The human promyelocytic leukemia zinc finger gene is ... - Nature

Leukemia (2002) 16, 1755–1762  2002 Nature Publishing Group All rights reserved 0887-6924/02 $25.00 www.nature.com/leu

The human promyelocytic leukemia zinc finger gene is regulated by the Evi-1 oncoprotein and a novel guanine-rich site binding protein S Takahashi and JD Licht Department of Medicine and Derald H Ruttenberg Cancer Center, The Mount Sinai School of Medicine, New York, NY, USA

PLZF (promyelocytic leukemia zinc finger ) is a transcription factor disrupted in t(11;17)-associated acute promyelocytic leukemia which is highly expressed in undifferentiated myeloid cells. To address the tissue-specific regulation of the promoter, we isolated sequences 1.2-kb 5⬘ to the transcriptional start site. Sequence analysis demonstrated that this region contains one TATA box and several putative transcription factor binding sites including four G/C-rich sites and one Evi-1-like site. A fragment of the promoter spanning 158-bp upstream of the transcription start site displayed relative specificity for PLZFexpressing myeloid cells. Functional promoter assays revealed that an Evi-1-like site at −140/−130 was essential for full promoter activity in every cell line tested while a G-rich site at −15/−7 was important for tissue specificity. Electrophoretic mobility shift assays showed that Evi-1 binds specifically to −140/−130 Evi-1-like site and overexpression of Evi-1 in K562 cells activated the PLZF promoter. UV cross-linking assays showed that the proximal, tissue specific element at −15/−7 bound a novel 28 kDa protein. These results indicate as with other myeloid genes, a relatively small segment of DNA can direct tissue-specific expression, but unlike other myeloid promoters, no critical PU.1 or C/EBP sites were found. Leukemia (2002) 16, 1755–1762. doi:10.1038/sj.leu.2402682 Keywords: PLZF; Evi-1; guanine-rich site; tissue-specific regulation

The PLZF gene was completely sequenced and the coding regions were found to be contained in six exons spread over 201-kb of DNA. Sequence analysis of a proximal 5⬘ upstream region of PLZF suggested that the gene could be regulated by a multiple transcription factors.2 We characterized the PLZF promoter and found that a small region conferred relative tissue specificity. Further analysis demonstrated that a guanine-rich (G-rich) site near transcription start site was important for the tissue specificity while the Evi-1 transcription factor, also implicated in leukemogenesis, was essential for promoter activity. Materials and methods

Cell culture KG1, HEL, K562, Jurkat, MDS, U937 cells were grown in RPMI (GIBCO BRL, Rockville, MD, USA) and 293T cells were grown in Dulbecco’s modified Eagle’s medium (GIBCO BRL) containing 10% fetal bovine serum and split every 3 days as described previously.10,11

Introduction

Northern blot analysis

The promyelocytic leukemia zinc finger (PLZF) protein is a transcription factor1,2 of 673 amino acids with nine Kruppellike C2H2 zinc finger domains and an N-terminal BTB (broad complex, tramtack, bric a brac) domain. PLZF was first identified as a partner gene fused to retinoic acid receptor ␣ RAR␣ in a variant chromosomal translocation t(11;17)(q23;q21) in acute promyelocytic leukemia (APL).3 The PLZF-RAR␣ fusion gene can induce leukemia in transgenic mice confirming the pathogenic nature of the fusion protein.4 PLZF is a transcriptional repressor that interacts with a number of co-repressors and histone deacetylases and suppresses cell growth; this latter action is linked to an arrest of the cell cycle and inhibition of cyclin A expression.5–7 PLZF can associate with the PML protein, yielding a possible link to the pathogenesis of more common t(15;17)-associated APL.8 PLZF mRNA is expressed in undifferentiated myeloid cell lines, at lower levels in more differentiated erythroleukemia, promyelocytic and monocytic cell lines and can be detected in peripheral blood mononuclear cells.3 PLZF is also highly expressed in CD34+ hematopoietic progenitor cells and decreases as differentiation proceeds.9 All of these suggest an important role of PLZF in leukemogenesis and myeloid cell development. The PLZF gene is located on chromosome 11q23 about 1 MB centromeric to the MLL (mixed lineage leukemia) gene.

Fifteen ␮g of total RNA were subjected to electrophoresis on a 1% formaldehyde-agarose gel and transferred to a sheet of nitrocellulose filter. The probe was amplified by polymerase chain reaction using the following primers: 5⬘CACTTACTGGCTCATTCAGCGG-3⬘ and 5⬘-CTTACA CTCAAAGGGCTTCTCACC-3⬘, corresponding to the sequence from human PLZF cDNA 1348–1369 and 1815– 1792.3 The amplified PLZF fragment was isolated, 32P-labeled by random priming and used for Northern blot analysis of PLZF expression.

