NOTE
Virology
Surveillance of Jaagsiekte Sheep Retrovirus in Sheep in Hokkaido, the Northern Island of Japan Naoyoshi MAEDA1,2), Yasuo INOSHIMA3)*, Satoshi OOUCHI4) and Toshimitsu UEDE1) 1)
Division of Molecular Immunology and 2)Research Center for Infection-Associated Cancer, Institute for Genetic Medicine, Hokkaido University, Kita-15, Nishi-7, Kita-ku, Sapporo 060–0815, 3)Laboratory of Food and Environmental Hygiene, Department of Veterinary Medicine, Gifu University, 1–1 Yanagido, Gifu 501–1193 and 4)Hokkaido Hayakita Meat Inspection Center, 695 Toasa, Yasuhira-cho, Isaharai-gun 059–1433, Japan (Received 24 March 2011/Accepted 14 June 2011/Published online in J-STAGE 28 June 2011)
ABSTRACT.
Surveillance of jaagsiekte sheep retrovirus (JSRV) infection was performed by polymerase chain reaction (PCR) of blood DNA samples collected from 40 sheep and goats in 10 different flocks in Hokkaido, the northern island of Japan. No exogenous (oncogenic) JSRV sequence was detected by PCR in these samples, while the ovine endogenous retrovirus sequence was successfully amplified in all samples. Our paper is the first demonstration of JSRV surveillance in Japan and shows no evidence of oncogenic JSRV infection in sheep and goats in Hokkaido. KEY WORDS: jaagsiekte sheep retrovirus, ovine pulmonary adenocarcinoma, surveillance. J. Vet. Med. Sci. 73(11): 1493–1495, 2011
Ovine pulmonary adenocarcinoma (OPA) and enzootic nasal adenocarcinoma (ENA) are contagious neoplasms caused by ovine -retroviruses, jaagsiekte sheep retrovirus (JSRV) and enzootic nasal tumor virus type 1 (ENTV-1), respectively; OPA arises from secretory epithelial cells (type II pneumocytes and Clara cells) of the distal airways in the lungs, while ENA arises from secretory epithelial cells of the ethmoid turbinate of the nasal cavity in the nasal glands of goats and sheep [5]. From a virological point of view, the JSRV and ENTV envelope proteins are thought to be the causative factors of OPA and ENA, respectively [12]. It was reported that the incubation period of OPA was on average 6–8 months after infection and that the mortality in sheep in first-introduced flocks was 30–50% in the first year, resulting in large economic losses for farmers [20]. A typical clinical sign of sheep with OPA is the flow of abundant mucoid fluid containing infectious JSRV from nostrils; in some severe cases, as much as 300 ml of fluid accumulates. The concern is that the fluid and/or aerosol from nostrils may contaminate farms and pastures, and then the disease may spread and persist subclinically in flocks. Therefore, rapid and reliable diagnosis of sheep, even those that appear healthy, is important. OPA and ENA can be found worldwide, except in Australia and New Zealand [5]. JSRV has been eradicated in Iceland, so it is now also free from OPA [5]. In Japan, since sheep have been imported from not only OPA-free countries including Australia and New Zealand but also from countries reporting OPA, including the UK, the U.S.A. and Canada, there is concern that JSRV might have contaminated imported sheep. Even though there are two reports describing naturally occurring ENA cases in Japan [10, 18], it is * CORRESPONDENCE TO: INOSHIMA, Y., Laboratory of Food and Environmental Hygiene, Department of Veterinary Medicine, Gifu University, 1–1 Yanagido, Gifu 501–1193, Japan. e-mail:
[email protected]
unknown whether sheep and goats in Japan are infected with JSRV. In this study, we investigated for the first time whether or not JSRV is present in sheep in Hokkaido, the northern island of Japan, which is the major sheep-breeding district (> 50%) in Japan. While antibodies against JSRV are not induced in sheep [13], the JSRV genome can be detected in peripheral blood cells [8]; thus, blood is a useful material for checking JSRV infection in sheep, especially in the subclinical stage of OPA. Blood samples from 38 sheep and 2 goats in 10 different flocks (flocks A to J) were collected at the Hokkaido Hayakita Meat Inspection Center. Genomic DNA of blood samples was extracted with a DNeasy Blood and Tissue Kit (QIAGEN, Hilden, Germany), according to the manufacturer’s instructions. Samples were randomly obtained from 7 sheep in flock A, 2 sheep in flock B, 2 sheep in flock C, 11 sheep in flock D, 2 sheep in flock E, 1 sheep in flock F, 2 goats in flock G, 8 sheep in flock H, 2 sheep in