Department ofBiochemistry, University ofMiami School ofMedicine, Miami, Florida 33101 ... hybrid gene isexpressed in a heat-induced fashion in trans-.
Vol. 5, No. 1
MOLECULAR AND CELLULAR BIOLOGY, Jan. 1985, p. 197-203
0270-7306/85/010197-07$02.00/0 Copyright C 1985, American Society for Microbiology
The Heat Shock Consensus Sequence Is Not Sufficient for hsp7O Gene Expression in Drosophila melanogaster JAHANSHAH AMIN, RUBEN MESTRIL, ROBERT LAWSON, HELENE KLAPPER, AND RICHARD VOELLMY* Department of Biochemistry, University of Miami School of Medicine, Miami, Florida 33101 Received 20 July 1984/Accepted 9 October 1984 A hybrid gene in which the expression of an Escherichia coli j-galactosidase gene was placed under the control of a Drosophila melanogaster 70,000-dalton heat shock protein (hsp70) gene promoter was constructed. Mutant derivatives of this hybrid gene which contained promoter sequences of different lengths were prepared, and their heat-induced expression was examined in D. melanogaster and COS-1 (African green monkey kidney) cells. Mutants with 5' nontranscribed sequences of at least 90 and up to 1,140 base pairs were expressed strongly in both cell types. Mutants with shorter 5' extensions (of at least 63 base pairs) were transcribed and translated efficiently in COS-1 but not at all in D. melanogaster cells. Thus, in contrast to the situation in COS-1 cells, the previously defined heat shock consensus sequence which is located between nucleotides 62 and 48 of the hsp70 gene 5' nontranscribed DNA segment is not sufficient for the expression of the D. melanogaster gene in homologous cells. A second consensus-like element 69 to 85 nucleotides upstream from the cap site is postulated to be also involved in the heat-induced expression of the hsp7O gene in D. melanogaster cells.
tosidase hybrid genes with upstream sequences of different lengths has been examined.
The genes coding for the Drosophila melanogaster 70,000dalton heat shock protein (hsp7o) have been isolated and have been characterized by DNA sequence analysis (4, 6-8, 11, 22, 23). The hsp70 genes themselves or fusion genes consisting of unrelated coding sequences which had been linked to hsp70 gene control elements have been introduced into a variety of different cells where they were found to be expressed in a heat-induced fashion. That the expression of the introduced genes is controlled at the transcriptional level has been shown in experiments with monkey cells (16, 20), Xenopus laevis oocytes (24), and mouse cells (3). By analyzing the expression in COS-1 (SV40 transformed African green monkey kidney) cells or X. laevis oocytes of mutant D. melanogaster hsp70 genes with 5' nontranscribed sequences of different lengths, Pelham (20) and Mirault et al. (16) have defined a sequence element, the heat shock consensus sequence, located immediately upstream from the hsp70 gene TATA box, which is required for expression of the hsp70 genes. Since these studies have employed heterologous cell systems, the question has remained unanswered whether the heat shock consensus sequence alone contains all the necessary information for the regulated expression of D. melanogaster hsp70 genes in homologous cells. Recently procedures have become available for introducing and studying the expression of genes in D. melanogaster cells. Rubin and Spradling have developed an elegant technique for introducing genes into the D. melanogaster germline (21). Using this approach, Lis et al. (10) have shown that a D. melanogaster hsp70-Escherichia coli ,-galactosidase hybrid gene is expressed in a heat-induced fashion in transformed flies. Methods for the transfection of cultured D. melanogaster cells have also been worked out by DiNocera and Dawid (5), by Morganelli and Berger (18), and in our laboratory (R. Lawson, R. Mestril, P. Schiller, and R. Voellmy, Mol. Gen. Genet., in press). Here we describe our attempts to define the upstream sequence elements required for the regulated expression of a D. melanogaster hsp70 gene in cultured D. melanogaster cells. The transient expression of hsp7o-E. coli P-galac*