Correspondence: JD Licht, Box 1130, Mount Sinai School of Medicine, One Gustave Levy Place, New York, NY10029, USA; Fax: 212 849–2523 Received 26 April 2002; accepted 31 May 2002

Plasmids A series of deletion mutants of the human PLZF promoter fused to a luciferase reporter gene were constructed. The PLZF promoter2 was first amplified by using the following primers: 5⬘-AAAGTGGCATCTTCTCCCCAAA-3⬘, 5⬘-TGGCTGCAC AGCAGTTTGATAA-3⬘. Then the fragment was amplified by nested PCR by the following forward primers: 5⬘-TTCTGGTAC CAAAAGGTAGGGATCTTTG-3⬘, 5⬘-TTTCGGTACCTCCTT CCTGTATGATCTC-3⬘, 5⬘-GGCAGGTACCCGCGAGAGATT GAGTATT-3⬘, 5⬘-ATTGGGTACCCTCTTGTAATTTTCCATC3⬘, 5⬘-CTCTGGTACCTTTCCATCCTGCTTGTTT-3⬘, 5⬘CTGAGGTACCTCATCAGCCTTCCCAGGA-3⬘, 5⬘-TTCCCG GTACCCAAGGACATAGCTCTGGC-3⬘ and the acceptor primer, 5⬘-GTTTCTCGAGCCCAGATAAAGCAGCAGC-3⬘. These amplified DNA fragments were digested with KpnI and XhoI and inserted into the KpnI/XhoI site of the pGL3-Basic

Regulation of the PLZF promoter S Takahashi and JD Licht

1756

plasmid (Promega, Madison, WI, USA), resulting in −1147, −473, −158, −138, −128, −73 and −52, respectively. Evi-1 del. was created as follows: first, the promoter region was amplified by 5⬘-TTCTGGTACCAAAAGGTAGGGATCTTTG-3⬘ and 5⬘-ACAAGGTACCACTCAATCTCTCTCGCGC-3⬘, digested by KpnI and inserted into −128 plasmid resulting in the internal deletion of −141 to −128 site. G-rich del. was created with the QuickChange site-directed mutagenesis system (Stratagene, La Jolla, CA, USA) using the following primers, respectively. Grich del. sense: 5⬘-CTATAAATGGTGCCAGTTTTGAGC TGCTGCTTTATCTGGG-3⬘, G-rich del. anti-sense; 5⬘-CCCAGATAAAGCAGCAGCTCAAAACTGGCACCATTTATAG-3⬘. All sequences of the constructs were confirmed by sequence analyses.

Transfection and luciferase assays Each reporter (30 ␮g) plasmid and 1.5 ␮g of a TK-renilla plasmid (as an internal control) were co-transfected into KG1 cells by electroporation. A total of 1 × 107 cells were collected, washed twice, suspended in 400 ␮l serum-free RPMI and transferred into BTX cuvettes (BTX, San Diego, CA, USA) with DNA. The cells were electroporated at settings of 350 V, 950 ␮F, 72 ohms. For Jurkat and HEL cells, 4 ␮g of each reporter plasmid and 0.2 ␮g of TK-renilla plasmid were co-transfected using the DMRIE-C liposome reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. For K562 cells, 1 ␮g of each reporter plasmid and 0.05 ␮g of pRL were co-transfected by Fugene 6 as described previously.12 The Evi1 SR-␣ plasmid (gift of Dr G Nucifora, University of Illinois at Chicago, IL, USA) was cloned into the pcDNA3.1(−)/Myc-His expression vector (Invitrogen) and Evi-1 expression was confirmed by Western blot using anti-Evi-1-antibody (c-20) (cat No. sc-8707) (Santa Cruz Biotechnology, Santa Cruz, CA, USA). A co-transfection assay was performed with 2 ␮g of the Evi-1 effector plasmid and 100 ng of reporter plasmid. The total amount of transfected plasmid kept constant by addition of the empty pcDNA3.1(−)/Myc-His plasmid. Luciferase and renilla activity were assayed using the Dual-luciferase reporter assay system (Promega).

Leukemia

Molecular weight assessment of trans-acting proteins UV cross-linking was performed as described14 with minor modifications. Briefly, the following oligomers were used for probe. G-rich wild-type tetramer: 5⬘-GTTTTGGTGGGGGAG CTGCTGCGTTTTGGTGGGGGAGCTGCTGCGTTTTGGTGG GGGAGCTGCTGCTTTATCT-3⬘, G-rich mutant tetramer: 5⬘GTTTTCCATTTTGAGCTGCTGCTGTTTTCCATTTTGAGCTGCT GCTGTTTTCCATTTTGAGCTGCTGCTGCTTTATCT-3⬘. Both of these were hybridized to a complementary oligomer; 5⬘AGATAAAGCAGCAGCT-3⬘ and used as a substrate for the Klenow fragment with incorporation of bromodeoxyuridine. The probes were mixed with nuclear protein extracts, placed on a UV transilluminator and irradiated for 30 min with UV light (300 nM). After crosslinking, the samples were treated with DNase I and micrococcal nuclease, boiled in SDS loading buffer and loaded on to a 12% SDS-polyacrylamide gel electrophoresis gel. After electrophoresis, the gel was fixed, stained for protein molecular weight markers, dried and autoradiographed. Results