flock I and 3 sheep in flock J, each of which comprised either Suffolk, Polled Dorset and Cheviot sheep or Saanen goats (Table 1). The ages of the sheep/goats used in this study ranged from 1 to 48 months, and the average age was approximately 14.8 months (Table 1); in general, OPA appeared in sheep ranging in age from 2 months to 11 years, and most clinical cases are thought to occur between 2 and 4 years of age [9]. We performed polymerase chain reaction (PCR) to detect the JSRV genome as previously reported [14]. The PCR cycle of the amplification consisted of initial denaturing at 95°C for 2 min, followed by 40 amplification cycles of denaturing at 95°C for 30 sec, primer annealing at 57°C for 1 min and extension at 72°C for 1 min, ending with a final extension at 72°C for 7 min with P1 and P2 primers to amplify a sequence of 229 bp in the gag region of both oncogenic JSRV and ovine endogenous retroviruses [7, 16] (Table 2). The amplified 229 bp fragment contains a Sca I restriction enzyme site in all known oncogenic JSRVs but
1494
N. MAEDA, Y. INOSHIMA, S. OOUCHI AND T. UEDE
Table 1.
Breed, age, sex and flock of samples
No
Breed
Age (month)
1 2 3 4 5 6 7 8 9 10 11 12 15 17 18 20 21 22 25 26 27 28 29 30 31 32 33 34 35 36 38 39 40 41 42 43 44 45 46 48
Suffolk Suffolk Suffolk Suffolk Suffolk Suffolk Suffolk Unknown Polled Dorset Polled Dorset Polled Dorset Suffolk Suffolk Suffolk Suffolk Unknown Unknown Unknown Unknown Unknown Unknown Suffolk Saanen Saanen Unknown Suffolk Suffolk Suffolk Suffolk Suffolk Suffolk Cheviot Suffolk Suffolk Cheviot Cheviot Suffolk Suffolk Suffolk Suffolk
11 11 11 11 11 10 10 24 10 10 10 12 12 12 12 11 10 10 11 11 13 1 24 48 25 11 11 16 16 16 15 13 13 38 13 13 15 15 15 15
Sex
A A A A A B B C D D D E E A A D D D D D D F G G C D D H H H H I I J J J H H H H
A total of 40 samples were tested. Nos. 29 and 30 are samples from goats
Table 2.
Flock
not in ovine endogenous retroviruses [6, 14, 19]. To distinguish these viruses, we digested the PCR fragments with Sca I, and found that none of the PCR products had Sca I sites (Fig. 1). For the internal control, PCR to amplify ovine glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was also performed to check the condition of the genome [15] (Table 2), and all samples were positive for the amplification of GAPDH (not shown). Furthermore, we performed a hemi-nested (hn)-PCR that could specifically detect the oncogenic JSRV, as previously performed by several investigators [1–4, 15, 17]. The PCR cycle of the first round of amplification consisted of initial denaturing at 96°C for 3 min, followed by 40 amplification cycles of denaturing at 94°C for 30 sec, primer annealing at 59°C for 1 min and extension at 72°C for 1 min, ending with a final extension at 72°C for 7 min with P-I and P-III primers to amplify a sequence of 176 bp in the U3 region of the JSRV long terminal repeat (LTR) (Table 2). Then, the second round of amplification was performed with P-I and P-VI primers to amplify a sequence of 133 bp within the first PCR (Table 2). Even in this sensitive hn-PCR, the JSRV genome could not be detected (not shown). Thus, as far as we have tested in this study, oncogenic JSRV was not detected in sheep on Hokkaido island, Japan. De las Heras et al. reported that the incidence of JSRV infection, determined by the same method, in not only sheep with clinical evidence of disease but also sheep with no evidence of disease or from countries free of OPA [2]. In the surveillance, they were able to detect the oncogenic JSRV in 16.6–83.3% of sheep with no evidence of disease. However, Lewis et al. pointed out that the sensitivity was relatively low and depends on the clinical stage [11]; PCR might inevitably produce false negative results, suggesting that improvement of the PCR method is required. In conclusion, sensitive PCR methods detected no JSRVconserved sequences in the LTR or gag region in sheep and goats in Hokkaido, the northern island of Japan. However, the sample size was relatively small; the results obtained in this study do not exclude the possibility that the oncogenic JSRV is present in some areas in Hokkaido. Thus, continuous surveillance of JSRV infection in sheep and goats should be performed. As a follow-up to this study, the incidence of JSRV infection in sheep and goats in other areas of Japan is currently being investigated.
