bound by CTCF, which functions as a chromatin insulator and prevents Igf2 ...... DNA fragments immunoprecipitated with an antibody for a given factor ..... (Upstate Biotechnology 06-942; 5 µg); anti-acetyl-H4 (Upstate Biotechnology 06-866; 1.
THE IDENTIFICATION, ESTABLISHMENT, AND MAINTENANCE OF GENOMIC IMPRINTS
By CHRISTINE MIONE KIEFER
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2005
To Chris – our adventure continues
ACKNOWLEDGMENTS I would first like to thank Tom for his support and patience throughout my time in his laboratory. I also must thank all the members of the lab, past and present, from whom I have learned an incredible amount. Thanks especially to Chien Chen, who could always see an alternative approach to answer a question, and Sue Kang, who taught me more than just about the science in the lab and who continues to be someone I am proud to call a friend. Also, thanks so much to Sara Rodriguez-Jato, one of the best scientists I know and a friend I am sure I will continue to learn from and laugh with in the future. I also appreciate the various students I have had the opportunity to train in the lab, most importantly Kristina Buac who worked diligently for over a year to get the DNA methylation analysis of Mkrn3 started. I am grateful for the help of my collaborators and fellow graduate students over the years, particularly John McCarrey and his lab who did virtually all of the germ cell isolations for the methylation project. I would also like to especially thank my graduate committee for their help and advice. On a personal note, I would like to say how incredibly thankful I am to have the support and love of Chris, my best friend for 13 years and my husband for 2 years. Also thanks to my family for their unconditional support in everything I have ever attempted. Your faith in me gives me the strength and determination to succeed in anything I do.
iii
TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................................................................................. iii LIST OF TABLES............................................................................................................ vii LIST OF FIGURES ......................................................................................................... viii ABSTRACT.........................................................................................................................x CHAPTER 1
INTRODUCTION AND LITERATURE REVIEW ....................................................1 Epigenetics....................................................................................................................1 DNA methylation ..................................................................................................1 Modification of histone proteins ...........................................................................5 Additional epigenetic mechanisms........................................................................7 Genomic Imprinting......................................................................................................8 The “classic” imprinted domain: H19 and Igf2...................................................11 The Prader-Willi and Angelman Syndromes Imprinted Gene Cluster.......................13 Clinical observations ...........................................................................................13 Genes in the PWS / AS domain...........................................................................16 The imprinting center ..........................................................................................20 Molecular genetic approaches to the study of PWS / AS in mouse ....................22 Epigenetic marks in the PWS / AS domain.........................................................24
2
DNA METHYLATION ANALYSIS OF THE IMPRINTED Snurf-Snrpn AND Mkrn3 GENES DURING GAMETOGENESIS AND EMBRYOGENESIS ............27 Introduction.................................................................................................................27 Results.........................................................................................................................31 DNA methylation patterns of the Mkrn3 CpG island in somatic tissue ..............31 The maternal DNA methylation imprint is erased and reset during embryonic germ cell development.....................................................................................33 DNA methylation imprints established during germ cell development are maintained during pre- and post-implantation development ...........................39 Absence of intragenic DNA methylation correlates with high levels of tissueand developmental stage-specific gene expression..........................................42 Identification of allele-specific hypersensitive sites within the Mkrn3 gene ......44 iv
Discussion...................................................................................................................46 Distal genes establish and maintain the DNA methylation imprint similarly to regions within the imprinting center ................................................................46 Developmental timing of the maternal-specific DNA methylation imprint........49 Intragenic DNA methylation may modulate Mkrn3 expression in a tissue- or developmental-specific manner .......................................................................53 DNase I hypersensitive sites identify cis-acting elements which may regulate transcription and act as a chromatin boundary ................................................54 3
CIS- AND TRANS-ACTING REGULATORY ELEMENTS OF THE IMPRINTED Mkrn3 GENE ..............................................................................................................55 Introduction.................................................................................................................55 Results.........................................................................................................................55 Identification of putative factor binding using transcription factor databases ....55 In vivo footprinting of the Mkrn3 promoter region .............................................56 Confirmation of factor binding by in vivo chromatin immunoprecipitation analysis.............................................................................................................62 Allele-specific analysis of histone modifications throughout the Mkrn3 locus ..66 Discussion...................................................................................................................68
4
MATERIALS AND METHODS ...............................................................................70 Mating Strategy for Mkrn3 and Snrpn DNA Methylation Analysis...........................70 Genomic DNA Isolation and Preparation...................................................................70 High-Resolution Sodium Bisulfite Genomic Sequencing ..........................................71 Analysis of DNA Methylation Data ...........................................................................73 DNase I Hypersensitivity Analysis.............................................................................73 In vivo and in vitro DMS Treatment of Cells and DNA for in vivo Footprinting ......74 Ligation-Mediated PCR (LMPCR).............................................................................75 Electrophoresis, Transfer, and Hybridization of Sequencing Gels.............................76 Chromatin Immunoprecipitation Analysis Using Real-Time PCR ............................77
5
CONCLUDING REMARKS AND FUTURE DIRECTIONS...................................83
APPENDIX A LOW PROTEIN DIET AFFECTS DNA METHYLATION IMPRINTS IN THE PLACENTA ...............................................................................................................87 Introduction.................................................................................................................87 Materials and Methods ...............................................................................................89 Control and low protein diets ..............................................................................89 Placenta collection and genomic DNA and RNA isolation.................................90 Sodium bisulfite genomic sequencing.................................................................90 Expression analysis by qPCR..............................................................................92 v
Methyl acceptance assay .....................................................................................92 Results.........................................................................................................................93 DNA methylation analysis of the Igf2 P0 promoter DMR..................................93 DNA methylation analysis of the H19-Igf2 imprinting control region ...............95 DNA methylation analysis of the Snrpn 5’ CpG island ......................................97 A low protein diet affects imprinted gene expression .........................................99 Global levels of DNA methylation are not affected by a low protein diet........101 Discussion.................................................................................................................103 LIST OF REFERENCES.................................................................................................106 BIOGRAPHICAL SKETCH ...........................................................................................126
vi
LIST OF TABLES page
Table 4-1
PCR primers utilized for DNA methylation analysis after sodium bisulfite conversion of DNA ..................................................................................................72
4-2
PCR primers utilized for LM-PCR in vivo footprinting analysis.............................76
4-3
PCR primers utilized for chromatin immunoprecipitation analysis.........................81
vii
LIST OF FIGURES page
Figure 1-1
The H19 – Igf2 imprinted locus on distal chromosome 7 in mouse. .......................12
1-2
Schematic of the PWS/AS imprinted gene cluster...................................................14
2-1
DNA methylation analysis of the 5’ and intragenic CpG island of Mkrn3 in somatic tissue.. .........................................................................................................31
2-2
DNA methylation analysis of the Snrpn 5’ CpG island in somatic tissue. ..............32
2-3
DNA methylation imprints are erased in the 5’ CpG islands of Mkrn3 and Snrpn during primordial germ cell development.. ...................................................34
2-4
Hypomethylation is observed in the 5’ CpG islands of Mkrn3 and Snrpn during late stages of spermatogenesis. .....................................................................36
2-5
The maternal-specific DNA methylation imprint within the 5’ CpG island of Mkrn3 is re-established during female embryonic germ cell development in an allele-specific manner......................................................................................37
2-6
The maternal-specific DNA methylation imprint within the 5’ CpG island of Snrpn is also re-established during female embryonic germ cell development in an allele-specific manner......................................................................................38
2-7
DNA methylation imprints within the 5' CpG islands of Mkrn3 and Snrpn are maintained during pre- and post-implantation development....................................41
2-8
Biallelic DNA methylation within the Mkrn3 intragenic CpG island was observed in the majority of stages analyzed.............................................................42
2-9
A loss of methylation of the Mkrn3 intragenic CpG island is observed only during specific stages of male germ cell development.............................................43
2-10 DNase I hypersensitivity within the Mkrn3 gene.....................................................45 2-11 Summary of DNA methylation changes throughout development in the 5’ CpG island of Snrpn and the 5’ and intragenic CpG island of Mkrn3.. ...................47 2-12 Quantitation of DNA methylation observed within Mkrn3 and Snrpn throughout development...........................................................................................48 viii
2-13 Female germ cells isolated at E18.5 and 21.5dpc were hypomethylated at the H19-DMR, indicating that the cell preparations contain low levels of somatic cell contamination.......................................................................................50 3-1
Fundamentals of in vivo footprinting.. .....................................................................57
3-2
Schematic representation of the Mkrn3 5’ region analyzed by in vivo footprinting...............................................................................................................58
3-3
DMS in vivo footprint analysis of the 5’ region of Mkrn3.......................................59
3-4
DMS in vivo footprint analysis of the 5’ region of Mkrn3.......................................60
3-5
ChIP analysis of NRF2 within the Mkrn3 gene and flanking regions .....................63
3-6
Analysis of NRF2 binding at additional genes within the PWS / AS cluster.. .....................................................................................................................64
3-7
Allele-specific in vivo interaction of Sp1 and YY1 with the Mkrn3 promoter region. .......................................................................................................65
3-8
Differential histone modifications within the Mkrn3 locus. ....................................67
5-1
Identification of allele-specific epigenetic marks and regulatory elements within the imprinted Mkrn3 gene .............................................................................84
A-1 Placental DNA methylation is significantly reduced in the placenta-specific P0 promoter region of the rat Igf2 gene after gestation in pregnant females fed a low protein diet................................................................................................94 A-2 Reduction of placental DNA methylation in the rat H19-DMR after gestation in pregnant females fed a low protein diet. ..............................................................96 A-3 Placental DNA methylation is reduced in the rat Snrpn promoter region after gestation in pregnant females fed a low protein diet................................................98 A-4 Analysis of imprinted gene mRNA levels in the placenta after gestation in pregnant females fed a low protein diet .................................................................100 A-5 Global DNA methylation levels are not significantly affected by a low protein diet..............................................................................................................102 A-6 Summary of the effects of a low protein diet on DNA methylation at three imprinted loci in the placenta .................................................................................103
ix
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE IDENTIFICATION, ESTABLISHMENT, AND MAINTENANCE OF GENOMIC IMPRINTS By Christine Mione Kiefer May 2005 Chair: Thomas P. Yang, Ph.D. Major Department: Biochemistry and Molecular Biology Genomic imprinting is an epigenetic process through which certain genes acquire an expression pattern dependent on the parental origin of the allele. Allele-specific DNA methylation is a common epigenetic mark, or imprint, found within imprinted regions. We examined the developmental changes of DNA methylation patterns within Mkrn3, a paternally-expressed imprinted gene, in two novel CpG islands separated by only 235 bp. The 5’ CpG island contains a DNA methylation imprint that distinguishes the maternal and paternal alleles in somatic tissue (the active paternal allele is undermethylated and the inactive maternal allele is hypermethylated). This imprint is erased and reset during gametogenesis and is protected from alteration during embryonic development. The intragenic CpG island biallelically methylated throughout development with the exception of specific stages of spermatogenesis correlating with an increase in Mkrn3 expression. DNase I hypersensitivity analysis identified two paternal-specific hypersensitive sites: HS1, near the Mkrn3 promoter and HS2, near the region between
x
the two CpG islands. A more detailed localization of HS2 may yield some insight into whether it could act as a chromatin boundary which allows the two CpG islands to maintain dissimilar DNA methylation patterns in somatic tissue and throughout development. Further characterization of HS1 by in vivo footprinting and chromatin immunoprecipitation confirmed the paternal-specific binding of NRF2, YY1, and SP1 in vivo. These factors may play a role in the regulation of Mkrn3 transcription and / or may mediate the interaction between the imprinting center and Mkrn3 to facilitate imprinted gene expression. The maintenance of DNA methylation imprints was also examined under conditions of nutrient deficiency. Placental DNA isolated from pregnant rats fed a low protein diet showed a significant decrease in DNA methylation in at least three imprinted gene loci. The loss of DNA methylation was accompanied by an alteration in gene expression. Additionally, the reduction in DNA methylation we observed within imprinted loci does not seem to be a reflection of global changes in DNA methylation levels. Future studies will determine whether our observations are unique to imprinted genes or whether other loci specifically regulated by DNA methylation are also affected, including tissue-specific genes and genes subject to X-inactivation. Further analysis will also examine whether similar alterations to DNA methylation occur in fetal tissue, and in particular within fetal germ cells, which could result in heritable epigenetic changes that continue to affect future progeny. These studies provide a description of allele-specific regulatory elements within the Mkrn3 gene and illustrate how the DNA methylation imprint may be altered during development and in response to environmental stress.