Isolation of human PLZF gene promoter In order to clarify the regulatory mechanisms of PLZF gene expression, we amplified the 5⬘-upstream region of the PLZF gene up to 1.2-kb from the transcription start site using data from GenBank sequence AF060568.2 From our sequence analysis, a nucleotide G at nt −102 (while the sequence in GenBank is T) is different from AF060568, shown with an asterisk. Sequence analysis using the MatInspector (http://transfac.gbf.de/cgi-bin/matSearch/matsearch.pl/) and TFSearch (http://www.cbrc.jp/research/db/TFSEARCH.html) programs revealed that PLZF promoter region contained one TATA box, eight GATA-like sites (A/T GATA A/G15), four G/C rich sites, nine Ets sites (C/AGGAA/T16) and one Evi-1 (ecotropic virus integration site-1)-like site. The Evi-1-like site was an eight out of 10 match to the Evi-1 consensus GACAAGATAA17 (Figure 1). This TATA box-containing type of promoter structure is typical of a non-housekeeping gene which can be induced by various signals or exhibits tissue-specific regulated genes.18,19

Electrophoretic mobility shift assay

Functional studies of the human PLZF promoter

The following oligomers were used as probes and/or competitors in gel mobility shift assays: Evi-1-like: 5⬘-TGAGTATTCTCTTGTAATTTTCC-3⬘. G-rich wild: 5⬘GTTTTGGTGGGGGAGCTGCTGCT-3⬘. G-rich mut: 5⬘GTTTTCCATTTTGAGCTGCTGCT-3⬘. Annealing and end labeling the probe was performed as described previously.13 Eight ␮g of nuclear extract were incubated with or without indicated competitors in a reaction mixture (Evi-1; 25 mM Hepes (pH 7.9), 50 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol, 10% glycerol, 250 ␮g/ml poly dI/dC, G-rich site binding protein; 25 mM Hepes (pH 7.5), 50 mM KCl, 10 ␮M ZnSO4, 1 mM DTT, 10% glycerol, 0.1%NP40, 120 ␮g/ml poly dI/dC). For the supershift assay, anti-Evi-1-antibody (c-20) (cat No. sc8707) (Santa Cruz) or anti-ATF-1-antibody (39–271) (cat No. sc-4006) (Santa Cruz) was added after adding protein and probe and incubating for 1 h at room temperature.

To examine the regulation of the PLZF promoter, we first performed Northern blot analysis to determine the expression of PLZF in various cell lines. As shown in Figure 2, a single major transcript was detected in early myeloid KG1 and erythromegakaryocyte HEL cells, but not in other cell lines (arrow). Next, we performed transient transfection assays in these PLZF expressing and non-expressing cells with a nested series of promoter deletion constructs fused to luciferase. The PLZF promoter constructs showed three to five-fold higher activity in PLZF expressing KG1, HEL cells compared to non-expressing Jurkat (human T cell leukemia), K562 (human erythroleukemia) cells, indicating the moderate tissue specificity of this region (Figure 3). The deletion of nt −138 to −128, where one Evi-1-like site exists, caused a dramatic (70–90%) decrease in promoter activity in every cell line tested (Figure 3), indicating that this region is important for human PLZF promoter regulation. Further deletion downstream from this


1757

Figure 1 The 5⬘-upstream region of the human PLZF gene. The nucleotide sequence of 1.2-kb of 5⬘-upstream region of the PLZF gene is presented. The arrowhead indicates the major transcription initiation site.2 The putative cis-acting GATA like (5/6 match to the GATA consensus A/T GATA A/G), Ets, Evi-1-like (8/10 match to the Evi-1 consensus GACAAGATAA), TATA box and G/C rich sites are boxed. The letter with an asterisk shows a different nucleotide compared to AF060568 sequence.2

site showed only slight decrease of promoter activity (Figure 3). To confirm the importance of the −140/−130 Evi-1-like site, an internal deletion of this site was introduced into the reporter and assayed by transient transfection. As shown in Figure 4, consistent with the 5⬘ deletion series of constructs, PLZF promoter activity was dramatically diminished in every cell line tested.