MATERIALS AND METHODS Plasmids 622c, 622a, 6221, 622/14, and 622x. Plasmid 622c is a derivative of p522 whose construction has been described elsewhere (R. Lawson, R. Mestril, P. Schiller, and R. Voellmy, Mol. Gen. Genet., in press). Briefly, an XhoI linker sequence was introduced at the XmaIII site of vector pSVod (15). A 5.75-kilobase-pair (kbp) hybrid gene segment was inserted in between the XhoI and the BamHI site of the pSVod derivative. The gene segment consisted of a 450-basepair (bp) XhoI-Sau3a D. melanogaster 70,000-dalton heat shock protein (hsp7o) gene fragment which included 194 bp of 5' nontranscribed sequence, a complete RNA leader region and the first seven hsp70 codons, a 0.9-kb BamHI-ClaI fragment containing the first one-third of the sequence coding for E. coli 0-galactosidase isolated from pMC1403 (1), a 2.1-kbp ClaI-SalI fragment from pMC1871 (2) representing the remainder of the ,B-galactosidase coding sequence, and a 2.3-kbp D. melanogaster hsp70 gene 3' nontranslated sequence element from p56H8 (17). Plasmid 622c (see Fig. 1) is the result of a five-step construction scheme. Each individual step was carefully controlled, and all intermediate plasmids were characterized extensively by restriction mapping and hybridization experiments to establish the presence and correct location of the different sequence elements in the plasmids. The fusion in p622c between the 450-bp hsp70 gene fragment and the truncated E. coli 3-galactosidase gene was such that the beginning of the hsp70 coding sequence was linked in phase to the bacterial gene sequence, thereby producing a functional hybrid P-galactosidase coding region. Fusion genes such as the one in p622c were expressed in E. coli. The ,-galactosidase-negative K12 strain MC1061 was used in all transformation experiments. Bacterial colonies containing plasmids with functional hybrid genes could easily be identified on plates containing the 3-galactosidase indicator substrate 5-bromo-4-chloro-3-indolyl-,3-D-galactopyranoside (Xgal; used at 40 ,g/ml). For construction of plasmid 622a, p622c was digested with BssHII, the sticky ends were filled in by E. coli DNA
Corresponding author. 197
198
MOL. CELL. BIOL.
AMIN ET AL.
polymerase fragment A, XhoI linkers were ligated to the DNA which was subsequently digested with ClaI and XhoI, and a 1.2-kb ClaI-XhoI fragment was purified by electrophoresis and elution from a low-melt agarose gel by standard procedures (13). This fragment, which contained hsp70 gene sequences including 68 bp of 5' extension and part of the 3-galactosidase coding region, was ligated to a gel-purified 7.35-kbp ClaI-XhoI fragment from p622c. The ligation mixture was then used for transformation. Plasmids 622a, 622a3, and a4 resulted from independent experiments of this kind (Fig. 1). Plasmid 132E3/6 (Fig. 1) is a subclone of p132E3 (8, 17). It was made by inserting a 3.3-kbp BglII hsp70 gene segment which included 1,140 bp of 5' nontranscribed sequence into the BamHI site of pSVod. A 4.25-kbp XhoI-BglII fragment from p622c which contained the hsp70-,B-galactosidase hybrid gene, including 0.8 kbp of 3' nontranslated and 194 bp of 5' nontranscribed sequence, was inserted in between the XhoI site in the upstream sequence of the hsp70 gene in p132E3/6 and the unique BamHI site in the middle of the 132E3/6 hsp70 gene, thereby producing (in p6221) a hybrid hsp70-p-galactosidase gene which was flanked by 1,140 bp of uninterrupted hsp70 5' nontranscribed sequence (Fig. 1). Plasmid 622n (Fig. 1) was made by digesting p622c with NruI, incubating the digest with E. coli DNA polymerase fragment A, and digesting the material subsequently with ClaI. A 1.2-kbp fragment was isolated from a low-melt agarose gel. Plasmid 622c was also digested with XhoI, and the sticky ends were filled in before further digestion of the material with ClaI. A 7.35-kbp fragment was purified from a low-melt agarose gel and was ligated to the 1.2-kbp fragment described above. The mixture was used for transformation after treatment with XhoI. RH
a.
p
t
> s t8 1 6.8Kb / Xb 8-7Kb
Xb
s
Ba
Bs
el
mmmc
N
N N x
smm
-1140 -254 N -194 Xb X
p
Bs
-6750 N
f
NVX *mmn
v
P
(X/W N
P
FIG. 1. Structures of hsp70-p-galactosidase hybrid genes. Abbreviations for restriction sites: Ba, BamHI; Bg, BglIl; Bs, BssHII; C, ClaI; H, HindlIl; N, NruI; P, PstI; R, EcoRI; X, Xhol; and Xb, XbaI. Sites which were destroyed during construction are in parentheses. Arrows indicate the presumed start sites and the orientation of transcription of the hybrid genes. Symbols: =, P-galactosidase DNA; _, hsp70 DNA; -----, simian virus 40 DNA; and
pBR322 DNA.
