striated muscle myosin heavy chain - Europe PMC

3 downloads 232804 Views 207KB Size Report
Page 1. 7158 Nucleic Acids Research, Vol. 18, No. 23. Nucleotide sequence of full length cDNA for a scallop striated muscle myosin heavy chain. L.Nyitray ...
7158 Nucleic Acids Research, Vol. 18, No. 23

.) 1990 Oxford University Press

Nucleotide sequence of full length cDNA for striated muscle myosin heavy chain

a

scallop

L.Nyitray, E.B.Goodwin and A.G.Szent-Gyorgyi* Department of Biology, Brandeis University, Waltham, MA 02254, USA Submitted October 26, 1990

EMBL

A 6751 nucleotide sequence encoding the striated adductor muscle myosin heavy chain of the scallop, Aequipecten irradians, is presented. Clones were isolated from a plasmid expression cDNA library (1) and sequenced by the dideoxy chain termination method (2). The sequence includes a 144 nucleotide 5' untranslated region, the entire coding region corresponding to 1938 amnino acids, and a 3' untranslated region of 793 nucleotides. The initiation codon at position 145, the termination codon at position 5959, and the poly A addition consensus signal AATAAA (3) at position 6729 are underlined.

accession no.

X55714

100 200 300 400 500 600 ,700

Soo0 900 '1000 '1100 ,1200 '1300 '1400 ;1500 :1600 ;1700 :1800 i1900 :2000 :2100

ACKNOWLEDGEMENTS

:2200 ;2300 i2400 :2500 '2600 ;2700 :2800 '2900

We thank Dr. L.A.Leinwand for her continued help and suggestions. This work was supported by NIH Grant AR15963-24 and MDA grants.

REFERENCES

3000 i3 100 i3200 33300 3400

Nyitray,L., Goodwin,E.G. and Szent-Gyorgyi,A.G. (1990) J. Biol. Chem. (in preparation). 2. Hattari,M. and Sakaki,Y. (1986) Anal. Biochem. 152, 232-238. 3. Proudfoot,N.J. and Brownlee,G.G. (1976) Nature 263, 211 -214. 1.

5000

s100

Lr5700 5800 5900 i6000 6100 K6200 6300 .' 6400

6500 6600 6700

TAATGACGATTATATGATGATGAACCTTAIMAGCTCTTCTATGATATAT

*

To whom correspondence should be addressed