Evi-1 binds to the PLZF promoter To identify the nuclear proteins that bind to the −140/−130 Evi-1-like site, a gel mobility shift assay was performed. When a labeled oligomer representing the Evi-1-like site within the PLZF promoter was incubated with nuclear extract from KG1 cells, a single major retarded band was observed (Figure 5, lane 2). This band was affected by the unlabeled homologous Evi-1-like site competitor (lanes 3 to 5), but not an unlabeled competitor of sequences nt −19 to +1 region from the PLZF promoter containing G-rich site (lanes 6 to 8). This complex was almost totally abolished by adding Evi-1 antibody (lane 11) but not an antibody directed against ATF-1 (activating transcription factor-1) (lane 12). The same phenomenon was observed when using nuclear extracts from HEL and K562

Figure 2 Expression profile of human PLZF in various cell lines. RNA blot analysis for human PLZF by using total RNA from various cell lines. Ethidium bromide stained rRNA is indicated in the lower panel as a control.

cells (data not shown). These results indicate that Evi-1 binds to the −140/−130 element in human PLZF promoter.

Evi-1 trans-activates the PLZF promoter Since the −140/−130 Evi-1 site was a positive regulatory element in the PLZF promoter (Figures 3 and 4), it was reasonable to assume that Evi-1 could be an activating transcription factor. To confirm the trans-activational effect of Evi-1, an Evi1 expression plasmid and a PLZF reporter plasmid were cotransfected into K562 cells. K562 cells were selected because of their relatively high transfection efficiency among hematopoietic cell lines. As shown in Figure 6, Evi-1 overexpression resulted in a nearly two-fold induction of luciferase activity from the full-length PLZF promoter. Evi-1 did not activate transcription of internal deletion mutant, Evi-1 del., which deleted the Evi-1 binding site. Leukemia


1758

Figure 3 Determination of sequences required for PLZF promoter activity. (a) Diagram of PLZF promoter/luciferase constructs. Human PLZF gene spanning nt −1147 to +13 or a set of serial deletions (open box for nt −1147 to +1 and shaded box for nt +1 to +13) was linked 5⬘ to the luciferase promoter gene (closed box). +1 indicates major transcription start site. (b) A series of 5⬘ deletion mutants of the human PLZF gene promoter were transfected into KG1, HEL, Jurkat and K562 cells and assayed for luciferase activity. The results are expressed as the ratio of luciferase expression compared to expression from a pRL-TK renilla control vector. The promoter activity is indicated by black bars for PLZF expressing cells or gray bars for PLZF non-expressing cells. Data are mean values from at least three separate experiments.

Figure 4 An Evi-1 site is essential for PLZF promoter activity. The Evi-1-like site at −140/−130 was internally deleted from the −1147 reporter and transfected into various hematopoietic cells. The results are expressed as the ratio of luciferase to renilla activity. The activity is indicated by black bars for PLZF expressing cells or gray bars for PLZF non-expressing cells. The data are the mean of at least three separate experiments.

A proximal G-rich site is important for tissue-specific regulation of the PLZF promoter Despite the critical role of Evi-1 for PLZF promoter activity, this protein could not explain the relative tissue specificity of a small fragment of the PLZF promoter. Evi-1 was expressed widely in hematopoietic cell lines including K562 cells which did not express PLZF and in which the PLZF promoter was inactive. There was no correlation between Evi-1 expression levels and PLZF expression (data not shown). Therefore, we sought other tissue-specific elements in the PLZF promoter. There are several putative transcription factor binding sites downstream from the −140/−130 Evi-1-like site. Interestingly, there is one G-rich site (TGGTGGGGG) near the transcription start site, similar to a site previously reported to play an Leukemia

important role in myeloid gene promoters.20 In order to investigate the importance of this site, it was deleted from the PLZF promoter. As shown in Figure 7, the 7 bp internal deletion at this site (G-del.) results in up to a 50% decrease of reporter activity in PLZF expressing HEL and KG1 cells, but had no effect in cells that did not express PLZF (Figure 7). This element is at least, in part, responsible for the tissue specificity of the proximal PLZF promoter.

A specific DNA–protein complex forms at the G-rich proximal site of the PLZF promoter To identify nuclear proteins that bind to the G-rich site, a gel mobility shift assay was performed. When labeled oligomers


Figure 5 Evi-1 binds to the PLZF promoter. Nuclear extract (8 ␮g) from KG1 (lanes 2 to 8, 10 to 12) were incubated with the end-labeled oligomers corresponding to the Evi-1-like site (−140/−130). Asterisks show the nucleotides homologous to complete the Evi-1 site.17 Competition assays were performed with a 100- to 300-fold molar excess of unlabeled homologous oligonucleotides containing the Evi-1-like site (lanes 3 to 5) or the −15/−7 G-rich site of the PLZF promoter (lanes 6 to 8). For supershift assays, 3 ␮l of anti-Evi-1 (lane 11) or anti-ATF1 (lane 12) were added. The arrow indicates the complex of the probe and protein.