xi
CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW Genomic imprinting is a well-studied model system for the examination of epigenetic modifications and their role in transcriptional regulation. This dissertation will focus on the differential epigenetic marks and regulatory elements that define imprinted domains and how one of these modifications, DNA methylation, changes during mouse development and in response to nutrient depletion. Epigenetics Epigenetics is a general term to describe heritable mechanisms that affect gene expression which cannot be explained by DNA sequence, that is, modifications of the chromatin and DNA that form part of the transcriptional memory of a cell. In a global view, epigenetic information complements the genetic information to determine what genes are transcribed and at what level (Wu and Morris, 2001 and reviewed in Jaenisch and Bird, 2003). Importantly, although epigenetic modifications are stable and heritable during cell divisions (both meiosis and mitosis), these marks are also dynamic, particularly during development, and may undergo both global and gene-specific changes to direct appropriate levels of transcription in specific cell types and during specific stages of development (Li, 2002; Reik et al., 2003). These epigenetic modifications are then maintained in terminally differentiated cells. DNA methylation The addition of a methyl group to position 5 of cytosines in the context of a CpG dinucleotide is the most well studied epigenetic mark in mammalian cells. The frequency
1
2 of CpG dinucleotides in the mammalian genome is underrepresented and likely the result of deamination of methylated cytosine residues to thymine. The majority of CpG dinucleotides in the genome are methylated early in development, with the exception of CpG-rich regions, termed CpG islands (Eden and Cedar, 1994). There is a strong correlation between DNA methylation and the transcriptional silencing of promoters, particularly within tissue-specific genes, imprinted genes, or genes subject to Xinactivation (Bird, 1992). The establishment and maintenance of DNA methylation patterns has been attributed to a family of DNA methyltransferases (Bestor, 2000). The maintenance methyltransferase, Dnmt1, preferentially recognizes hemi-methylated DNA (Yoder et al., 1997) and remethylates newly synthesized daughter strands during DNA replication. This activity ensures that the correct DNA methylation patterns are inherited by each daughter cell during mitosis. In addition to the somatic housekeeping form of Dnmt1, expression of alternate splice-forms is driven by sex-specific promoters (Bestor, 2000). The oocyte-specific form, Dnmt1o, undergoes a unique series of migrations between the nucleus and cytoplasm during female germ cell and pre-implantation development and may be important for the maintenance of methylation patterns at imprinted loci (Carlson et al., 1992; Howell et al., 2001; Mertineit et al., 1998). Dnmt1p is expressed only in pachytene spermatocytes, however the mRNA is not actively translated which may be responsible for the reduction of Dnmt1 activity in these cells (Mertineit et al., 1998). Dnmt 3a and 3b are mainly responsible for de novo methylation during post-implantation development. A loss of Dnmt3b has also been implicated in ICF (immunodeficiencycentromeric instability-facial anomalies) syndrome, and may be important for the
3 establishment or maintenance of centromeric heterochromatin (Okano et al., 1999; Xu et al., 1999). Additional family members, such as Dnmt2 and Dnmt3L, exhibit no independent methyltransferase activity, but may still be required for the establishment or maintenance of DNA methylation (Bestor, 2000). Dnmt3L, in particular, is expressed during gametogenesis and has been shown to be required for the monoallelic expression of imprinted genes (Bourc'his et al., 2001; Hata et al., 2002). Demethylation is likely mediated by two distinct mechanisms. Passive demethylation results from an inability to maintain DNA methylation levels after cell division, and has been observed in the maternally-inherited genome during preimplantation development (Rougier et al., 1998; Santos et al., 2002). Active demethylation has been observed in non-dividing cells during primordial germ cell development, at specific genes, and after fertilization in the male pronucleus (Geyer et al., 2004; Kafri et al., 1992; Mayer et al., 2000; Oswald et al., 2000). The DNA demethylase continues to elude discovery after almost 30 years of discussion, but it has been suggested that the protein or proteins involved may have deaminase activity and convert methylated cytosine to thymine (Kubicek and Jenuwein, 2004; Morgan et al., 2004). The mechanism for transcriptional repression by DNA methylation is not well understood. The most straightforward scheme is that DNA methylation interferes directly with binding of transcription factors or other regulatory proteins to their cognate DNA sequence, and a number of examples in the literature support this hypothesis (Deng et al., 2001; Eden and Cedar, 1994; Rhodes et al., 1994). More recent evidence suggests that an alternative mechanism for the repressive effects of promoter methylation is
4 mediated through chromatin condensation. Proteins which bind specifically to methylated DNA such as those in the MBD/MeCP2 family are often found in silencing complexes that include additional chromatin modifying enzymes such as histone deacetylases and remodeling proteins (discussed in more detail below) (reviewed in Bird, 2002; Harikrishnan et al., 2005). Dynamic changes in the genome-wide patterns of DNA methylation occur during mammalian embryonic and germ cell development. In general, the levels of DNA methylation in somatic tissue are higher than observed in sperm and egg, with egg containing slightly lower levels than sperm (Kafri et al., 1992). Upon fertilization, the male pronucleus undergoes an active demethylation which is complete before the first cell division (Mayer et al., 2000; Oswald et al., 2000). The maternally-inherited DNA also becomes demethylated, beginning after fusion of the parental pronuclei, by a passive process dependent on DNA replication. By the 32-cell blastocyst stage, the majority of the genome is hypomethylated, with the exception of some imprinted genes, such as H19 and Ras Grf1 and specific repeat regions such as intracisternal A particles (IAPs) (Kim et al., 2004; Lane et al., 2003; Olek and Walter, 1997; Tremblay et al., 1997; Warnecke et al., 1998). Upon implantation, active remethylation begins to help establish the correct patterns of gene expression within the developing embryo (Li, 2002; Santos and Dean, 2004). In mouse, this remethylation process is complete sometime between embryonic day 6.5 to 9.0 (E6.5 to E9.0). A second wave of demethylation occurs in primordial germ cells, and is complete by E13.5 in the mouse when male and female germ cells undergo mitotic or meiotic arrest, respectively. Single-copy gene sequences and most, if not all, imprinted genes become demethylated during this time (Hajkova et al., 2002; Kafri et al.,
5 1992; Shemer et al., 1997). Remethylation begins a few days later, and appears to occur in females later in developmental time than it does in males (Brandeis et al., 1993; Coffigny et al., 1999; Kafri et al., 1992). Modification of histone proteins The first order packaging of DNA into chromatin is facilitated by the wrapping of up to 170 nucleotides of DNA around a histone octamer composed of two copies each of histones H2A, H2B, H3 and H4 (Luger et al., 1997). Each of the core histones contains an amino-terminal tail which, along with a few specific regions within the globular domain, is subject to a wide variety of modifications, including acetylation of lysines, methylation of lysines and arginines, serine phosphorylation, lysine ubiquitylation, and sumoylation (Berger, 2002; Iizuka and Smith, 2003). The variety of specific combinations of these covalent modifications has been suggested to define a histone code which can identify silenced, active, or potential regions of transcription (Jenuwein and Allis, 2001; Richards and Elgin, 2002; Spotswood and Turner, 2002). Acetylation of lysine residues is associated with regions of active or potentiated transcription, but has also been linked to replication and nucleosome assembly, higherorder chromatin structure, and can serve as a mark for open and accessible chromatin of large domains (reviewed in Grant and Berger, 1999). Conversely, deacetylation of lysine residues is associated with transcriptional repression and a less accessible chromatin conformation. The proteins responsible for the acetylation of histones may be categorized into a number of sub-families, including the Gcn5-related N-acetyltransferase superfamily (GNAT), p300/CBP related histone acetyltransferases (HATs), and others (Grant, 2001). Each class has been linked to specific cellular processes such as those
6 mentioned above. Histone deacetylases have been generally associated with silencing complexes and act as transcriptional corepressors (Wolffe et al., 2000). Histone methylation, in contrast with acetylation, may be associated with either active or repressed chromatin dependent on the specific residue containing the modification. Transfer of a methyl group from S-adenosyl methionine can be to either lysine or arginine on the histone tails (Manzur et al., 2003; Min et al., 2002). Additionally, these amino acids can accept mono-, di-, and tri-methylation, and each of these may have very specific consequences on the chromatin structure and transcriptional activity of a particular region (Schotta et al., 2004). For example, di- and tri- methylation of histone H3 lysine 4 (H3K4) is enriched in the 5’ region of active genes, whereas methylation at H3K9 and H3K27 residues is associated with transcriptional repression. The proteins responsible for the deposition of methyl groups on histone tails, the histone methyltransferases (HMTs), seem to be specific for individual amino acids of a particular histone tail (Schotta et al., 2004). For example, SET7/9 is restricted to monomethylation of H3K4, whereas DIM-5 is specific to tri-methylation of H3K9 (reviewed in Peterson and Laniel, 2004). Histone demethylases have only recently been identified and also have a narrow specificity for the degree of methylation on a particular arginine or lysine residue. The removal of mono- or di-methylation of arginines, a modification which has been associated with active transcription, is carried out by protein arginine demethylases (PADs) (Cuthbert et al., 2004; Wang et al., 2004). These enzymes effectively remove arginine methylation via a deimination reaction that converts unmodified, mono- , or di-methylated arginine residues to citrulline. The first true histone demethylase, LSD1, is specific for H3K4 mono- or di-methylation and removes