For preparation of plasmid 622/14, p622a was digested with BssHII. The digest was then treated with nuclease Si to remove sticky ends. The DNA was incubated further with ClaI and then subjected to electrophoresis on a low-melt agarose gel. A 1.2-kbp fragment was isolated and ligated to ClaI-SmaI-digested p671. Plasmid 671 is a pSVod derivative containing, between its BamHI and XmaIII sites, a truncated P-galactosidase gene which is flanked at its 5' end by a unique SmaI site and at its 3' end by hsp70 gene 3' nontranslated sequences. The P-galactosidase gene in p671 is in the same orientation as in p622c. For preparation of p622x, p622a was digested with XhoI. Sticky ends were removed by nuclease S1 treatment. The material was then religated and digested extensively with XhoI before being used to transform E. coli. Bal 31 deletion mutants. p622c DNA (30 p.g) was digested with XhoI (Fig. 2). The digested material was then incubated at 28 or 30°C with 2.5 U of Bal 31 (New England Biolabs) in a total volume of 200 ,u1 in the buffer solution recommended by the supplier. Samples (5 RI1) were removed over a 30-min period at 1- to 2-min intervals and were pipetted into tubes containing equal volumes of 10 mM Tris-hydrochloride, 1 mM EDTA, 10 mM EGTA [ethylene glycol-bis(paminoethyl ether)-N,N-tetraacetic acid (pH 7.4)], and equilibrated phenol. The samples were phenol extracted three times. After removal of phenol, the samples were blunt ended with E. coli DNA polymerase fragment A. XhoI linkers were then added to the material. After activation by XhoI cleavage, excess linkers were removed by passage of the DNAs through Sephadex G75. The DNAs were ligated subsequently and used for transformation. Ampicillin-resistant transformants which produced P-galactosidase on Xgal plates were selected for further characterization. Small amounts of plasmid DNAs were prepared from several hundred colonies by a rapid procedure (9). Double digests with PstI and XhoI of the DNAs were analyzed by gel electrophoresis. A number of plasmids with shortened 5' nontranscribed DNA sequences were then selected (Fig. 3), and larger quantities of DNAs of these plasmids were prepared by CsCl banding from cleared lysates by standard procedures. All mutant genes chosen for expression studies were recloned into pSVod to ensure that the hsp70 gene 5' nontranscribed sequences of all mutant genes were flanked by identical vector sequences (Fig. 2). The original mutant gene-containing plasmids were digested with BglII and XhoI. The Xhol-BglII gene segments were then inserted in between the Sall and BamHI sites of pSVod. The restriction analysis of the recloned mutant genes is shown in Fig. 3. Colony hybridization assays to characterize hybrid genes were carried out by standard procedures (13). The promoter sequences of several important hybrid genes were examined by direct DNA sequencing by the method of Maxam and Gilbert (14). Cell culture and transfection. Schneider line 3 D. melanogaster cells were grown in Schneider D. melanogaster medium (SDM; GIBCO Diagnostics) with 10% fetal calf serum (FCS; GIBCO) at 25°C. Nearly confluent cultures in 90-mm dishes were used for transfection-transient expression experiments. The cells were washed once carefully with SDM. Transfection solution (2 ml) containing DEAEdextran (100 pLg/ml; molecular weight, 500,000; Sigma Chemical Co.) and plasmid DNA (2.5 to 5 ,ug/ml) in SDM were added per dish, and the cells were incubated for 4 to 6 h. After one wash with SDM, the cells were incubated overnight in SDM containing 10% FCS (5 ml per dish).
Hsp7O GENE EXPRESSION
VOL. S, 1985
199
mixtures was read at 420 and 550 nm, and relative Pgalactosidase activities were calculated by using the following formula: A420 - 1.1 x A550. A280 measurements were
used to correct for differences in the protein concentrations of different cleared lysates. COS-1 cell cultures were heat-treated for 3 to 4 h at42°C in a tissue culture incubator. The cells were returned to37°C for 24 h before the P-galactosidase assays were carried out. The cultures were then washed twice with phosphate-buffwith 0.5% Nonidet P-40 was ered saline. Z buffer (200 added to each dish, and the cells were scraped off the dishes and were lysed by pipetting or gentle agitation. After censamples of trifugation to remove insoluble debris, lysates from individual cultures were added to 100 ptl of ONPG (4 mg/ml) in Z buffer. Reactions and absorbance measurements were performed as described above. RESULTS hybrid genes. D. melanogaster hsp7O-E. coli The parent plasmid used in this study, 622c (Fig. 1 and 2), contains a 450-bp D. melanogaster hsp70 gene fragment which includes 194 bp of 5' nontranscribed sequence, a hsp70 complete RNA leader region, and the first seven codons. This fragment has been linked in phase to a trun-
pul)
* p
N
-50
400-pul
Xho I
B3-31
.
aPvod
H
S URa
j(-galactosidase
XhoI L hinkra.Lgatftn X N
p Xho)I jBg N
Se
Lug
fi.s I.