Primers for PCR
Name
Orientation
Region amplified Sequence (5’–3’)
Position
Reference
P-1 P-2
Forward Reverse
gag
GCTGCTTTRAGACCTTATCGAAA ATACTGCAGCYCGATGGCCAG
1598–1620 1806–1826
14
P-I P-III P-VI
Forward Reverse Reverse
U3(LTR)
TGGGAGCTCTTTGGCAAAAGCC CACCGGATTTTTACACAATCACCGG TGATATTTCTGTGAAGCAGTGCC
7210–7231 7361–7385 7316–7338
15
Ovine GAPDH Ovine GAPDH
Forward Reverse
GAPDH
TCACCACCATGGAGAAGGCT TTCATTGTCATACCAGGAAA
299–318 926–945
15
JSRV SURVEILLANCE IN HOKKAIDO 6.
7.
8.
9.
10.
Fig. 1. Results of PCR followed by Sca I digestion. PCR was performed with primers P1 and P2 described in Table 2. The plasmids pJSRV21 (GenBank accession number AF105220) and penJS56A1 (GenBank accession number AF153615) were used as positive and negative controls for restriction enzyme Sca I digestion, respectively. The PCR products were digested with Sca I at 37°C for 1 hr, and visualized by electrophoresis in 2.5% agarose gels stained with 1 g/ml ethidium bromide. Numbers indicate the sample IDs shown in Table 1. EN, endogenous penJS56A1 plasmid; EX, exogenous pJSRV21 plasmid; M, molecular size markers of 50 bp; NC, negative control with water.
ACKNOWLEDGMENT. This work was supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology, Japan. REFERENCES 1.
2.
3.
4.
5.
Cousens, C., Maeda, N., Murgia, C., Dagleish, M. P., Palmarini, M. and Fan, H. 2007. In vivo tumorigenesis by Jaagsiekte sheep retrovirus (JSRV) requires Y590 in Env TM, but not full-length orfX open reading frame. Virology 367: 413–421. De Las Heras, M., Ortín, A., Salvatori, D., Pérez de Villareal, M., Cousens, C., Miguel Ferrer, L., Miguel Cebrián, L., García de Jalón, J. A., Gonzalez, L. and Sharp, J. M. 2005. A PCR technique for the detection of Jaagsiekte sheep retrovirus in the blood suitable for the screening of ovine pulmonary adenocarcinoma in field conditions. Res. Vet. Sci. 79: 259–264. García-Goti, M., González, L., Cousens, C., Cortabarría, N., Extramiana, A. B., Minguijón, E., Ortín, A., De Las Heras, M. and Sharp, J. M. 2000. Sheep pulmonary adenomatosis: characterization of two pathological forms associated with jaagsiekte retrovirus. J. Comp. Pathol. 122: 55–65. González, L., García-Goti, M., Cousens, C., Dewar, P., Cortabarría, N., Extramiana, A. B., Ortín, A., De Las Heras, M. and Sharp, J. M. 2001. Jaagsiekte sheep retrovirus can be detected in the peripheral blood during the pre-clinical period of sheep pulmonary adenomatosis. J. Gen. Virol. 82: 1355–1358. Griffiths, D. J., Martineau, H. M. and Cousens, C. 2010. Pathology and pathogenesis of ovine pulmonary adenocarcinoma. J. Comp. Pathol. 142: 260–283.
11.
12. 13.
14.
15.
16.
17.
18.
19.
20.