7 methyl groups by way of amine oxidation which results in unmodified lysine and formaldehyde (Shi et al., 2004). Undoubtedly, the discovery of additional demethylase enzymes with alternate substrate specificity will occur in the near future. Additional epigenetic mechanisms One emerging mechanism of epigenetic regulation is RNA-mediated effects on chromatin structure and gene expression. The first evidence that RNA can direct epigenetic changes in chromatin structure emerged in plants with the discovery of RNAdirected DNA methylation in tobacco plants (Wassenegger et al., 1994). The elucidation of additional dsRNA mediated pathways has resulted in a new understanding of the role of RNA in the regulation of chromatin structure and gene expression. For example, RNAi-mediated heterochromatin formation and RNA-directed DNA methylation (RdDM) are epigenetic processes that result in covalent modification of histones (typically methylation of lysine 9 of histone H3) or cytosines in DNA, respectively (reviewed in Matzke and Birchler, 2005). Although some components required for these processes in plants and other lower eukaryotes are present in mammals, the evidence is still unclear whether RdDM or heterochromatin formation via RNAi can occur in mammalian systems (Kawasaki and Taira, 2004; Morris et al., 2004; Svoboda et al., 2004). Replacement of the four canonical histones with variant histone isoforms has also been shown to be critical for the establishment and maintenance of chromatin structure in specialized systems of gene regulation. Variants of histone H3 include H3.1, H3.2, H3.3, and CenpA (Sarma and Reinberg, 2005). H3.3 is present at transcriptionally active loci, and may be deposited in a replication-dependent or replication independent pathway (Ahmad and Henikoff, 2002a; Ahmad and Henikoff, 2002b). Although CenpA shares
8 limited sequence homology to other H3 isoforms, it co-purifies with other histones and is specifically localized to centromeric heterochromatin (Palmer et al., 1987; Sullivan et al., 1994). Several variants for H2A have also been identified, including macroH2A, H2AZ, H2AX, and H2A-Barr-body-deficient (Sarma and Reinberg, 2005). These histone isoforms are enriched on the inactive X-chromosome (macroH2A) (Costanzi and Pehrson, 1998), within actively transcribed regions that flank heterochromatin (H2AZ) (Meneghini et al., 2003), and at sites of DNA double-strand breaks (H2AX) (Rogakou et al., 1998). The specific pathways for the deposition of these histone variants are just beginning to be understood and have suggested a link between complexes that exchange histone isoforms and those that disrupt nucleosome structure (Sarma and Reinberg, 2005). Genomic Imprinting Genomic imprinting is an epigenetic process by which differential allele-specific epigenetic modification of certain genes during development result in the preferential expression of a gene from one allele, depending on the parent of origin. Although plants (Autran et al., 2005) and insects (Bongiorni and Prantera, 2003) are also subject to this process in some form, this dissertation will focus on genomic imprinting in eutherian mammals which was first described by McGrath and Solter and Surani et al. using nuclear transfer experiments (McGrath and Solter, 1984; Surani et al., 1984). These groups showed that diploid androgenetic or gynogenetic embryos derived from two sperm or egg pronuclei respectively failed to thrive and collectively demonstrated the requirement of both a maternal and paternal genome contribution for successful embryonic development. Additionally, they postulated that specific genes required for development must be exclusively expressed from one parental genome. Since the literal
9 DNA sequence of these genes, whether maternal or paternal in origin, is theoretically identical, allele identity must be established and maintained by the epigenetic modification of one or both alleles. In the time since the discovery of genomic imprinting, much about the organization and evolution of imprinted domains and the elements that establish and maintain imprinted gene expression has been elucidated. A detailed mechanism for the epigenetic control of imprinted gene expression, however, is less understood. To date, almost 100 imprinted genes have been identified (visit www.geneimprint.com for updated information), and a few unifying themes have emerged. First, imprinted genes are often organized into large chromosomal domains within the mammalian genome that include both maternally-expressed and paternally-expressed genes. The organization and parental-specific expression of genes within these clusters of imprinted genes is often conserved among species throughout mammalian evolution (Reik and Walter, 1998; Verona et al., 2003). Additionally, imprinted genes are often coordinately regulated within domains by an imprinting control region (ICR). Several well studied gene clusters, including the H19-Igf2 and Prader-Willi and Angelman syndromes imprinting domains which are discussed below, seem to be under the control of specific cis-acting elements that regulate the epigenetic modifications and / or imprinted gene expression of genes located tens to thousands of kilobases away. Regulation by ICRs also seems to be evolutionarily conserved among eutherian mammals, in particular between human and rodent species. The combination of epigenetic marks at imprinted loci which distinguish one allele from the other, termed the parental epigenotype, may be involved either directly or
10 indirectly in the expression of imprinted genes. The allele-specific methylation of cytosine residues in DNA within the context of a CpG dinucleotide is the hallmark of imprinted genes (Reik et al., 2003). Although differential DNA methylation is found within a number of imprinted gene promoters containing CpG islands, the presence of DNA methylation on an imprinted allele is not universally correlated with gene silencing (Razin and Cedar, 1994; Verona et al., 2003). Differential chromatin structure has also been observed at imprinted loci, where covalent modifications of histone tails associated with gene repression, such as methylation of lysine 9 on histone H3, are found on the silenced allele, while the active allele contains histone tail modifications such as methylation of lysine 4 on histone H3 which are related to active transcription of a locus (Fournier et al., 2002; Grandjean et al., 2001; Reik et al., 2003; Verona et al., 2003; Xin et al., 2001; Yang et al., 2003). Additional allele-specific characteristics which may be related to the epigenetic modifications discussed above have also been identified within imprinted domains. Asynchronous replication of parental alleles, where the paternally-inherited copy has been shown to consistently replicate earlier than the maternally-inherited allele, has been observed as early as the first round of replication in the zygote and until the onset of meiosis in germ cells (Gribnau et al., 2003; Kitsberg et al., 1993; Simon et al., 1999). Allele-specific hypersensitivity to nuclease digestion has been observed at imprinted loci, suggesting that the maternal and paternal alleles contain dissimilar chromatin architecture and factor binding (Feil and Khosla, 1999; Hark and Tilghman, 1998; Khosla et al., 1999; Koide et al., 1994; Schweizer et al., 1999). Indeed, parental alleles exhibit differential factor binding, specifically within the ICRs and imprinted gene promoters (reviewed in
11 Delaval and Feil, 2004). Matrix attachment regions (MARs) have also been investigated for their role in genomic imprinting as they may influence gene expression, methylation, and chromatin structure in cis and can be affected by passage through the germ line (Greally et al., 1999; Weber et al., 2003). Existence of MARs in imprinted regions may act in an allele-specific manner via factors such as YY1 bound to both the nuclear matrix and the imprinted loci (Guo et al., 1995). There are two critical time points in mammalian development for the establishment and maintenance of genomic imprints. Although all somatic cells have epigenetically distinct maternally- and paternally-inherited imprinted genes, the gametes must erase and reset the parental-specific epigenetic marks to either a maternal epigenotype (oogenesis) or a paternal epigenotype (spermatogenesis). This “imprint switch” ensures the equal contribution of correctly imprinted maternal and paternal genomes to a zygote. Upon fertilization, these marks should be maintained to some degree to ensure the correct monoallelic expression of a particular imprinted gene in the appropriate tissues and at the appropriate developmental stage. The “classic” imprinted domain: H19 and Igf2 The imprinted locus on distal mouse chromosome 7 contains the H19 and insulinlike growth factor-2 (Igf2) genes and has been linked to a number of congenital growth abnormalities and tumors associated with Beckwith-Wiedemann syndrome (BWS) in humans (Henry et al., 1991). The H19 gene encodes a non-translated RNA that is expressed from the maternally-inherited allele and is silenced on the paternal allele (Bartolomei et al., 1991). A CpG-rich region located 2-4 kb upstream of H19 is
12
Figure 1-1: The H19 – Igf2 imprinted locus on distal chromosome 7 in mouse. Adapted from Lopes et al., 2003. methylated on the silenced paternally-inherited allele (Figure 1-1) (Brandeis et al., 1993). Igf2 is located 90 kb upstream of H19, and contains at least four promoters and three differentially methylated regions. In addition to an involvement in BWS, Igf2 plays an important role in the control of embryo and placental growth (Constancia et al., 2002). The most 5’ promoter / DMR of Igf2 has been shown to be placenta-specific, and an intact H19 gene is required in cis to maintain the maternal-specific hypermethylation of this region observed in placental tissue (Moore et al., 1997). Downstream of H19 are endodermal enhancers which can act on both H19 and Igf2. The coordinated regulation of these two genes is dependent on the presence or absence of a chromatin insulator which mediates the interaction of enhancers with either the H19 or Igf2 gene promoters (Bell and Felsenfeld, 2000). Similar to other imprinted domains, the imprinted expression of H19 and Igf2 is dependent on an imprinting control region (ICR) located 2-4 kb upstream of H19 that colocalizes with a DMR (Thorvaldsen et al., 1998). The maternal ICR is unmethylated and bound by CTCF, which functions as a chromatin insulator and prevents Igf2 from gaining access to enhancers downstream of H19. Conversely, the paternal ICR is methylated, which precludes the association of CTCF and allows for the preferential interaction of Igf2 with the downstream enhancers (Bell and Felsenfeld, 2000). Mutation of CTCF