Figure 6 Evi-1 trans-activates the PLZF promoter. K562 cells were transiently co-transfected with the wild-type PLZF promoter construct (−1147) or a construct harboring an internal deletion of the Evi-1 site (Evi-1 del.) with or without Evi-1 expression vector. Results are the mean of three separate experiments.

were incubated with a nuclear extract from KG1 cells, several retarded bands were observed (Figure 8, arrow and arrowhead). The slower migrating band (arrowhead) was nonspecific because it was competed by the addition of the Grich site wild-type or mutant type competitor. The faster migrating band (arrow) was completely competed by as little as a 25-fold excess of the wild-type (lanes 3 to 5) but not by

as much as a 400-fold excess of mutant competitor (lanes 6 to 8). To begin to determine the nature of the protein(s) bound to this site, UV-cross-linking studies were performed. Incubation of nuclear extracts with the wild-type G-rich site led to the identification of a 28 kDa protein species. A mutant binding site incapable of competing for the G-site binding protein in gel shift assays failed to cross-link to this protein (Figure 9). The sequence TGGTGGGGG is similar to the MZF-1 binding site, but the MZF-1 is a 48 kDa protein.21 Furthermore, the PLZF promoter did not bind to MZF-1 in vitro nor did MZF-1 trans-activate the promoter in transfection assays (data not shown). Sp1 binding sequence is also similar to this site, but Sp1 protein has a molecular mass between 95 and 105 kDa depending on the glycosylation22 which is far larger than the 28 kDa protein that bound to the G-rich element determined by UV-cross-linking. These data suggest that a novel protein binds to this G-rich site and plays an important role in the myeloid-specific regulation of PLZF promoter.

1759

Discussion In this study, we analyzed the regulation of the human PLZF gene and found that Evi-1 is essential for the activity of the PLZF promoter. Evi-1 is a zinc finger transcription factor encoded by a gene initially identified by its activation by a retrovirus in myeloid leukemia in mice.23 In human leukemia, Evi1 is often inappropriately activated by chromosomal rearrangements at 3q26, the region of the Evi-1 locus.24 Evi1 is also overexpressed in patients with myeloid leukemia or myelodysplastic syndrome without chromosomal abnormalities,25 indicating an important role for Evi-1 in the pathogenesis in myeloid malignancies. Evi-1 is expressed in a significant proportion of acute promyelocytic leukemia (APL) cases26 suggesting a role of Evi-1 in the pathogenesis in APL associated with PLZF. In situ hybridyzation assays for Evi-1 in the developing mouse embryo showed significant expression in the developing limbs.27 PLZF is also expressed in the developing murine limb and analysis of PLZF knockout mice revealed that PLZF is essential for patterning of the limb and axial skeleton.28 This spatial and temporal overlap of the expression of PLZF and Evi-1 during mouse development also supports a functional relationship between the two genes. Evi1 is abundantly expressed in a large number of tissues and organs, especially in pancreas, heart, kidney, lung, skeletal muscles and ovaries.29 This expression pattern partly overlaps that of the non-hematopoietic expression of PLZF, which is highly expressed in the heart, among other organs.30 We found that the Evi-1 site was a positive element for PLZF expression and that Evi-1 activated the PLZF promoter in transfection experiments. Evi-1 was frequently reported to be a repressor, recruiting C-terminal binding protein (CtBP) as a co-repressor.31,32 In other contexts, however, Evi-1 acts as a sequence-specific trans-activator.33 An alternative isoform of Evi-1, MDS-1/Evi-1, generated by an alternative upstream promoter yields a longer protein, which is naturally expressed in bone marrow.34 This extended protein antagonized the ability of the shorter form of Evi-1 to activate transcription,34,35 suggesting that the balance of Evi-1 action on target genes in hematopoietic tissues may be related to the ratio of these isoforms. A shift of these isoforms could represent one mechanism of regulation of PLZF expression. It must be noted that although Evi-1 seemed critical for the activity of the PLZF promoter, Evi-1 expression was not Leukemia


1760

Figure 7 A guanine-rich site is essential for myeloid specificity of the PLZF promoter. The G-rich site at −15/−7 was internally deleted from the −158 PLZF reporter and transfected into the indicated cell line. The results are expressed as the ratio of luciferase to renilla activity in transfected cells. Indicated by black bars is luciferase activity in PLZF expressing cells and PLZF non-expressing cells by gray bars. Data are the mean of at least three separate experiments.