*
rMEN=Nq--
I
WXS)N
(Ba/B9)
FIG. 2. Construction of deletion mutants and recloning of the genes into pSVod. Abbreviations and symbols are as in Fig. 1. For details of the procedures see the text.
mutant
COS-1 cells were grown in minimal essential medium (MEM [Earle salts]; M. A. Bioproducts) with 10% FCS under 5% CO2 at 37°C. A DEAE-dextran-based procedure was used for transfection (12). Subconfluent cultures in 90-mm dishes were washed twice with MEM and were then incubated for 30 min at 37°C with 2 ml of DEAE-dextran (500 pg/ml), chloroguine (100,ug/ml), and plasmid DNA (2.5 to 5 p.g/ml) in MEM. The cells were washed twice with MEM subsequently and were incubated for another 3 to 4 h in After two MEM with 10% FCS and chloroquine (100 washes with MEM, the cells were incubated further for 48 h at 37°C in MEM with 10% FCS (5 ml per dish). Heat treatment and,(-galactosidase assay. D. melanogaster cells were heat treated by incubation in a water bath (36 to 37°C) for 2 h. The cells were then scraped off the plates, collected by centrifugation and suspended in 200 pAl of Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCI, 1 mM MgSO4, 50 mM ,-mercaptoethanol, [pH 7.0]) per dish, containing 0.5% Nonidet P-40. Lysis was completed by repeated pipetting. o-Nitrophenyl-,-D-galactopyranoside (ONPG; 100 pul, 4 mg/ml; Sigma) was added to 200 ,ul of lysate which had been cleared before by centrifugation. Reactions usually were for 1 to 2 h at 37°C and were stopped by the addition of 200 RI1 of 1 M Na2CO3. After centrifugation to remove insoluble debris, absorbance of the reaction
,ug/ml).
cated (lacking the first seven codons) E. coli P-galactosidase gene gene segment flanked at its 3' end by 2.3 kbp of hsp70 signal. 3' sequence including the polyadenylic acid addition The resulting hybrid gene has been inserted into pSVod, a pBR322-derived vector suitable for the introduction and amplification of genes in COS-1 cells (15). Plasmid 622c was introduced into COS-1 and D. melanogaster S3 cells by DEAE-dextran-mediated transfection andof was found to direct the synthesis of substantial amounts P-galactosidase activity in heat-treated but not in untreated COS-1 and D. melanogaster cells (Table 1). Hybrid gene-directed j-galactosidase synthesis can be used as an assay for the presence of funtional upstream promoter elements. If readthrough transcription of hybrid genes from start sites somewhere in the vector sequences occurred only at a negligible level (or if the readthrough transcripts were not recognized by the translation machine, or both) and if none of the vector sequences served as RNA polymerase entry sites, measurements of rates of synthesis of hybrid gene products could be employed to assay for the presence, in hybrid genes, of functional upstream promoter elements. To determine whether ,-galactosidase activity measurements could be used in this fashion, mutant gene 622n was constructed (Fig. 1). This mutant gene contains a complete hsp70-,-galactosidase RNA coding region and is flanked at its 5' end by 50 bp of hsp70 gene nontranscribed sequence which includes the TATA motif but not the heat shock consensus sequence or other upstream sequence elements. The mutant gene in p622n was found not to be expressed in either COS-1 or D. melanogaster cells (Table 1). The hybrid could gene-directed production of ,3-galactosidase activity therefore be used as assay for upstream promoter elements. Since our approach involved measurements of hybrid all parts gene expression at the protein level, it required thatnumber of of the hybrid genes examined be functional. A hybrid steps were taken to ensure the quality of the mutant extensive genes used. (i) All mutant genes were analyzed byduring their restriction enzyme digestion. (ii) It was realized construction that hybrid genes such as the one in p622c were expressed at an easily detectable level in E. coli. Apparently these bacteria are capable of using an element(s) within the hsp70 sequence as a weak promoter. Expression in bacteria
200
MOL . CELL . B IOL .