13 binding sites and RNAi approaches indicate that CTCF bound to the maternal ICR is required to establish and maintain an unmethylated state in this region (Fedoriw et al., 2004; Pant et al., 2004; Schoenherr et al., 2003). Additionally, post-translational modification of CTCF is also required for its insulator function (Yu et al., 2004). Changes to the differential DNA methylation found in the H19-Igf2 ICR during germ cell development reflect the predicted erasure and re-establishment required of genomic imprints. The paternal-specific DNA methylation imprint in this region is erased sometime between E 11.5 and E12.5 (Hajkova et al., 2002) and re-established during spermatogenesis in an allele-specific manner (Davis et al., 2000; Ueda et al., 2000). Specifically, the paternally-inherited allele acquires the majority of de novo methylation in prospermatogonia during fetal development between E14.5 and E15.5. The maternally-inherited ICR remains hypomethylated until E18.5, and does not fully establish the paternal-specific pattern of DNA methylation until the completion of meiosis I (Davis et al., 1999; Ueda et al., 2000). These studies strongly suggest that additional epigenetic marks remain at these stages of male germ cell development to distinguish the maternal and paternal alleles and / or male-specific proteins remain bound to the maternally-inherited allele until later stages of spermatogenesis, thus protecting it from de novo methylation. The Prader-Willi and Angelman Syndromes Imprinted Gene Cluster Clinical observations Prader-Willi syndrome (PWS, OMIM 176270) and Angelman syndrome (AS, OMIM 105830) are two clinically distinct neurobehavioral disorders. PWS patients are characterized by neonatal hypotonia with failure to thrive, hypergonadism, hyperphagia and obesity, short stature and small hands and feet, craniofacial dysmorphism, mild
14 mental retardation with learning disabilities, and obsessive compulsive disorder (Cassidy et al., 2000). The clinical features of AS include ataxia and tremors, lack of speech, severe mental retardation, inappropriate laughter and in most cases microcephalus, seizures and abnormal electroencephalogram. With an relatively high incidence of 1 in every 10,000 to 15,000 births per year, the majority (~70%) of PWS and AS patients harbor a similar ~4 Mb chromosomal deletion of chromosome 15q11-13 (Butler and Palmer, 1983; Knoll et al., 1989; Williams et al., 1990). The imprinted domain within this deletion contains several paternally-expressed imprinted genes and at least two maternally-expressed genes (Figure 1-2). Therefore, the differential phenotype of Human: 15q11-13 MKRN3/ MKRN3-AS
snoRNA
NDN
Cen
ATP10C Tel
IC
IPW UBE3A-AS/ SNURF-SNRPN UBE3A
MAGEL2
Mouse: Chromosome 7c Mkrn3/ Mkrn3-as
Ndn
Tel
snoRNA
Atp10c/a Cen
IC
Frat3
Magel2
Paternally expressed
Snurf-Snrpn
Ipw Ube3a-as/ Ube3a
Maternally expressed
Figure 1-2: Schematic of the PWS/AS imprinted gene cluster. Paternally-expresses genes are shown in blue, and maternally-expressed genes are shown in pink. The Snrpn long transcript is indicated by the dotted line. Arrows indicate the direction of transcription. Cen = centromere, Tel = telomere, IC = imprinting center PWS and AS is dependent on the parental origin of the allele carrying the deletion. Paternal inheritance of the deletion, and thus the loss of paternal-specific gene
15 expression, results in PWS. Alternatively maternal inheritance of the deletion results in AS. The remaining patients with either PWS or AS have lost paternal or maternal gene expression, respectively, due to some other molecular mechanism. A relatively large proportion of PWS patients (~25-28%) have maternal uniparental disomy (UPD), possibly due to a rescue of trisomy 15 in the developing fetus created by meiotic nondisjunction (Driscoll, 1994; Nicholls et al., 1989). UPD in AS patients is much less frequent (2 Mb region is not well understood. Changes to the DNA methylation imprint within a portion of the putative imprinting center in mouse (within the 5’ region of Snrpn) have been analyzed throughout development (Lucifero et al., 2004; Lucifero et al., 2002; Shemer et al., 1997). These studies indicate that, in female germ cells, the re-methylation of the maternal allele occurs prior to the paternal allele. Additionally, although an earlier study utilizing a methyl-sensitive restriction enzyme / PCR based assay indicated that the reestablishment of the maternal-specific DNA methylation imprint occurs during embryonic female germ cell development (Shemer et al., 1997), recent evidence suggests that this re-establishment does not occur until after birth and is directly related to oocyte diameter (Lucifero et al., 2004; Lucifero et al., 2002). The allele-specific DNA methylation patterns established in the germ line within the 5’ region of Snrpn are
30 preserved and protected during pre- and post-implantation development (Shemer et al., 1997). In contrast, an analysis of Necdin, a paternally-expressed gene located between Mkrn3 and the IC, showed that parental-specific DNA methylation observed in sperm and oocytes was not maintained after fertilization, indicating that the DNA methylation imprint may play less of a role in the maintenance of Necdin imprinted expression (Hanel and Wevrick, 2001). Our objective was to identify and characterize the DNA methylation patterns within the Mkrn3 gene in a systematic way throughout mouse development. This study is the first to present a comprehensive DNA methylation analysis during mouse gametogenesis and embryogenesis within two CpG islands which are associated with an imprinted gene but not an imprinting control region. Interestingly, although the promoter-related 5’ CpG island and the intragenic CpG island are separated by only 235bp, we show that the DNA methylation patterns in these two regions are distinctive from each other. While the 5’ CpG island mimics the changes observed in the PWS/AS imprinting center throughout development and may serve as the Mkrn3 DNA methylation imprint, the intragenic CpG island may play a role in the tissue-specific modulation of Mkrn3 expression independent of IC-regulated imprinted expression. We have also identified two paternal-specific DNase I hypersensitive sites which map approximately within the proximal promoter and between the 5’ and intragenic CpG islands. The promoter-specific hypersensitive site may be indicative of transcription factor binding and a more open accessible chromatin structure on the paternal chromosome in this region. The potential role of the intragenic hypersensitive site as a paternal-specific boundary element is also discussed.
31 Results DNA methylation patterns of the Mkrn3 CpG island in somatic tissue We first examined the DNA methylation patterns of the Mkrn3 5’ CpG island in mouse brain and spleen, two tissues that have been previously shown to have relatively
A
C
Mkrn3 5’ CpG island: Brain
Mkrn3 intragenic CpG island: Brain
Maternal
Maternal
Paternal
Paternal
B
D
Mkrn3 5’ CpG island: Spleen
Mkrn3 intragenic CpG island: Spleen
Maternal
Maternal
Paternal
Paternal
Figure 2-1: DNA methylation analysis of the 5’ and intragenic CpG island of Mkrn3 in somatic tissue. Each horizontal line designates a single clone sequenced after sodium bisulfite conversion, PCR amplification, and cloning. Individual CpGs within the analyzed sequence are denoted by the circles. Filled circles represent methylated CpGs and open circles represent unmethylated CpGs. Maternally- and paternally-inherited alleles were distinguished using subspecies-specific single nucleotide polymorphisms between M.m.musculus and M.m.castaneus. high levels of Mkrn3 expression, to determine the somatic level of DNA methylation on each allele at high resolution. After chemical conversion with sodium bisulfite and DNA sequencing of individual clones, we utilized sub-species-specific single nucleotide
32
A
Snurf-Snrpn 5’ CpG island: Brain Maternal
Paternal
B Snurf-Snrpn 5’ CpG island: Spleen Maternal
Paternal
Figure 2-2: DNA methylation analysis of the Snrpn 5’ CpG island in somatic tissue. Three primer sets were utilized to analyze a region spanning from -175 to +899, relative to the transcription initiation site. All symbols are as described in Figure 2-1. polymorphisms between M.m.musculus and M.m castaneus to distinguish the maternallyand paternally-inherited alleles, respectively (see materials and methods for details). The 5’ CpG island of Mkrn3 spans from -254 to +551 relative to the transcription initiation site as defined by 50% GC content and a ratio of 0.65 observed CpG / expected CpG (Takai and Jones, 2003). A region from -336 to +145 was heavily methylated (58%) on the maternal allele and hypomethylated on the paternal allele (Figure 2-1A and B). By comparison, a region spanning from -175 to +899 relative to the transcription initiation site of Snrpn exhibited maternal hypermethylation (at a level of 97% on average for both tissues) and was almost completely unmethylated on the paternally-inherited allele in this same region (Figure 2-2). This region encompasses the majority of the Snrpn 5’ CpG
33 island and is included within the putative mouse IC. Since hypermethylation of the maternally-inherited allele in these regions is strongly correlated with maternal allelespecific silencing in somatic tissue (Hershko et al., 1999; Jong et al., 1999a), these results establish that differential methylation in the 5’ region of Mkrn3 may function as a genomic imprint in somatic tissue. We identified a second CpG island within the Mkrn3 gene located from +786 to +985 (Takai and Jones, 2003). Biallelic DNA methylation was observed in somatic tissue at 17 CpG dinucleotides within the intragenic CpG island (in a region spanning from +708 to +1189), indicating that DNA methylation in this region does not function as a genomic imprint to distinguish the parental alleles in somatic tissue (Figure 2-1C and D). The maternal DNA methylation imprint is erased and reset during embryonic germ cell development In order to observe whether the DNA methylation imprint within the 5’ CpG island of Mkrn3 is erased and re-established during gametogenesis, we began our analysis in primordial germ cells isolated at E10.5 when migration is still underway and the cells are beginning to reach the genital ridge (Gomperts et al., 1994). The cells analyzed at this stage did not contain a polymorphism that could be used to distinguish the maternally- and paternally- inherited alleles of Mkrn3, however approximately half of the clones analyzed were methylated to a similar degree observed on the maternal allele in somatic tissue (Figure 2-3A), and the remaining clones from E10.5 were hypomethylated. The two distinct populations of clones observed at this stage suggest that erasure of the DNA methylation imprint has not occurred in primordial germ cells this early in development.
34 To investigate further, we examined male and female germ cells separately at E13.5 and utilized single nucleotide polymorphisms between the M.m.musculus and M.m. castaneus alleles. The 5’ region of Mkrn3 was hypomethylated in male and female germ
A
C
Mkrn3: E10.5 germ cells
Snurf-Snrpn: E10.5 germ cells
B
D
Mkrn3: E13.5 male germ cells
Snurf-Snrpn: E13.5 male germ cells
Maternal
Maternal
Paternal
Paternal
Mkrn3: E13.5 female germ cells Maternal
Paternal
Snurf-Snrpn: E13.5 female germ cells Maternal
Paternal
Figure 2-3: DNA methylation imprints are erased in the 5’ CpG islands of Mkrn3 and Snrpn during primordial germ cell development. Bisulfite treated DNA from germ cells isolated at E10.5 was generously provided by D. Maatouk and J. Resnick, and these samples did not contain a polymorphism to distinguish the maternal and paternal alleles. All symbols are as described in Figure 2-1.