1495
Hecht, S. J., Carlson, J. O. and DeMartini, J. C. 1994. Analysis of a type D retroviral capsid gene expressed in ovine pulmonary carcinoma and present in both affected and unaffected sheep genomes. Virology 202: 480–484. Hecht, S. J., Stedman, K. E., Carlson, J. O. and DeMartini, J. C. 1996. Distribution of endogenous type B and type D sheep retrovirus sequences in ungulates and other mammals. Proc. Natl. Acad. Sci. U.S.A. 93: 3297–3302. Holland, M. J., Palmarini, M., Garcia-Goti, M., Gonzalez, L., McKendrick, I., De Las Heras, M. and Sharp, J. M. 1999. Jaagsiekte retrovirus is widely distributed both in T and B lymphocytes and in mononuclear phagocytes of sheep with naturally and experimentally acquired pulmonary adenomatosis. J. Virol. 73: 4004–4008. Hunter, A. R. and Munro, R. 1983. The diagnosis, occurrence and distribution of sheep pulmonary adenomatosis in Scotland 1975 to 1981. Br. Vet. J. 139: 153–164. Kawasako, K., Okamoto, M., Kurosawa, T., Nakade, T., Kirisawa, R., Miyashou, T., Komine, M., Go, T., Imazu, S., Takeuchi, N., Tomonaga, K., Ikuta, K., Akihara, Y., Shimoyama, Y., Hirayama, K. and Taniyama, H. 2005. Enzootic intranasal tumour virus infection in apparently healthy sheep in Japan. Vet. Rec. 157: 118–120. Lewis, F. I., Brülisauer, F., Cousens, C., McKendrick, I. J. and Gunn, G. J. 2011. Diagnostic accuracy of PCR for Jaagsiekte sheep retrovirus using field data from 125 Scottish sheep flocks. Vet. J. 187: 104–108. Maeda, N., Fan, H. and Yoshikai, Y. 2008. Oncogenesis by retrovirus: old and new paradigms. Rev. Med. Virol. 18: 387–405. Ortín, A., Minguijón, E., Dewar, P., García-Goti, M., Ferrer, L. M., Palmarini, M., González, L., Sharp, J. M. and De Las Heras, M. 1998. Lack of specific response against a recombinant capsid protein of Jaagsiekte sheep retrovirus in sheep and goats naturally affected by enzootic nasal tumour or sheep pulmonary adenomatosis. Vet. Immunol. Immunopathol. 61: 229–237. Palmarini, M., Cousens, C., Dalziel, R. G., Bai, J., Stedman, K., DeMartini, J. C. and Sharp, J. M. 1996. The exogenous form of Jaagsiekte retrovirus is specifically associated with a contagious lung cancer of sheep. J. Virol. 70: 1618–1623. Palmarini, M., Holland, M. J., Cousens, C., Dalziel, R. G. and Sharp, J. M. 1996. Jaagsiekte retrovirus establishes a disseminated infection of the lymphoid tissues of sheep affected by pulmonary adenomatosis. J. Gen. Virol. 77: 2991–2998. Varela, M., Spencer, T. E., Palmarini, M. and Arnaud, F. 2009. Friendly viruses: the special relationship between endogenous retroviruses and their host. Ann.New.York Acad. Sci. 1178: 157–172. Voigt, K., Brügmann, M., Huber, K., Dewar, P., Couses, C., Hall, M., Sharp, J. M. and Ganter, M. 2007. PCR examination of bronchoalveolar lavage samples is a useful tool in pre-clinical diagnosis of ovine pulmonary adenocarcinoma (Jaagsiekte). Res. Vet. Sci. 83: 419–427. Yonemichi, H., Ohgi, T., Fujimoto, Y., Okada, K., Onuma, M. and Mikami, T. 1978. Intranasal tumor of the ethmoid olfactory mucosa in sheep. Am. J. Vet. Res. 39: 1599–1606. York, D. F., Vigne, R., Verwoerd, D. W. and Querat, G. 1992. Nucleotide sequence of the jaagsiekte retrovirus, an exogenous and endogenous type D and B retrovirus of sheep and goats. J. Virol. 66: 4930–4939. York, D. F. and Querat, G. 2003. A history of ovine pulmonary adenocarcinoma (jaagsiekte) and experiments leading to the deduction of the JSRV nucleotide sequence. Curr. Top. Microbiol. Immunol. 275: 1–23.