Figure 8 A rapidly migrating specific protein complex forms on the myeloid specific G-rich site. Aliquots of nuclear extracts (8 ␮g) from KG1 and HEL cells were incubated with the end-labeled oligomers corresponding to the −15/−7 G-rich site (lane 2). Competition assays were performed with a 25- to 250-fold molar excess of unlabeled oligonucleotides containing the wild-type (lanes 3 to 5) or mutant type of G-rich site (lanes 6 to 8). The specific DNA–protein complex band is shown by the arrow. The arrowhead shows the non-specific complex.

exactly correlated with PLZF expression, suggesting that other tissue-specific factors were required for the proper pattern of PLZF expression. Therefore, we sought other tissue-specific elements in the PLZF promoter. The expression of myeloid granule proteins (myeloperoxidase, neutrophil elastase, proteinase 3 and cathepsin G) is dramatically upregulated before promyelocytic stage and then downregulated with further myeloid development.36 This myeloid developmental stagespecific expression is similar to diminution of PLZF expression Leukemia

Figure 9 A 28 kDa protein specifically binds to the myeloid-specific G-rich element of the PLZF promoter. A BrdU substituted, radiolabeled probe consisting of a trimer of the G-rich myeloid element or a mutant element were UV-cross-linked with nuclear extract from KG1 cells. A 28 kDa protein binds the wild-type (lane 1) but not the mutant probe (lane 2). Molecular mass markers are separated on the left lane.

during myeloid development. The promoters of these genes (myeloperoxidase,37 neutrophil elastase,38,39 proteinase 320 and cathepsin G40), all have TATAA boxes and contain a common sequence, CCCCnCCC, which is functionally important in the tissue-specific regulation.20,41 Strikingly, the PLZF promoter has the sequence TGGTGGGG, close to the TATA box, complementary with only 1-bp mismatch to CCCCnCCC. Sturrock et al20 reported the importance of this cytidine-rich element in tissue-specific regulation and demonstrated the binding of a 40 kDa protein to this element. Similarly, we found that this G-rich site was crucial for tissue-specific expression of PLZF and bound a 28 kDa protein, which may be the same as that reported by Sturrock et al. However, this protein was detected by EMSA in both KG1 cells and PLZF


non-expressing cells (data not shown). Therefore, the tissue specificity of this promoter in myeloid cells conferred by the G-rich site and the 28 kDa protein might be explained by modification or protein–protein interaction with myeloid-specific transcription factors or co-factors. Sturrock et al found that the 40 kDa protein is also widely expressed, suggesting we may have identified the same or a closely related protein. PU.1, a member of the Ets transcription factor family, is an important myeloid transcription factor and a number of myeloid promoters have a functional PU.1 site close to the transcription start site required for tissue specificity.42–44 Curiously, although we found multiple putative Ets binding sites within the PLZF promoter, we could not demonstrate the functional importance of these sites by transient transfection assay. It is still possible that PU.1 might play a role in the activity of the PLZF promoter through protein–protein interactions. In conclusion, we revealed the involvement of the Evi-1 oncoprotein in the regulation of human PLZF promoter. Furthermore, we showed the tissue-specific regulation of the PLZF promoter, like other myeloid promoters, may depend on a relative short cis-acting sequence but a potentially complex set of trans-acting factors. Identification of the G-rich site binding protein should offer functional insight into myeloid gene regulation.

9

10 11 12

13

14 15

16

Acknowledgements

17

Supported by NIH Grant CA59936 and American Cancer Society Grant DHP 160.

18 19

References 1 Licht JD, Chomienne C, Goy A, Chen A, Scott AA, Head DR, Michaux JL, Wu Y, DeBlasio A, Miller WH Jr. Clinical and molecular characterization of a rare syndrome of acute promyelocytic leukemia associated with translocation (11;17). Blood 1995; 85: 1083–1094. 2 Zhang T, Xiong H, Kan LX, Zhang CK, Jiao XF, Fu G, Zhang QH, Lu L, Tong JH, Gu BW, Yu M, Liu JX, Licht J, Waxman S, Zelent A, Chen E, Chen SJ. Genomic sequence, structural organization, molecular evolution, and aberrant rearrangement of promyelocytic leukemia zinc finger gene. Proc Natl Acad Sci USA 1999; 96: 11422–11427. 3 Chen Z, Brand NJ, Chen A, Chen SJ, Tong JH, Wang ZY, Waxman S, Zelent A. Fusion between a novel Kruppel-like zinc finger gene and the retinoic acid receptor-alpha locus due to a variant t(11;17) translocation associated with acute promyelocytic leukaemia. EMBO J 1993; 12: 1161–1167. 4 He L, Bhaumik M, Tribioli C, Rego EM, Ivins S, Zelent A, Pandolfi PP. Two critical hits for promyelocytic leukemia. Mol Cell 2000; 6: 1131–1141. 5 Melnick A, Carlile GW, McConnell MJ, Polinger A, Hiebert SW, Licht JD. AML-1/ETO fusion protein is a dominant negative inhibitor of transcriptional repression by the promyelocytic leukemia zinc finger protein. Blood 2000; 96: 3939–3947. 6 Yeyati PL, Shaknovich R, Boterashvili S, Li J, Ball HJ, Waxman S, Nason-Burchenal K, Dmitrovsky E, Zelent A, Licht JD. Leukemia translocation protein PLZF inhibits cell growth and expression of cyclin A. Oncogene 1999; 18: 925–934. 7 Shaknovich R, Yeyati PL, Ivins S, Melnick A, Lempert C, Waxman S, Zelent A, Licht JD. The promyelocytic leukemia zinc finger protein affects myeloid cell growth, differentiation, and apoptosis. Mol Cell Biol 1998; 18: 5533–5545. 8 Koken MH, Reid A, Quignon F, Chelbi-Alix MK, Davies JM, Kabarowski JH, Zhu J, Dong S, Chen S, Chen Z, Tan CC, Licht J, Waxman S, de The H, Zelent A. Leukemia-associated retinoic acid receptor alpha fusion partners, PML and PLZF, heterodimerize and