35 cells isolated at E13.5 (Figure 2-3B). We are unable to distinguish whether residual DNA methylation on the maternally-inherited allele of Mkrn3 in male germ cells may be a result of incomplete erasure, or whether the minimal DNA methylation observed in female germ cells could be indicative of either incomplete erasure or the early stages of the re-establishment of the DNA methylation imprint. The hypomethylation observed on both alleles of Mkrn3 suggests that the loss of the DNA methylation imprint occurs sometime between E10.5 and E13.5 when female germ cells enter meiotic prophase and male germ cells undergo mitotic arrest. Interestingly, our analysis of Snrpn at these stages (Figure 2C and D) indicates a similar erasure of the DNA methylation imprint, and these data are supported by previously published evidence that erasure of DNA methylation within Snrpn occurs sometime between E11.5 and E12.5 (Hajkova et al., 2002). In male germ cell development, the erasure of DNA methylation within the 5’ CpG island of Mkrn3 at E13.5 was further enhanced in pachytene spermatocytes and round spermatids isolated approximately a month later (Figure 2-4). Since the normal state of the paternal allele in somatic tissue is virtually unmethylated, these data suggest that after erasure, the demethylated state persists throughout the subsequent stages of spermatogenesis. The re-establishment of the DNA methylation imprint in the 5’ CpG island of Mkrn3 occurred during the embryonic stages of female germ cell development. The acquisition of de novo DNA methylation began at E15.5 (Figure 2-5A). This region subsequently acquired de novo methylation in an allele-specific manner, and the onset of methylation seemed to occur sporadically in all clones analyzed (Figure 2-5B and C).
36
A
C
Snurf-Snrpn: Pachytene spermatocytes
Mkrn3: Pachytene spermatocytes
Maternal
Maternal
Paternal
Paternal
B
D
Snurf-Snrpn: Round spermatids Maternal
Mkrn3: Round spermatids Maternal
Paternal Paternal
Figure 2-4: Hypomethylation is observed in the 5’ CpG islands of Mkrn3 and Snrpn during late stages of spermatogenesis. All symbols are as described in Figure 2-1. Specifically, on the maternally-inherited allele, the percent of methylated CpGs observed out of the total number of CpGs analyzed increased from 22.9% in E15.5 female germ cells to 33.2% and 44.4% in E18.5 and 21.5 dpc (days post coitus), respectively. Conversely, the paternally-inherited allele was delayed, increasing from 14.9% to 28.4% to 36.1% from E15.5 to E18.5 to 21.5 dpc. The complete somatic pattern of maternal DNA methylation was not fully established by 21.5 dpc on either allele. These results are in contrast to previous studies of a single CpG dinucleotide at position +157 within Mkrn3, a CpG just outside our region of analysis, indicating that mature oocytes contain no DNA methylation (Hershko et al., 1999).
37
A
B
Mkrn3: E15.5 female germ cells
Mkrn3: E18.5 female germ cells
Maternal
Maternal
Paternal
Paternal
C Mkrn3: 21.5 dpc female germ cells Maternal
Paternal
Figure 2-5: The maternal-specific DNA methylation imprint within the 5’ CpG island of Mkrn3 is re-established during female embryonic germ cell development in an allele-specific manner. All symbols are as described in Figure 2-1. Because of previous data which showed that maternal DNA methylation imprints are established during post-natal oogenesis (Lucifero et al., 2004; Lucifero et al., 2002), we next wanted to determine whether the acquisition of DNA methylation we observed during embryonic female germ cell development was novel to Mkrn3 or if the 5’ CpG island of Snrpn was also de novo methylated at these stages using our mating strategy. Indeed, we observed that the maternal-specific DNA methylation imprint within the 5’
38
A
B
Snurf-Snrpn: E15.5 female germ cells Maternal
Snurf-Snrpn: E18.5 female germ cells Maternal
Paternal
Paternal
C Snurf-Snrpn: 21.5 dpc female germ cells Maternal
Paternal
Figure 2-6: The maternal-specific DNA methylation imprint within the 5’ CpG island of Snrpn is also re-established during female embryonic germ cell development in an allele-specific manner. All symbols are as described in Figure 2-1. CpG island of Snrpn was also re-established during female embryonic germ cell development beginning at E15.5 (Figure 2-6A) in our system. Unlike Mkrn3, the establishment of DNA methylation on the maternally-inherited allele at this stage was not intermittent, that is, most individual clones were either heavily methylated or hypomethylated. This suggests that de novo DNA methylation at this stage was established rapidly and completely in this region within individual germ cells. Throughout embryonic female germ cell development, de novo methylation was observed in an increasing proportion of maternal allele-specific clones, similar to Mkrn3. The first
39 detectable de novo DNA methylation on the paternally-inherited allele of Snrpn was not observed until E18.5 at just a few CpG sites (Figure 2-6B), and therefore the onset of methylation was also delayed compared to the maternal allele. At 21.5 dpc, all the clones of the maternally-inherited allele of Snrpn were hypermethylated although not to the degree observed in somatic tissue in at least a few clones. The paternally-inherited allele by comparison was hypomethylated, with some clones still completely unmethylated and the remaining clones exhibiting a slight increase in CpG methylation compared to E18.5 female germ cells (Figure 2-6C). Interestingly, unlike female germ cells containing the maternally-inherited allele, the pattern of de novo DNA methylation in female germ cells containing the paternally-inherited allele appears to be random, beginning at just a few CpGs, which is similar to what was observed in the 5’ region of Mkrn3. These observations during embryonic female germ cell development suggest that some further epigenetic mark must continue to distinguish the maternally- and paternally-inherited alleles at these stages. Notably, although de novo DNA methylation initiates in the 5’ CpG island of Mkrn3 and Snrpn during female embryonic development, the complete maternal DNA methylation pattern may not be fully established in all female germ cells until post-natal oogenesis. DNA methylation imprints established during germ cell development are maintained during pre- and post-implantation development We analyzed the DNA methylation patterns within the 5’ CpG island of Mkrn3 during embryonic development to determine whether the DNA methylation imprint established during gametogenesis was maintained throughout the global demethylation and remethylation of the mouse genome that occurs in the developing embryo (Howlett and Reik, 1991; Kafri et al., 1992; Mayer et al., 2000; Oswald et al., 2000; Rougier et al.,
40 1998; Santos et al., 2005). Genome-wide demethylation occurs during pre-implantation mouse development, and a high-resolution DNA methylation analysis was vital to determine whether critical CpGs or the entire DNA methylation imprint was protected during this process to maintain allele identity. We analyzed the allele-specific DNA methylation patterns within the 5’ CpG island of Mkrn3 in blastocysts, near the end of this demethylation event, and determined that the degree and level of DNA methylation at this stage were similar to those observed in somatic tissue (Figure 2-7A). This suggests that the complete DNA methylation imprint of Mkrn3 is preserved and protected from demethylation prior to implantation. In agreement with previously published results (Shemer et al., 1997), our analysis determined that allele-specific DNA methylation patterns within the imprinting center are also maintained in both morula stage embryos isolated from E2.5 and blastocysts isolated from E3.5 (Figure 2-7B and C). The differential DNA methylation observed correlates with Snrpn expression, which has a strong paternal-allele bias as early as the 4-cell stage and is expressed exclusively from the paternally-inherited allele by the 8-cell stage in mice (Szabo and Mann, 1995). Additionally, increased expression of Mkrn3 in Dnmt1-deficient embryos (Hershko et al., 1999) may also suggest that the DNA methylation is important for Mkrn3 imprinted expression. Therefore, the maintenance of differential methylation in the 5’ CpG island of Mkrn3 is consistent with the possible imprinted expression of Mkrn3 during preimplantation development. After implantation, the developing embryo undergoes a general wave of remethylation, concluding sometime between E6.5 and E9.0 (Howlett and Reik, 1991;
41
A
D
Mkrn3: E3.5 blastocysts
Mkrn3: E12.5 embryo head
Maternal
Maternal
Paternal
Paternal
B
E
Snurf-Snrpn: E2.5 morula
Snurf-Snrpn: E9.5 embryo
Maternal
Maternal
Paternal
C Snurf-Snrpn: E3.5 blastocysts Maternal
Paternal
Paternal
F Snurf-Snrpn: E12.5 embryo head Maternal
Paternal
Figure 2-7: DNA methylation imprints within the 5' CpG islands of Mkrn3 and Snrpn are maintained during pre- and post-implantation development. All symbols are as described in Figure 2-1. Kafri et al., 1992; Santos et al., 2002). We examined allele-specific DNA methylation patterns in embryo heads from E12.5 after the genome-wide remethylation should be complete, and found no significant changes in DNA methylation compared to blastocyst stage embryos (Figure 2-7D – F). Therefore, the level of DNA methylation observed in pre-implantation embryos, specifically the hypomethylation of the paternally-inherited
42 allele, was preserved and protected from de novo methylation during post-implantation development. Absence of intragenic DNA methylation correlates with high levels of tissue- and developmental stage-specific gene expression Unlike the differentially methylated 5’ CpG island of Mkrn3, the intragenic CpG island of Mkrn3 was biallelically methylated in somatic tissue. We performed a similar comprehensive analysis of allele-specific DNA methylation patterns throughout
A
Mkrn3: E13.5 female germ cells
D
Mkrn3: 21.5 dpc female germ cells
Maternal
Maternal
Paternal
Paternal
B
E
Mkrn3: E15.5 female germ cells
Mkrn3: E3.5 blastocysts
Maternal
Maternal
Paternal
Paternal
C
F
Mkrn3: E18.5 female germ cells
Mkrn3: E12.5 embryo head
Maternal
Maternal
Paternal
Paternal
Figure 2-8: Biallelic DNA methylation within the Mkrn3 intragenic CpG island was observed in the majority of stages analyzed. All symbols are as described in Figure 2-1.