AMIN ET AL.
was used as a convenient indicator for the presence of an intact p-galactosidase coding sequence in the mutant hybrid genes (Table 1). (iii) The 5' nontranscribed sequences of the most important mutant genes were examined by direct DNA sequencing. (iv) Some of the mutant hybrid genes were constructed in two independent experiments (see below). Far upstream sequences do not affect significantly the expression of hsp7O hybrid genes in D. melanogaster cells. Plasmid 132E3/6 is a pSVod deriative carrying a 3.3-kbp
A
(Z
.-
I
cc _
--..
0
0Or
0
0)NV-M
NO)
cc 00
_
CD CL0:L
B
00
Cd4 cc C\d cZ0 0ccC)CO CO r
BgIII segment from clone 132E3 (17) which includes, in addition to an intact hsp70 RNA coding region, 1,140 bp of hsp70 5' nontranscribed sequence (Fig. 1). The hybrid gene in p622c has hsp70 upstream sequences extending to the XhoI site at position -194 (1 is the position of the putative capping site). The p622c gene was inserted between the unique XhoI and BamHI sites of p132E3/6. This mariipulation produced hybrid gene 6221, which is flanked by 1,140 bp of hsp70 gene upstream sequence identical to that of the
r
cI
CD
CD
N
CttVV
Cd
CC cC CC Cc ccC cIr000000=0=0= Cc CdJ cc OQ
1849
1849 bp
bp 517
440 517 440
298 220 185 154
298 220 185 154
C
X%
-..
0 Cd
X
_.
X x EL=0..
CCc
j CL
>
L Z Z Z
0
.
co
c C
C\ Cd C\ C
N CM CM CMdCM cm co w CDCO co (D Cd
X
C Cd
cc
X X m-. -
O
CM)
CM
CM
x
_
_
_
Cd
Cd (D
CM CM CM CD CdCO CO ccl
1849 bp 517 440
298 220 185 154
FIG. 3. Restriction analysis of hybrid hsp7O-p-galactosidase gene plasmids. Digests of the original mutants (A and C) and of the recloned mutants (B) were electrophoresed on 5% polyacrylamide gels. Photographs of the ethidium bromide-stained gels are shown. Plasmid DNAs were cleaved with PstI and XhoI (A) and with NruI (B). A Hinfl digest of pSVod provided size markers. Abbreviations and symbols are as for Fig. 1.
Hsp7O GENE EXPRESSION
VOL. 5, 1985
original hsp70 gene. The level of expression of the p6221 hybrid gene was found to be similar to that of the p622c gene (Table 1). Thus, sequences upstream from position -194 do not appear to contribute in an important fashion to hsp70 gene activity. Sequences required for the heat-induced expression of hsp7O hybrid genes in D. melanogaster and COS-1 cells. Mutant 622a was prepared by a procedure involving the use of restriction endonuclease BssHII for the isolation of a hybrid gene segment with only 68 bp of 5' nontranscribed sequence (Fig. 1). Other mutant genes with upstream DNA segments of different lengths were prepared by the Bal 31 exonuclease procedure outlined in Fig. 2 (see above), with p622c as starting material. The lengths of the upstream sequences in the mutant genes were estimated by restriction digestion and electrophoresis on polyacrylamide gels (Fig. 3). The endpoint of the upstream sequence in mutant PR4/9° was determined by direct sequence analysis. The BdI 31 procedure was expected not only to shorten the hsp70 gene upstream sequence but also to remove parts of the vector sequences. To avoid potential problems with analyzing the expression of mutant genes in vectors of different size and sequence content, we cloned all mutant hybrid genes, including 622a and 622c, into vector pSVod (Fig. 2). The resulting plasmids were then introduced into D. melanogaster S3 or COS-1 cells, and their heat-induced expression was examined (Table 1). All mutant genes with the exception of the p622a gene were found to be expressed
TABLE 1. Heat-induced expression of mutant hybrid genes in different cell types Relative 0-galactosidase activity" CS-cel Length of D. melanogaster Mutant
upstream
sequence
(bp)
6221 622c
622c*b CR1
CR11 CR3 CR9 CR7 PR4/4 PR4/7 PR4/9 622a*b 622a 622a3 622a4 622x
622/14 622n
1,140 195 194 190 180 175 160 140 135 110 90 68 68 68 68 68 63 50
cells Heat Control shock
0.90 1.00 1.20 0.59 1.37 0.69 1.15 1.38 0.97 0.78 1.19 0.06 0.10 0.00 0.02 0.04 0.11 0.00
0.13 0.08 0.09 0.25 0.13 0.08 0.17 0.18 0.11 0.02 0.16 0.03 0.05 0.01 0.07 0.02 0.06 0.04
COS-1 cells Heat shock
Control
0.73 1.00 1.39
0.02 0.04 0.30
1.16 1.03 0.81 1.05 0.91 0.63 1.00 0.03
0.26 0.17 0.22 0.04 0.02 0.04 0.00 0.04
E. coli CO
MC1061 + + + + + + + + + + + + + + + + + +
a Transfections and ,3-galactosidase assays were carried out as described in the text. The background activity measured in extracts of mock-transfected cells (about 5% of the signal obtained with hybrid genes) was subtracted from the 3-galactosidase activities of the extracts from hybrid gene-containing cells. Activities in extracts from heat-treated D. melanogaster and COS-1 cells containing p622c were 1 to 2 and 3 to 6, respectively (1 h of reaction with material from one culture dish). All activity data shown in the table are expressed relative to the heat-induced activity of the p622c gene. The data represent mean values from three to five independent experiments with each cell type. +, Positive activity (no numerical value given). b The asterisk indicates that a hybrid gene was recloned into pSVod in the same fashion as the Bal 31 mutant genes.