20 21 22 23

24

25

26 27

28 29

colocalize to nuclear bodies. Proc Natl Acad Sci USA 1997; 94: 10255–10260. Reid A, Gould A, Brand N, Cook M, Strutt P, Li J, Licht J, Waxman S, Krumlauf R, Zelent A. Leukemia translocation gene, PLZF, is expressed with a speckled nuclear pattern in early hematopoietic progenitors. Blood 1995; 86: 4544–4552. Pear WS, Nolan GP, Scott ML, Baltimore D. Production of hightiter helper-free retroviruses by transient transfection. Proc Natl Acad Sci USA 1993; 90: 8392–8396. Calabretta B. Dissociation of c-fos induction from macrophage differentiation in human myeloid leukemic cell lines. Mol Cell Biol 1987; 7: 769–774. Takahashi S, Furuyama K, Kobayashi A, Taketani S, Harigae H, Yamamoto M, Igarashi K, Sasaki T, Hayashi N. Cloning of a coproporphyrinogen oxidase promoter regulatory element binding protein. Biochem Biophys Res Commun 2000; 273: 596–602. Takahashi S, Taketani S, Akasaka JE, Kobayashi A, Hayashi N, Yamamoto M, Nagai T. Differential regulation of coproporphyrinogen oxidase gene between erythroid and nonerythroid cells. Blood 1998; 92: 3436–3444. Lin SY, Riggs AD. Photochemical attachment of lac repressor to bromodeoxyuridine- substituted lac operator by ultraviolet radiation. Proc Natl Acad Sci USA 1974; 71: 947–951. Evans T, Reitman M, Felsenfeld G. An erythrocyte-specific DNAbinding factor recognizes a regulatory sequence common to all chicken globin genes. Proc Natl Acad Sci USA 1988; 85: 5976– 5980. Pio F, Kodandapani R, Ni CZ, Shepard W, Klemsz M, McKercher SR, Maki RA, Ely KR. New insights on DNA recognition by ets proteins from the crystal structure of the PU.1 ETS domain–DNA complex. J Biol Chem 1996; 271: 23329–23337. Perkins AS, Kim JH. Zinc fingers 1–7 of EVI1 fail to bind to the GATA motif by itself but require the core site GACAAGATA for binding. J Biol Chem 1996; 271: 1104–1110. Fong TC, Emerson BM. The erythroid-specific protein cGATA-1 mediates distal enhancer activity through a specialized beta-globin TATA box. Genes Dev 1992; 6: 521–532. Mack DH, Vartikar J, Pipas JM, Laimins LA. Specific repression of TATA-mediated but not initiator-mediated transcription by wildtype p53. Nature 1993; 363: 281–283. Sturrock A, Franklin KF, Hoidal JR. Human proteinase-3 expression is regulated by PU.1 in conjunction with a cytidinerich element. J Biol Chem 1996; 271: 32392–32402. Peterson MJ, Morris JF. Human myeloid zinc finger gene MZF produces multiple transcripts and encodes a SCAN box protein. Gene 2000; 254: 105–118. Kadonaga JT, Carner KR, Masiarz FR, Tjian R. Isolation of cDNA encoding transcription factor Sp1 and functional analysis of the DNA binding domain. Cell 1987; 51: 1079–1090. Mucenski ML, Taylor BA, Ihle JN, Hartley JW, Morse HC, 3rd, Jenkins NA, Copeland NG. Identification of a common ecotropic viral integration site, Evi-1, in the DNA of AKXD murine myeloid tumors. Mol Cell Biol 1988; 8: 301–308. Nucifora G, Begy CR, Kobayashi H, Roulston D, Claxton D, Pedersen-Bjergaard J, Parganas E, Ihle JN, Rowley JD. Consistent intergenic splicing and production of multiple transcripts between AML1 at 21q22 and unrelated genes at 3q26 in (3;21)(q26;q22) translocations. Proc Natl Acad Sci USA 1994; 91: 4004–4008. Russell M, List A, Greenberg P, Woodward S, Glinsmann B, Parganas E, Ihle J, Taetle R. Expression of EVI1 in myelodysplastic syndromes and other hematologic malignancies without 3q26 translocations. Blood 1994; 84: 1243–1248. Xi ZF, Russell M, Woodward S, Thompson F, Wagner L, Taetle R. Expression of the Zn finger gene, EVI-1, in acute promyelocytic leukemia. Leukemia 1997; 11: 212–220. Perkins AS, Mercer JA, Jenkins NA, Copeland NG. Patterns of Evi1 expression in embryonic and adult tissues suggest that Evi-1 plays an important regulatory role in mouse development. Development 1991; 111: 479–487. Barna M, Hawe N, Niswander L, Pandolfi PP. Plzf regulates limb and axial skeletal patterning. Nat Genet 2000; 25: 166–172. Fears S, Mathieu C, Zeleznik-Le N, Huang S, Rowley JD, Nucifora G. Intergenic splicing of MDS1 and EVI1 occurs in normal tissues as well as in myeloid leukemia and produces a new member of the PR domain family. Proc Natl Acad Sci USA 1996; 93: 1642–1647.

