp= base pair; PCR= polymerase chain reaction; SCCmec= staphylococcal cassette chromosome mec; MRS= methicillin-resistant staphylococci DISCUSSION Methicillin-resistant S. aureus (MRSA) is a strain of S. aureus which was first reported in 1961 soon after methicillin was introduced and it has since emerged as an important pathogen in human medicine. MRSA infections have now become a major public health concern and its prevalence is increasing globally.[1] In addition, Methicillin-resistant coagulase-negative staphylococci (MRCoNS) are now recognized as important causes of human infections and they often serve as reservoirs of antimicrobial resistance determinants, since they usually have a high prevalence of multidrug resistance.[12] In the present study, the prevalence of methicillin-resistant staphylococci (MRSA and MRCoNS) obtained from clinical samples in four tertiary hospitals in south-south (Okada, Benin, Abraka and Warri), Nigeria was 53.7%. This is higher than 35.0% MRSA reported previously by Okwu, et al.,[1] in south-south, Nigeria probably due to the addition of MRCoNS isolates that increased the prevalence value in the present study. However, previous studies reported that the prevalence of MRSA in Nigeria usually varies between 34.7% and 71.2%.[13,14,15] MRSA prevalence values are known to vary with geographical locations, type of health institutions, studied population and methods of detection employed. MRSA is commonly associated with nosocomial infections with high isolation rates recorded in tertiary hospitals.[16] It was observed in the present study that the percentages of methicillin-resistant staphylococci (MRS) were higher in females than males and also in age groups 20-29 years, followed by 30-39 years than others. However, there was no statistical significant difference in MRS carriage in sex (p = 0.53) and age (p = 0.84). This is in line with the previous reports of Ankur et al.,[17]; Okwu, et al.,[1] and Navidinia, et al.,[5] One of the most important molecular methods available for the determination of the epidemiology and clonal strains relatedness of MRSA is SCCmec typing.[5] It could be used to determine hospital-acquired MRSA (HA-MRSA) and community-acquired MRSA (CAMRSA) isolates. Generally, SCCmec types I, II, III, VI and VIII are HA-MRSA while types IV, V and VII are CA-MRSA.[6,7] In this study, SCCmec typing using single-target PCR technique identified types II, III, IVa, IVc, V and VI which are in agreement with the previous report of Alli, et al.,[18] in south-west, Nigeria. However, type VI was not reported in their studies probably due to its absence in the isolates studied or the homologous primer set www.wjpps.com

Vol 5, Issue 7, 2016.

99

Okwu et al.


was not included. Type I was not reported in the present study which is in line with previous report.[18] Type II was the most prevalent in this study with 43.0% (MRSA and MRCoNS), followed by type III with 11.6% (identified only for MRSA); suggesting that most of the MRS isolates in the present study may have originated from HA-MRSA or/and HAMRCoNS. Alli, et al.,[18] reported that the MRSA clones in circulation in south-west, Nigeria were dominated by types II and V with 36.4% and 42.4% respectively. Amirkhiz et al.,[7] reported that type III MRSA was predominant with 69.8% in northwest, Iran. For MRCoNS isolates, type III was found to be the most prevalent in southern Brazil (52%); type IV was the most common in United States (36%) and Finland (33%) and type II in China.[19] SCCmec type II (53 kb) and type III (67 kb) are large and possess mobile genetic elements such as integrated plasmids (pUB110, pI258 and pT181) and transposons (e.g. Tn554). Type II carries multiple resistance genes and has been associated with strains that began to be prevalent in the 1980s and is frequently associated with HA-MRSA. Type III encodes the largest number of resistance genes and is associated with serious hospital infections. In contrast, type IV (21-24 kb) and type V (27 kb) have shorter elements, more mobile, generally susceptible to non-beta-lactam antibiotics and linked with community MRSA clones.[20,21] There were variations in the combinations of ccr and mec complexes for the MRS isolates in the present study. This is in line with the reports of Amirkhiz, et al.,[7] and Abadi, et al.,[22] who recorded variations in SCCmec cassettes. These variations included strains containing both SCCmec type IV and ccrC, type III strains carrying ccrAB1, ccrAB2 or ccrAB3 gene, strains with multiple ccr genes, strains carrying ccr genes without a mec complex and a mecA positive strain with neither ccr genes nor a mec complex. CONCLUSION MRSA and MRCoNS SCCmec type II were the predominant isolates in this present study. MRCoNS type II isolates may be related to the presence of predominantly MRSA isolates carrying mostly SCCmec type II element in south-south, Nigeria. This is because coagulasenegative staphylococci (CoNS) are known to carry SCCmec elements at a high frequency and they serve as possible reservoir of resistance genes. Also, horizontal transfer of mecA DNA from CoNS to S. aureus was observed in a previous study.[19] There will be a need: to develop new SCCmec classification methods or alternatively employ whole genome sequencing approach to assist in typing the non-typeable MRS; for active www.wjpps.com