201
at similar levels in D. melanogaster cells. The p622a gene was not expressed at all in D. melanogaster cells. In COS-1 cells, the same gene was as active as the p622c gene. Our results indicate that the sequences required for the expression of hsp70 genes in D. melanogaster cells extend to somewhere between positions -90 and -68. An upstream sequence of 66 bp has been reported to be sufficient for the heat-induced expression of the gene in COS-1 cells (16, 20). Our finding that the p622a gene is active in COS-1 cells is in agreement with these earlier observations. To ensure the validity of our conclusion that more than 68 bp of upstream sequence are required for the expression of hsp70 genes in D. melanogaster cells, we isolated mutant genes identical to the p622a gene (p662a3 and p662a4 in Table 1 and Fig. 3) in a separate cloning experiment. The promoter segments of mutants 622a, 622a3, and 622a4 were analyzed by DNA sequencing and were found to be identical and of the predicted lengths. Mutants 622a3 and 622a4 were active in COS-1 cells but completely inactive in D. melanogaster cells (Table 1). An XhoI or XhoI-SalI linker sequence is located immediately upstream from the D. melanogaster sequences in all mutant genes. To demonstrate that the differences in the activity of the p622a gene in D. melanogaster and COS-1 cells are not in any way related to the presence of these linker elements adjacent to important promoter sequences, we constructed mutant 622x (see above). This mutant gene was identical to the p622a gene except that the XhoI sequence had been deleted. Like 622a, the p622x gene was inactive in D. melanogaster but active in COS-1 cells (Table 1). The DNA element constituting the BssHII restriction site at -68 to -63 has the potential for forming Z DNA. To determine whether this sequence element was of importance for the heat-induced expression of hsp70 genes, we prepared mutant 622/14 by a procedure involving the removal of the nucleotides in the BssHII site by nuclease S1 trimming (deletion endpoint was at -63 as determined by sequencing). Since the BssHII element lies well within the sequence required for gene activity in D. melanogaster cells, the question could only be addressed by using COS-1 cells. Our findings (Table 1) suggest that the BssHII sequence is not an essential element of the hsp70 gene promoter sequence recognized in COS-1 cells.
DISCUSSION We have found that the shortest hsp70 hybrid gene mutant which is still expressed in a heat-induced fashion in D. melanogaster cells contains a 5' nontranscribed sequence element of 90 bp in length. Mutants with 68 bp or less of upstream sequence are not expressed at all in D. melanogaster cells. The gene with the 90-bp promoter segment is as active as a gene with 1,140 bp of upstream sequence in heat-treated cells. This finding indicates that all elements important for the expression of the hsp70 gene are contained within 90 bp of 5' nontranscribed sequence. The same mutants have also been analyzed in COS-1 cells. Mutant genes flanked by only 63 bp of promoter sequence are expressed in heat-shocked cells. These results indicate that the promoter elements involved in hsp70 gene expression in COS-1 cells are located downstream from position -63 and agree well with the earlier findings of Pelham (20) and Mirault et al. (16) but are at variance with the above-mentioned observations in D. melanogaster cells. Thus, there is an upstream sequence element which is required for hsp70 gene expression in D. melanogaster but not in COS-1 or X.