43
A Mkrn3: E10.5 germ cells
D Mkrn3: Pachytene spermatocytes Maternal
Paternal
B Mkrn3: E13.5 male germ cells Maternal
E Mkrn3: Round Spermatids Maternal
Paternal
Paternal
C Mkrn3: 6dpp Prim. Type A
F Mkrn3: testicular sperm
Figure 2-9: A loss of methylation of the Mkrn3 intragenic CpG island is observed only during specific stages of male germ cell development. All symbols are as described in Figure 2-1. development in this region as well. The majority of developmental stages examined also maintain the same level of biallelic DNA methylation observed in somatic tissue (Figure 2-8). Most notably, no observable erasure of DNA methylation was observed either in E13.5 germ cells (as seen in the 5’ CpG island of Mkrn3) or in E3.5 blastocysts after most of the genome has undergone global demethylation. The latter suggests that
44 although DNA methylation in this region does not epigenetically distinguish the maternal and paternal alleles at any developmental stage analyzed, it is nonetheless protected from global DNA methylation changes similar to the 5’ CpG islands of Mkrn3 and Snrpn. Biallelic DNA methylation was present at all stages of embryogenesis and female germ cell development, however clones analyzed during male germ cell development were biallelically methylated at E13.5 and completely unmethylated at all CpGs analyzed in pachytene spermatocytes and round spermatids (Figure 2-9A and B, D and E). Examination of clones derived from primitive type A spermatogonia, an earlier stage isolated from 6dpp mice, showed evidence of hypermethylation at a level equivalent to other developmental stages (Figure 2-9C). Additionally, sperm isolated from the vas deferens of adult mice also had a similar level of DNA methylation to the other stages analyzed (Figure 2-9F). Thus, the intragenic CpG island of Mkrn3 becomes transiently hypomethylated within pachytene spermatocytes and round spermatids. Interestingly, the absence of DNA methylation at these stages is strongly correlated with the high levels of Mkrn3 expression observed in testis and specifically in these cell types (Jong et al., 1999a). This correlation of expression and demethylation of the intragenic CpG island of Mkrn3 suggests that this region may play an important regulatory role for tissue- and developmental-stage specific expression. Identification of allele-specific hypersensitive sites within the Mkrn3 gene The somewhat surprising result that allele-specific DNA methylation patterns within two CpG islands separated by only 235bp could be so discordant in somatic tissue, and in fact throughout development, led us to further characterize Mkrn3 using DNase I hypersensitivity. Regions of DNase I hypersensitivity have been associated with the
45 altered chromatin structure and transcription factor binding within gene promoters as well as regulatory elements such as locus control regions and insulators (Boyes and Maternal allele [DNase I]
Paternal allele
G
G
5’ Mkrn3 (5.18 kb)
5’ Mkrn3 (5.18 kb)
HS2 (4.26 kb) HS1 (3.81 kb)
EcoRI Bgl II
EcoRI 1kb
-3715
HS1
HS2
+1464
BE0.7 (probe) Parental (5.18 kb) HS1 (3.81 kb) HS2 (4.26 kb)
Figure 2-10: DNase I hypersensitivity within the Mkrn3 gene. Intact cells were treated with increasing concentrations of DNase I, indicated by the triangles, and the subsequently isolated genomic DNA was digested with EcoRI and probed with the fragment BE0.7. The formation of hypersenstive sites was determined by comparison to non-DNaseI treated genomic DNA which was similarly digested with EcoRI and probed. Maternal and paternal alleles were analyzed separately using TgPWSdel and TgASdel immortalized mouse fibroblasts (Gabriel et al., 1999). Two paternal-specific hypersensitive sites were identified near the promoter and within the body of the Mkrn3 gene. Felsenfeld, 1996; Gross and Garrard, 1988; Hark and Tilghman, 1998; Khosla et al., 1999; Koide et al., 1994; Talbot et al., 1989). For this analysis, we utilized immortalized mouse fibroblasts derived from a previously described mouse model for Prader-Willi and Angelman syndromes (Gabriel et al., 1999). This approach allowed us to examine
46 localized hypersensitivity to DNase I of the maternal allele (in PWS fibroblasts) and paternal allele (in AS fibroblasts) separately. Each of the two cell lines was initially verified to contain the appropriate DNA methylation patterns and to maintain the correct imprinted expression of Mkrn3 and Snrpn (data not shown). Intact PWS and AS fibroblasts were then permeabilized and treated in vivo with increasing concentrations of DNase I. Isolated genomic DNA was digested with EcoRI for Southern blot analysis and hybridized with a probe (BE0.7) located upstream of the Mkrn3 promoter region. In PWS fibroblasts which contain a single maternally-inherited allele, only the expected 5.18kb genomic fragment was detected (Figure 2-10). Two hypersensitive fragments specific to the paternally-inherited allele were detected in AS fibroblasts at 3.81kb and 4.26 kb. The smaller fragment, HS1, maps near the 5’ region of Mkrn3, whereas HS2 maps in the vicinity of the region between the two previously identified CpG islands of Mkrn3. Discussion Distal genes establish and maintain the DNA methylation imprint similarly to regions within the imprinting center For the first time, we have systematically characterized the DNA methylation imprint of a gene located over two million base pairs away from the imprinting center, and showed that similar changes occur in both regions throughout mouse development (Figure 2-11 and 2-12). The 5’ CpG islands of both genes are differentially methylated in somatic tissue, although Mkrn3 has a lower overall level of maternal-specific DNA methylation compared to Snrpn. Additionally, the maternal DNA methylation imprint is erased in both the 5’ CpG islands of Mkrn3 and Snrpn sometime between E10.5 and E13.5 in male and female germ cells.
47 Similar to Snrpn, differential de novo DNA methylation during female germ cell development in the 5’ region of Mkrn3 was also observed. The allele-specific establishment of DNA methylation in both regions may be the result of imprints other than DNA methylation which remain and distinguish the maternal and paternal alleles. Snrpn
Mkrn3
5' CpG Island
Mkrn3
5' CpG Island
Intragenic CpG Island
Brain
Somatic Tissue
Spleen E10.5 PGCs
Male germ cell development
E13.5 Male Germ Cells Pachytene Spermatocytes Round Spermatids E10.5 PGCs E13.5 Female Germ Cells
Female germ cell development
E15.5 Female Germ Cells E18.5 Female Germ Cells 21.5 dpc Germ Cells E2.5 Morula
Embryogenesis
E3.5 Blastocysts E9.5 Embryos E12.5 Embryo head Maternal allele
Paternal allele Low
High
Degree of Methylation In Region Analyzed
Figure 2-11: Summary of DNA methylation changes throughout development in the 5’ CpG island of Snrpn and the 5’ and intragenic CpG island of Mkrn3. Circles represent the maternal allele, and squares represent the paternal allele. The degree of shading represents the percentage of methylated CpGs out of the total number of CpGs analyzed. These marks may act in cis- along with female-specific factors to either promote de novo maternal methylation or delay paternal methylation in the 5’ CpG islands of Mkrn3 and Snrpn. The difference in the pattern of de novo methylation between Mkrn3, which is established intermittently in all clones, and Snrpn, where individual clones either are hypermethylated or hypomethylated ((Lucifero et al., 2004) and data presented here),
48
Brain Spleen E10.5 primordial germ cells E13.5 male germ cells Primitive type A spermatogonia Pachytene spermatocytes Round spermatids Vas deferens sperm E13.5 female germ cells E15.5 female germ cells E18.5 female germ cells 21.5 dpc female germ cells E2.5 morula E3.5 blastocysts E9.5 embryo E12.5 embryo head
Snurf-Snrpn 5' CpG Island Mk rn3 5' CpG Island # mCpGs Total % meth. # mCpGs Total % meth. M P M P M P M P M P M P 541 0 554 740 97.65 0.00 103 1 180 216 57.22 0.46 425 7 438 424 97.03 1.65 139 7 234 180 59.40 3.89 173 322 53.73 140 396 35.35 0 0 0.00 0.00 20 0 180 180 11.11 0.00 0 0 182 140 0.00 0.00 0 0 180 270 0.00 0.00 0 0 140 182 0.00 0.00 0 0 198 252 0.00 0.00 1 3 168 154 0.60 1.95 12 2 180 216 6.67 0.93 81 0 210 238 38.57 0.00 70 43 306 288 22.88 14.93 144 6 308 168 46.75 3.57 85 92 256 324 33.20 28.40 160 40 182 196 87.91 20.41 112 117 252 324 44.44 36.11 162 0 168 140 96.43 0.00 129 3 140 182 92.14 1.65 97 5 198 216 48.99 2.31 178 0 182 140 97.80 0.00 152 0 154 154 98.70 0.00 83 2 180 270 46.11 0.74
Mk rn3 intragenic CpG Island # mCpGs Total % meth. M P M P M P 133 120 170 187 78.24 64.17 146 121 187 170 78.07 71.18 189 255 74.12 128 127 170 187 75.29 67.91 175 238 73.53 0 0 170 204 0.00 0.00 0 0 221 204 0.00 0.00 188 221 85.07 142 116 170 170 83.53 68.24 116 129 170 187 68.24 68.98 109 146 170 221 64.12 66.06 125 104 204 170 61.27 61.18 117 121 187 204 62.57 59.31 117 107 187 170 62.57 62.94
Figure 2-12: Quantitation of DNA methylation observed within Mkrn3 and Snrpn throughout development. # mCpG = number of methylated CpGs observed in all clones. Total = total number of CpGs analyzed in all clones. % meth = percentage of methylated CpGs out of the total number of CpGs analyzed. M = maternal allele, P = paternal allele. Dashes indicate cells / tissues which were not analyzed. E10.5 primordial germ cells, primitive type A spermatogonia, and vas deferens sperm did not contain a polymorphism to distinguish the maternal and paternal alleles. may represent the distinction between establishment of DNA methylation imprints in an imprinted gene promoter versus an imprinting control region. Indeed, the H19-Igf2 ICR also acquires de novo methylation during spermatogenesis in an allele-specific pattern similar to that observed for Snrpn and not Mkrn3 (Davis et al., 2000). Nevertheless, our data propose that the preservation of a genomic imprint other than DNA methylation which results in the non-equivalence of parental alleles during gametogenesis is not unique to differentially methylated regions within ICRs. The DNA methylation imprints established during gametogenesis within the 5’ CpG island of Mkrn3 are maintained throughout embryonic development and resist the waves of demethylation and remethylation that occur in the pre- and post-implantation embryo, however the protection of the DNA methylation imprint observed in this study may not apply to all imprinted genes in the cluster. An analysis of approximately 40 CpGs within the 5’ CpG-rich region of Necdin, another paternally-expressed gene in the