1761

Leukemia


1762

Leukemia

30 Cook M, Gould A, Brand N, Davies J, Strutt P, Shaknovich R, Licht JD, Waxman S, Chen Z, Gluecksohn-Waelsch S. Expression of the zinc-finger gene PLZF at rhombomere boundaries in the vertebrate hindbrain. Proc Natl Acad Sci USA 1995; 92: 2249–2253. 31 Bartholomew C, Kilbey A, Clark AM, Walker M. The Evi-1 protooncogene encodes a transcriptional repressor activity associated with transformation. Oncogene 1997; 14: 569–577. 32 Izutsu K, Kurokawa M, Imai Y, Maki K, Mitani K, Hirai H. The corepressor CtBP interacts with Evi-1 to repress transforming growth factor beta signaling. Blood 2001; 97: 2815–2822. 33 Morishita K, Suzukawa K, Taki T, Ihle JN, Yokota J. EVI-1 zinc finger protein works as a transcriptional activator via binding to a consensus sequence of GACAAGATAAGATAAN1–28 CTCATCTTC. Oncogene 1995; 10: 1961–1967. 34 Soderholm J, Kobayashi H, Mathieu C, Rowley JD, Nucifora G. The leukemia-associated gene MDS1/EVI1 is a new type of GATAbinding transactivator. Leukemia 1997; 11: 352–358. 35 Wimmer K, Vinatzer U, Zwirn P, Fonatsch C, Wieser R. Comparative expression analysis of the antagonistic transcription factors EVI1 and MDS1-EVI1 in murine tissues and during in vitro hematopoietic differentiation. Biochem Biophys Res Commun 1998; 252: 691–696. 36 Gullberg U, Andersson E, Garwicz D, Lindmark A, Olsson I. Biosynthesis, processing and sorting of neutrophil proteins: insight into neutrophil granule development. Eur J Haematol 1997; 58: 137–153.

37 Morishita K, Tsuchiya M, Asano S, Kaziro Y, Nagata S. Chromosomal gene structure of human myeloperoxidase and regulation of its expression by granulocyte colony-stimulating factor. J Biol Chem 1987; 262: 15208–15213. 38 Nuchprayoon I, Meyers S, Scott LM, Suzow J, Hiebert S, Friedman AD. PEBP2/CBF, the murine homolog of the human myeloid AML1 and PEBP2 beta/CBF beta proto-oncoproteins, regulates the murine myeloperoxidase and neutrophil elastase genes in immature myeloid cells. Mol Cell Biol 1994; 14: 5558–5568. 39 Oelgeschlager M, Nuchprayoon I, Luscher B, Friedman AD. C/EBP, c-Myb, and PU.1 cooperate to regulate the neutrophil elastase promoter. Mol Cell Biol 1996; 16: 4717–4725. 40 Grisolano JL, Sclar GM, Ley TJ. Early myeloid cell-specific expression of the human cathepsin G gene in transgenic mice. Proc Natl Acad Sci USA 1994; 91: 8989–8993. 41 Shapiro LH, Ashmun RA, Roberts WM, Look AT. Separate promoters control transcription of the human aminopeptidase N gene in myeloid and intestinal epithelial cells. J Biol Chem 1991; 266: 11999–12007. 42 Tenen DG, Hromas R, Licht JD, Zhang DE. Transcription factors, normal myeloid development, and leukemia. Blood 1997; 90: 489–519. 43 Moreau-Gachelin F. Spi-1/PU.1: an oncogene of the Ets family. Biochim Biophys Acta 1994; 1198: 149–163. 44 Hromas R, Klemsz M. The ETS oncogene family in development, sproliferation and neoplasia. Int J Hematol 1994; 59: 257–265.