AMIN ET AL.
202
MOL. CELL. BIOL. -90
-80
-70
-60
-50
-40
-30
CTGCTCTCGTTGGTTCCAGAGAGCGCGCCTCGAATGTTCGCGAAAA kGAGCGCCGGAGTATAAATA
1 4-9
629.
822/14
62
n
Cos
Drosophila
4
-
-
-
FIG. 4. Relevant region of the hsp70 gene 5' nontranscribed sequence. The TATA motif and the heat shock consensus sequence are indicated by heavy lines; the sequence in the consensus sequence region which is repeated between positions -85 and -69 is indicated by a thin line. Summarized below the sequence is the expression pattern in COS-1 and D. melanogaster cells of some of the mutant genes.
laevis cells and which is located between positions -90 and -68 (Fig. 4). It is assumed that the mechanism of heat shock gene regulation is similar in D. melanogaster and COS-1 cells, this upstream element plays a role in D. melanogaster cells, probably in addition to the element located further downstream (downstream from position -63) which contains the previously described heat shock consensus sequence (20). Inspection of the short sequence between positions -90 and -68 reveals the presence of a 17-bp sequence (between -85 and -69) containing an imperfect direct repeat of a sequence (between -62 and -46) which overlaps the heat shock consensus sequence (between -62 and -48). Perhaps hsp70 gene expression in D. melanogaster cells involves both repeat sequences, whereas only one element is required for expression in COS-1 and X. laevis cells. Whether all or only part of the upstream repeat is required for the efficient expression of hsp70 genes in D. melanogaster cells will have to be investigated by a more detailed study. We believe that the discrepancy between the results obtained with homologous and heterologous expression systems may be due to the fact that, to obtain a measurable expression signal with heterologous systems, it has been necessary to introduce large numbers of genes into the cells. X. laevis ooctyes containing between 108 and 109 gene copies have been used in the previously described experiments (24). COS-1 cells amplify introduced genes to somewhere between 104 and 105 copies per cell (15). The D. melanogaster hsp70 promoter, which is one of the strongest promoters in D. melanogaster cells, seems to function only poorly in heterologous cells. It appears that heterologous cells can only be forced to express D. melanogaster hsp70 genes by increasing dramatically the number of genes per nucleus. In this situation, it is conceivable that some of the transcription signals may simply be ignored and may therefore not appear to be relevant to gene expression. In contrast, the D. melanogaster transient expression system used in this study most likely does not permit replication of the introduced genes.
It
seems
therefore reasonable to
assume
that the D.
melanogaster cells contain only low numbers of genes. Their expression can be measured easily because their D. melanogaster promoters are functioning efficiently in the homologous
situation.
Recently Parker and Topol (19) have shown that an RNA polymerase II transcription factor is required for the in vitro transcription of a D. melanogaster hsp70 gene. Footprint analysis revealed that RNA polymerase II transcription factor protects the hsp70 promoter sequence between positions -90 and -40. The heat shock consensus sequence (between -62 and -48) is included but accounts for only one-quarter to one-third of the entire protected sequence. Our findings that a sequence element(s) located between positions -90 and -68 and, thus, well upstream from the
is involved in hsp70 gene expression and that far upstream sequences (beyond -90) do not affect the activity of the gene in D. melanogaster cells agree well with the data on the location and dimension of the RNA polymerase II transcription factor binding site (19) and, therefore, provide evidence for the in vivo importance of most of the RNA polymerase II transcription factor binding consensus sequence
sequence.