49 PWS/AS gene cluster located between Snrpn and Mkrn3, found that DNA methylation may only play a key role in imprint establishment (Hanel and Wevrick, 2001). Interestingly, the patterns of CpG methylation observed in oocytes and sperm were not maintained during development and into adult tissue, suggesting that additional epigenetic modifications within the Necdin gene may play a role in the maintenance of imprinted gene expression. Developmental timing of the maternal-specific DNA methylation imprint The first observation of the timing of the DNA methylation imprint erasure and re-establishment within the Snrpn 5’ CpG island was determined using a methyl-sensitive restriction enzyme / PCR-based assay (Shemer et al., 1997). The analysis showed that erasure of the DNA methylation imprint was complete at E12.5 in both male and female germ cells, and re-establishment occurred gradually in female germ cells from E15.5 to 21.5 dpc (Shemer et al., 1997). Although this study provided some evidence for the timing of the imprint switch, it was limited by the examination of only a minimal number of CpGs within the 5’ CpG island and did not distinguish the maternally- and paternallyinherited alleles. In contrast, more recent studies utilizing sodium bisulfite genomic sequencing and allele-specific single nucleotide polymorphisms indicate that the reestablishment of the maternal DNA methylation imprint within the 5’ CpG island of Snrpn does not occur until post-natal oogenesis, beginning at 10dpp, and that de novo methylation was directly related to a larger oocyte diameter (Lucifero et al., 2004). Our data seem to agree with the earlier study and show that the DNA methylation imprint was established during embryonic oogenesis. We first addressed the possibility that the maternal DNA methylation we observed during female germ cell development may be a result of somatic cell contamination in our enriched population of cells,
50 although a positive result would not account for the methylation we observed in later stages on the paternal allele. For this control, we utilized a previous strategy from the H19 DMR, which has been shown to be almost completely unmethylated in female germ cells by E14.5 (Davis et al., 2000). We optimized sodium bisulfite genomic sequencing primers designed to flank the region spanning 1304-1726 (U19619) analyzed by (Davis et al., 2000; Mann et al., 2004) for amplification in a single round of PCR in order to avoid potential amplification bias in nested PCR. The analysis was completed in female germ cells isolated at both E18.5 and 21.5 dpc, when the levels of methylation were the highest observed in this study for Snrpn and Mkrn3. In E18.5 female germ cells, all 22 clones analyzed were completely unmethylated (Figure 2-13A). The majority of clones from
A
H19: E18.5 female germ cells
B H19: 21.5 dpc female germ cells
Figure 2-13: Female germ cells isolated at E18.5 and 21.5dpc were hypomethylated at the H19-DMR, indicating that the cell preparations contain low levels of somatic cell contamination. All symbols are as described in Figure 2-1. 21.5 dpc female germ cells (27 of 29) were completely unmethylated with 2 additional clones containing 2 or 5 methylated CpGs (Figure 2-13B). These data from the H19 DMR indicate that our cell preparations from E18.5 and 21.5 dpc are highly enriched for female germ cells at these stages, and the re-establishment of the maternal-specific DNA
51 methylation imprint we observed in the 5’ CpG island of Mkrn3 and Snrpn is unlikely the result of somatic cell contamination. Another potential reason for the timing discrepancy observed in previous publications may be a result of the dissimilar maternal mouse strains used in each experiment. A growing body of evidence suggests that the genotype of the mother, via modifiers in the egg cytoplasm or some other mechanism, can influence the epigenotype of the offspring. The reciprocal matings of a wild-type mouse (C57BL/6) and a mouse congenic for a region spanning only two specific genetic loci on chromosome 7 from a closely related strain (BALB/c congenic on a C57BL/6 background) have resulted in observable differences in growth rate depending on the maternal genotype (Lutz et al., 1989). Moreover, significant differences in the phenotype and viability of a mouse model for PWS have been observed which are dependent on the genetic background of the normal mothers used for breeding the F1 generation (Chamberlain et al., 2004; Yang et al., 1998). Both our matings and the matings employed by Shemer, et al. (Shemer et al., 1997) utilized C57BL/6 (M.m.musculus) as the mother, or the maternal allele donor, and different species for the paternal allele donor, either M.m.castaneus or M.spretus, respectively. The more recent Snrpn data from Lucifero, et al. (Lucifero et al., 2004) used reciprocal crosses of a consomic strain, C57BL/6J (Cast-7), and an outbred strain, CD-1. Although this consomic mouse is only homozygous for M.m.castaneus on chromosome 7 in a C57BL/6 (M.m.musculus) background (Mann et al., 2003), a number of imprinted genes in addition to those found in the PWS/AS gene cluster are located on this chromosome. Kono, et al. recently showed that appropriate modulation of H19 and
52 Igf2 expression, two imprinted genes also found on mouse chromosome 7, can circumvent the normal requirement for both parents and create a viable offspring from two maternally-derived genomes (Kono et al., 2004). Since genetic and epigenetic differences exist among mouse strains and the modulation of only two genes on chromosome 7 can have such a profound effect on genomic imprinting, it is conceivable that the use of a consomic mother which specifically contains two chromosome 7s derived from an alternate sub-species of mouse may result in an dissimilar oocyte environment as compared to that of a wild-type C57BL/6 mother. Therefore, the use of M.m.musculus as the mother and maternal allele donor of the F1 mice used in our analysis as opposed to the C57BL/6J(Cast-7) consomic or a genetically uncharacterized outbred strain, CD-1, may be a plausible explanation for the difference in the timing of maternal DNA methylation imprint establishment observed. Although our analysis does not directly address the possibility that a second wave of demethylation and remethylation occurs post-natally in female germ cells, no clear evidence for this has been reported in the literature. Additionally, reciprocal matings utilizing the B6.CastC7 congenic mouse as the maternal allele donor in our experiments exhibited no significant difference in the level of DNA methylation observed in somatic tissue for Mkrn3 or Snrpn (data not shown). Intriguingly, conflicting data in humans indicates that the maternal DNA methylation imprint may be established either post-zygotically or during oogenesis by the germinal vesicle oocyte stage (El-Maarri et al., 2001; Geuns et al., 2003; Kantor et al., 2004a). This dissimilarity in the timing of imprint establishment may also be a result of polymorphic, maternal genetic or epigenetic factors among an outbred species.
53 Intragenic DNA methylation may modulate Mkrn3 expression in a tissue- or developmental-specific manner The intragenic CpG island exhibits no differential DNA methylation in any developmental stage analyzed, suggesting that this region does not act as the genomic imprint. The complete loss of biallelic DNA methylation observed in this region in pachytene spermatocytes and round spermatids is concurrent with an increase in Mkrn3 expression compared to other tissues (Jong et al., 1999a). Evidence that demethylation serves to potentiate the expression of testis-specific genes such as transition protein 1, phosophoglycerate kinase-2, apolipoprotein A1, and Oct-3/4 suggests that demethylation of the intragenic CpG island of Mkrn3 may play a role in the testis-specific expression of Mkrn3 (Ariel et al., 1994; Trasler et al., 1990). Interestingly, the intragenic CpG island of Mkrn3 contains seven repeats of a hexanucleotide sequence (Jong et al., 1999a). A variety of repeat sequences have been identified in a number of imprinted loci, although the evolutionary and functional significance of these regions is not fully understood. Furthermore, the intragenic CpG island of Mkrn3 is located within the 3’ end of an antisense transcript, Mkrn3as. Unlike antisense transcription of other imprinted genes such as Igf2r, which is specific to the normally silenced allele, Mkrn3as is imprinted and expressed at low levels from the same paternally-inherited allele as Mkrn3. Thus, the loss of methylation in the intragenic CpG island of Mkrn3 along with the presence of repeat sequences and the paternal-specific expression of an antisense transcript through the region may all potentially play some role in the modulation of tissue-specific Mkrn3 expression.
54 DNase I hypersensitive sites identify cis-acting elements which may regulate transcription and act as a chromatin boundary Strikingly, the 5’ and intragenic CpG islands of Mkrn3 are separated by a mere 235 bp, and the two specific regions within the CpG islands that we have analyzed are only 563 bp apart. As a continuation of this study, we examined the sensitivity of Mkrn3 to DNase I and have identified two paternal allele-specific hypersensitive sites. HS1 approximately maps in the 5’ region of Mkrn3, and is consistent with an open, accessible chromatin structure and the binding of transcription factors to the paternal expressed allele. The localization of the second paternal-specific hypersensitive site, HS2, near the region between the 5’ and intragenic CpG islands of Mkrn3 suggests that cis-acting regulatory elements in this region could potentially function as a chromatin boundary. A boundary element may help to allow the two CpG islands to maintain dissimilar patterns of CpG methylation in somatic tissue and throughout development. We have begun to further characterize the cis- and trans-acting factors within these two localized regions of DNase I hypersensitivity, and data from these studies will be presented in the next chapter.