Vol 5, Issue 7, 2016.

100

Okwu et al.


MRS surveillance by healthcare institutions in Nigeria; to develop and enforce measures in preventing the spread of MRS infections such as frequent hand washing, rational prescription of antibacterial drugs, proper disinfection and sterilization. These will aid curb the spread and emergence of MRS in Nigeria. ACKNOWLEDGEMENTS We are grateful to the VIB Department of Molecular Microbiology, Laboratory of Molecular Cell Biology, Institute of Botany and Microbiology, KU Leuven, Belgium where the study was done. We also thank Sona Kucharikova (KU Leuven, Belgium) for providing S. aureus strains USA300 and SH1000; Herminia de Lencastre and Catarina Milheiriço (Laboratório de Genética Molecular, Instituto de Tecnologia Química e Biológica, Oeiras, Portugal ) for strains COL, BK2464, ANS46, MW2 and HDE288; Robert Daum and Susan Boyle-Vavra (MRSA Research Centre, University of Chicago Medical Centre, USA) for Q2314 and 8/63P and Yuki Uehara (Juntendo University Faculty of Medicine, Department of Infection Control Science/General Medicine, Japan) for JCSC4469 and WIS used in this work (Table 1). Funding/Support Coimbra Scholarship for Sub-saharan African countries and the Flemish Science Foundation, FWO financially supported the research. REFERENCES 1. Okwu MU, Mitsan O, Okeke OP. Prevalence and antimicrobial susceptibility profiles of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) isolates among healthy individuals in Okada, south-south, Nigeria. US Open Pharmaceutical, Biological and Chemical Sciences Journal., 2014; 1(1): 1-9. 2. Milheiriço C, Oliveira DC, de Lencastre H. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrob Agents Chemother., 2007; 51(9): 3374-7. 3. Zong Z, Peng C, Lü X. Diversity of staphylococcal cassette chromosome mec in methicillin-resistant coagulase negative staphylococci clinical isolates. PLOS ONE., 2011; 6(5): e20191. 4. Ghaznavi-Rad E, Shansudin M, Sekawi Z, Belkum A, Neela V. A simplified multiplex Polymerase chain reaction assay for fast and easy discrimination of globally distributed

www.wjpps.com

Vol 5, Issue 7, 2016.

101

Okwu et al.


staphylococcal cassette chromosome mec types in methicillin-resistant Staphylococcus aureus. J Med Microbiol., 2010; 59: 1135-9. 5. Navidinia M, Fallah F, Lajevardi B, Shirdoost M, Jamali J. Epidemiology of methicillinresistant Staphylococcus aureus isolated from health care providers in Mofid children hospital. Arch Pediatr Infect Dis., 2015; 3(2): e16458. 6. Ito T, Kuwahara-Arai K, Katayama Y, Uehara Y, Han X, Kondo Y, et al. Staphylococcal cassette chromosome mec analysis of methicillin-resistant Staphylococcus aureus. In: Yinduo J, editor.