ACKNOWLEDGMENTS We thank E. Berger and W. Scott for providing us with D. melanogaster S3 and COS-1 cells, M. Casadaban for plasmids MC1403 and MC1871, and D. Rungger for carefully reading this manuscript. This work was supported by Public Health Service grant GM31125 from the National Institutes of Health to R.V. LITERATURE CITED 1. Casadaban, M. J., J. Chou, and S. N. Cohen. 1980. In vitro gene fusions that join an enzymatically active ,B-galactosidase segment to amino-terminal fragments of exogenous proteins: Escherichia coli plasmid vectors for the detection and cloning of translational initiation signals. J. Bacteriol. 143:971-980. 2. Casadaban, M. J., A. Martinez-Arias, S. K. Shapira, and J. Chou. 1983. P-Galactosidase gene fusions for analyzing gene expression in E. coli and yeast. Methods Enzymol. 100:293-308. 3. Corces, V., A. Pellicer, R. Axel, and M. Meselson. 1981. Integration, transcription, and control of a Drosophila heat shock gene in mouse cells. Proc. Natl. Acad. Sci. U.S.A. 78:7038-7042. 4. Craig, E. A., B. J. McCarthy, and S. C. Wadsworth. 1979. Sequence organization of two recombinant plasmids containing genes for the major heat shock-induced protein of D. melanogaster. Cell 16:575-588. 5. DiNocera, P. P., and I. B. Dawid. 1983. Transient expression of genes introduced into cultured cells of Drosophila. Proc. Natl. Acad. Sci. U.S.A. 80:7095-7098. 6. Hackett, R. W., and J. T. Lis. 1981. DNA sequence analysis reveals extensive homologies of regions preceding hsp70 and cx, heat shock genes in Drosophila melanogaster. Proc. Natl. Acad. Sci. U.S.A. 78:6196-6200. 7. Ingolia, T. D., E. A. Craig, and B. J. McCarthy. 1980. Sequence of three copies of the gene for the major Drosophila heat shock induced protein and their flanking regions. Cell 21:669-679. 8. Karch, F., I. Torok, and A. Tissieres. 1981. Extensive regions of homology in front of the two hsp70 heat shock variant genes in Drosophila melanogaster. J. Mol. Biol. 148:219-230. 9. Klein, R. D., E. Selsing, and R. D. Wells. 1980. A rapid microscale technique for isolation of recombinant plasmid DNA suitable for restriction enzyme analysis. Plasmid 3:88-91. 10. Lis, J. T., J. A. Simon, and C. A. Sutton. 1983. New heat shock puffs and 3-galactosidase activity resulting from transformation of Drosophila with an hsp70-lacZ hybrid gene. Cell 35:403-410. 11. Livak, K. J., R. Freund, M. Schweber, P. Wensink, and M. Meselson. 1978. Sequence organization and transcription at two heat shock loci in Drosophila. Proc. Natl. Acad. Sci. U.S.A. 75:5613-5617.
VOL. 5, 1985 12. Luthman, H., and G. Magnusson. 1983. High efficiency polyoma DNA transfection of chloroquine treated cells. Nucleic Acids Res. 11:1235-1308. 13. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 14. Maxam, A. M., and W. Gilbert. 1977. A new method for sequencing DNA. Proc. Natl. Acad. Sci. U.S.A. 74:560-564. 15. Mellon, P., V. Parker, Y. Gluzman, and T. Maniatis. 1981. Identification of DNA sequences required for transcription of the human al-globin gene in a new SV40 host-vector system. Cell 27:279-288. 16. Mirault, M. E., R. Southgate, and E. Delwart. 1982. Regulation of heat shock genes: a DNA sequence upstream of Drosophila hsp70 genes is essential for their induction in monkey cells. EMBO J. 1:1279-1285. 17. Moran, L., M. E. Mirault, A. Tissieres, J. Lis, P. Schedl, S. Artavanis-Tsakonas, and W. Gehring. 1979. Physical map of two D. melanogaster DNA segments containing sequences coding for the 70,000 dalton heat shock protein. Cell 17:1-8. 18. Morganelli, C. M., and E. M. Berger. 1984. Transient expres-
Hsp7O GENE EXPRESSION
19. 20. 21. 22.
23.
24.
203
sion of homologous genes in Drosophila cells. Science 224:1004-1006. Parker, C. S., and J. Topol. 1984. A Drosophila RNA polymerase II transcription factor specific for the heat shock gene binds to the regulatory site of an hsp70 gene. Cell 37:273-283. Pelham, H. R. B. 1982. A regulatory upstream promoter element in the Drosophila hsp70 heat-shock gene. Cell 30:517-528. Rubin, G. M., and A. C. Spradling. 1982. Genetic transformation of Drosophila with transposable element vectors. Science 218:348-353. Schedl, P., S. Artavanis-Tsakonas, R. Steward, W. Gehring, M. E. Mirault, M. Goldschmidt-Clermont, L. Moran, and A. Tissieres. 1978. Two hybrid plasmids with D. melanogaster DNA sequences complementary to mRNA coding for the major heat shock protein. Cell 14:921-929. Torok, I., and F. Karch. 1980. Nucleotide sequences of heat shock activated genes in Drosophila melanogaster. Nucleic Acids Res. 8:3105-3123. Voellmy, R., and D. Rungger. 1982. Transcription of a Drosophila heat shock gene is heat-induced in Xenopus oocytes. Proc. Natl. Acad. Sci. U.S.A. 79:1776-1780.