Methicillin-resistant Staphylococcus aureus protocols, methods in

Molecular Biology. Springer Science and Business media, 2014; 1085: 131-147. 7. Amirkhiz MF, Rezaee MA, Hasani A, Aghazadeh M, Naghili B. Staphylococcal cassette chromosome mec typing of methicillin-resistant Staphylococcus aureus: An eight year experience. Arch Pediatr Infect Dis., 2015; 3(4): e30632. 8. Zhang K, McClure J, Elsayed S, Louie T, Conly JM. Novel multiplex polymerase chain reaction assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I-V in methicillin-resistant Staphylococcus aureus. J Clin Microbiol., 2005; 43(10): 5026-33. 9. Japoni A, Jamalidoust F, Mazyar Z, Alborzi A, Japoni S, Rafaatpour N. Characterization of staphylococcal cassette chromosome mec types and antibacterial susceptibility patterns of methicillin-resistant Staphylococcus aureus in southern Iran. Japanese Journal of Infectious Diseases., 2011; 64(1): 28-33. 10. Cheesbrough, M. Staphylococcus. In: Cheesbrough M, editor. District of Laboratory Practice in Tropical Countries. Cambridge University Press, South Africa, 2004; 157-158. 11. Okwu M, Bamgbala S, Aborisade W. Prevalence of nasal carriage of communityassociated methicillin-resistant Staphylococcus aureus (CA-MRSA) among healthy primary school children in Okada, Nigeria. Journal of Natural Sciences Research., 2012; 2(4): 61-65. 12. Al-Talib H, Yean CY, Al-Khateeb A, Hassan H, Singh KK, Al-Jashamy K, et al. A pentaplex PCR assay for the rapid detection of methicillin-resistant Staphylococcus aureus

and

panton-valentine

leucocidin.

BMC

Microbiol.,

2009;

9:

113.

doi:10.1186/1471-2180-9-113. 13. Taiwo SS, Onile BA, Akanbi AA. Methicillin Resistant Staphylococcus aureus (MRSA) in Ilorin, Nigeria. African Journal of Clinical and Experimental Microbiology., 2004; 5(2): 189-197.

www.wjpps.com

Vol 5, Issue 7, 2016.

102

Okwu et al.


14. Onanuga A, Oyi AR, Onaolapo JA. Prevalence and susceptibility pattern of methicillin resistant Staphylococcus aureus isolates among healthy women in Zaria, Nigeria. African Journal of Biotechnology., 2005; 4(11): 1321– 4. 15. Tiwari HK, Sapkota D, Sen MR. High prevalence of multidrug-resistant methicillinresistant Staphylococcus aureus in a tertiary care hospital in Northern India. Infect. Drug Res., 2008; 1: 57 – 61. 16. Okon KO, Shittu AO, Usman H, Adamu N, Balogun ST, Adesina OO. Epidemiology and antibiotic susceptibility pattern of methicillin-resistant Staphylococcus aureus recovered from tertiary hospitals in northeastern Nigeria. Journal of Medicine and Medical Sciences., 2013; 4(5): 214-20. 17. Ankur B, Devjyti M, Barnali P. Prevalence of nasal carriage methicillin-resistant staphylococci in healthy population of Gangtok, East Sikkim. JIMSA., 2008; 24(4): 191–3. 18. Alli OA, Ogbolu DO, Shittu AO, Okorie AN, Akinola JO, Daniel JB. Association of virulence genes with mecA gene in Staphylococcus aureus isolates from tertiary hospitals in Nigeria. Indian Journal of Pathology and Microbiology., 2015; 58(4): 464-71. 19. Mert G, Kiliç A, Bedir O, Basustaoglu AC. Clinical significance and staphylococcal casstte chromosome mec characterization of coagulase-negative staphylococci isolated from blood cultures. Turk J Med Sci., 2011; 41(5): 859-65. 20. Pereira VC, Cunha ML. Coagulase-negative staphylococcal strains resistant to oxacillin isolated from neonatal blood cultures. Mem Inst Oswaldo Cruz., 2013; 108(7): http://dx.doi.org/10.1590/0074-0276130644. 21. Abdulgader SM, Shittu AO, Nicol MP, Kaba M. Molecular epidemiology of methicillinresistant Staphylococcus aureus in Africa: a systematic review. Front Microbiol., 2015; 6: 348. http://dx.doi.org/10.3389/fmicb.2015.00348 22. Abadi MI, Moniri R, Khorshidi A, Piroozmand A, Mousavi SG, Dastehgoli K et al. Molecular characteristics of nasal carriage methicillin-resistant coagulase-negative staphylococci in school students. Jundishapur Journal of Microbiology., 2015; 8(6): e18591. 23. Oliveira DC, de Lencastre H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother., 2002; 46(7): 2155-61.

www.wjpps.com

Vol 5, Issue 7, 2016.

103