CHAPTER 3 CIS- AND TRANS-ACTING REGULATORY ELEMENTS OF THE IMPRINTED MKRN3 GENE Introduction In the previous chapter, two novel CpG islands within the imprinted Mkrn3 gene were identified. Although these two CpG rich regions are physically located only 235 bp apart, the pattern of DNA methylation within these regions in somatic tissue as well as throughout development is highly divergent. Our subsequent identification of two paternal-specific hypersensitive sites may suggest some insight into how the DNA methylation patterns within each CpG island of Mkrn3 are maintained. This chapter will examine additional epigenetic marks and potential regulatory elements within the promoter region of Mkrn3, near the 5’ hypersensitive site, HS1, as well as throughout the Mkrn3 locus using ligation-mediated PCR (LM-PCR) in vivo footprinting and chromatin immunoprecipitation analysis, respectively. Results Identification of putative factor binding using transcription factor databases We previously identified two hypersensitive sites within Mkrn3 that were specific to the paternally-inherited allele. Because regions which are hypersensitive to nucleases may be indicative of chromatin that is free of canonical histones and may be formed by transcription / regulatory factor binding, we first determined what potential factors may be bound in the two regions of hypersensitivity using TESS (Transcription Element Search System - http://www.cbil.upenn.edu/tess/). This web-based program utilizes the
55
56 TRANSFAC v4.0 database and others to identify binding sites using site or consensus strings and positional weight matrices. We examined 3 kb of Mkrn3 (from -1000 to +2000, relative to the transcription initiation site) using the default parameters with the exception of adjusting the string scoring parameter, “Maximum Allowable String Mismatch % (tmm)” from 10% to 20% (which reduces the requirement for the strength of the match between our sequence and the string model). Multiple factor binding sites were identified in the region analyzed, particularly in the 5’ promoter region of Mkrn3. These results provided information about DNA sequences that may potentially interact with transcription factors and allowed us to narrow the regions important for further analysis. We next performed ligation-mediated PCR in vivo footprinting, in order to identify specific regions of protein-DNA interaction in vivo. In vivo footprinting of the Mkrn3 promoter region Dimethyl sulfate in vivo footprinting was used to perform high resolution identification of cis-acting elements in the 5’ flanking region of Mkrn3 where HS1 is approximately located. We utilized the immortalized mouse fibroblasts described in the previous chapter (TgPWSdel and TgASdel) (Gabriel et al., 1999) to examine intimate contacts between protein and guanine residues on the maternally- and paternally-inherited allele, respectively. A schematic representation of the fundamentals of in vivo footprinting is shown in Figure 3-1. Analyses using the in vivo footprinting technique analysis are based on the chemical cleavage or enzymatic modification of genomic DNA within intact cells, where DNA sequence bound by a protein or proteins is protected from these modifications. Each treatment of intact cells is compared to the pattern of modification / cleavage of purified genomic DNA that has been isolated and cleared of all protein factors (naked
57 DNA). Dimethyl sulfate (DMS) is one chemical utilized for in vivo footprint analyses, which primarily methylates guanine residues through the major groove of DNA at
Naked DNA
DMS
G G
In vivo
G G
GG G G
GG G G
DMS
Piperidine Cleavage Primer
Ligation-Mediated PCR (LMPCR) Naked In vivo DNA
Figure 3-1: Fundamentals of in vivo footprinting. Naked DNA or intact cells are exposed to DMS which methylated guanine residues. Within cells, intimate contact of DNA binding factors with guanine nucleotides prevents methylation while nucleotides in proximity to hydrophobic pockets in the protein are modified at higher frequency. After DMS treatment, exposure to a mild base cleaves the DNA at the modified guanine residues generating a collection of nested fragments that end at each of the modified nucleotides. The fragments ending at protected nucleotides will be underrepresented in the in vivo DMS-treated sample compared to the DMS-treated naked DNA. The fragments ending at nucleotides modified at higher frequency will be overrepresented. Following LMPCR amplification, this pattern can be observed on a sequencing gel as bands missing or of reduced intensity (protected nucleotides) and band of enhanced intensity (nucleotides with enhanced reactivity to DMS). position N7 (although adenine residues are also modified to a lesser degree). DMS is a small hydrophobic chemical that may easily diffuse into intact cells and modify DNA. After purification of genomic DNA from cells exposed to DMS for different time periods, treatment with a mild base results in cleavage of the DNA at methylated
58 guanines. The region of interest is then amplified using ligation-mediated PCR (LMPCR). The nature of modification by DMS allows for an analysis of intimate contacts between guanine residues and the protein factors bound to them, and thus it is possible that factors which do not bind guanine in DNA may not be identified using this technique. However, guanines near sites of factor binding may exhibit an enhanced reactivity to DMS if hydrophobic pockets are formed by the neighboring protein factors. These pockets may accumulate DMS, resulting in an increased modification of nearby guanines. Figure 3-2 illustrates the position of potential transcription factor binding sites as well as the relative positions of LM-PCR primers and the extent of the sequence analyzed with each. Several strong paternal allele-specific footprints were identified on the upper strand at positions -74/3, -45, -28 and -12/-11/-10, indicating protection from DMS Mkrn3 1U
Mkrn3 1Lb Mkrn3 1L
YY1 consensus SP1 consensus NRF-2 consensus
Figure 3-2: Schematic representation of the Mkrn3 5’ region analyzed by in vivo footprinting. The bent arrow indicates the position of the transcription initiation site. Also indicated are potential transcription factors binding sites (colored boxes). The horizontal arrows specify the position of the overlapping primer sets used in the LM-PCR and the extent of the sequence analyzed with each one. Primer sets above the diagram assayed the upper strand and primer sets below the diagram assayed the lower strand. Circles above and below the diagram indicate upper and lower strand in vivo footprints, respectively.
59
120
60 90
Paternal
120 0
60 90
0
Maternal
-86 -74/3 -60
-45
-28 -23 -15, -14 -12 to -10
Figure 3-3: DMS in vivo footprint analysis of the 5’ region of Mkrn3. Shown is a representative gel using the upper strand primer Mkrn3 1U. Maternal and paternal alleles were analyzed in TgPWSdel and TgASdel immortalized mouse fibroblasts, respectively. Cells were treated with DMS for 60, 90, or 120 seconds. Time 0 indicates naked genomic DNA treated with DMS. In vivo footprinted sites on the paternal allele are indicated on the right of the sequencing gel with closed or open circles that represent the protection or enhanced reactivity, respectively, of guanine residues in vivo. The numbers on the left indicate position with respect to the transcription initiation site which is indicated by a bent arrow. No consistent maternal footprints were observed. modification at these residues as compared to naked DNA (Figure 3-3). Enhanced reactivity on the paternally-inherited allele was observed at position -86, -23, and -14. Analysis of the lower strand in the same region identified additional protections at -41, 65, -79, and -104/5 (Figure 3-4). No clear maternal allele-specific footprints were observed on either the upper or lower strand. Comparison of the observed footprints with the previous sequence analysis suggested that the footprints observed on the upper strand
60
B)
-62/3 -65
-75/6
-51
90
120
C) Maternal
Paternal
0 60 90 120 0 60 90 120
-41
0
-32/1
Paternal 0
Maternal 120
Paternal
0 60 90 120 0 60 90 120
Maternal
90
A)
-105/4
-79
Figure 3-4: DMS in vivo footprint analysis of the 5’ region of Mkrn3. Shown are representative gels using the lower strand primer Mkrn3 1L (A) and Mkrn3 1Lb (B and C). Maternal and paternal alleles were analyzed in TgPWSdel and TgASdel immortalized mouse fibroblasts, respectively. Cells were treated with DMS for 60, 90, or 120 seconds. Time 0 indicates naked genomic DNA treated with DMS. In vivo footprinted sites on the paternal allele are indicated on the right of the sequencing gel with closed circles that represent the protection of guanine residues in vivo. The numbers on the left indicate position with respect to the transcription initiation site. at positions -74/3, -45, -28, -23, and -12/-11/-10 as well as lower strand footprints at positions -79 and -104/5 all correspond to potential nuclear respiratory factor 2 (GAbinding protein transcription factor) binding sites. As the name implies, NRF2 (Gabp) is a GA-binding protein transcription factor composed of multiple subunits, including the DNA binding subunit Gabpa (Watanabe et al., 1993). NRF2 contributes to the transcriptional regulation of a number of mitochondrial enzyme subunits, including cytochrome c oxidase (CO) and mitochondrial transcription factor A (TFAM) (OMIM 600609). This observation is significant in light of evidence from out lab implicating another nuclear respiratory factor, NRF1, as a potential regulatory element present in vivo within the human imprinting center
61 (Rodriguez-Jato, et al., manuscript submitted). NRF1 and NRF2 have similar hydrophobic structural motifs for activating transcription and have been implicated in the control of nuclear genes required for respiration, heme biosynthesis, and mitochondrial DNA transcription and replication (Gugneja et al., 1996; Scarpulla, 2002b). Binding sites for both NRF1 and NRF2 have been identified in a number of NRF2-dependent genes, although this is not obligatory (reviewed in Scarpulla, 2002a). Although NRF1 and NRF2 have not been shown to directly interact, NRF1 and NRF2 may associate indirectly via interactions between host cell factor (HCF – which directly interacts with NRF2) and PGC-1 family members (which directly interact with NRF1 and contain a proposed HCF binding motif). A molecular complex linking these components has not yet been identified. Although no potential NRF1 binding site has been identified in the 5’ region of Mkrn3, it is interesting that the remaining footprints observed at positions -86 on the upper strand and -65 on the lower strand correspond to potential binding sites for YY1 and SP1, respectively. These ubiquitous transcription factors with multiple regulatory functions that have also been associated with genes required for nuclear respiration and mitochondrial biogenesis (Scarpulla, 2002a). Binding sites for SP1 are found in the majority of characterized respiratory protein genes and may act as either a positive or negative regulator of transcription. YY1 also may exert positive or negative effects on transcription, and disruption of YY1 in ES cells results in peri-natal lethality. Additionally, YY1 and NRF1 are clearly associated in vivo with the PWS/AS imprinting center, as well as at other genes within the cluster (Rodriguez-Jato, et al., manuscript submitted).
62 Footprints at -14 (upper strand) and -41 (lower strand) do not correspond to any known sites for factor binding, however they may be a result of their proximity to potential NRF2 binding sites. This is particularly significant for the enhancement observed at position -14 on the upper strand, as enhancements are often found near the periphery of factor binding sites where hydrophobic pockets may form. Confirmation of factor binding by in vivo chromatin immunoprecipitation analysis Although the footprints observed in potential NRF2, SP1, and YY1 binding sites were compelling, we next sought to confirm these interactions using chromatin immunoprecipitation assays (ChIP). This technique utilizes antibodies for the detection of specific factors bound within a particular region of DNA in vivo, and the sensitivity of detection is in part a function of the quality of antibodies chosen for the analysis. Initially, intact cells are subjected to a reversible crosslinking reagent which temporarily fixes DNA-protein and protein-protein interactions occurring within individual cells at that time. Chromatin is then isolated and sheared to an appropriate size for analysis of specific regions of DNA. In the following experiments, the chromatin was sonicated to an average size of 300 bp which ranged to greater than 500 bp. Therefore, some of the DNA fragments immunoprecipitated with an antibody for a given factor binding to a specific DNA sequence may include significant portions of neighboring DNA that is not associated with that factor. In these cases, PCR-amplification of the immunoprecipitated DNA with primers specific for the neighboring sequence would yield a positive result even though the factor of interest is not associated with that region and the actual sequence bound is hundreds of base pairs away. Immuoprecipitation using antibodies for specific transcription factors and histone proteins is followed by the reversal of crosslinking in the bound fraction. Importantly,
63 the antibodies utilized at this step may be highly specific to distinct post-translational modifications of the protein of interest, which is particularly significant in the study of histone modifications using this technique (discussed below). After purification, the immunoprecipitated DNA is the amplified and quantitated using real-time PCR, and normalized to an input DNA control (detailed methods are discussed in Chapter 5). A reaction containing no antibody is also mock immunoprecipitated to control for any nonspecific precipitation of DNA in the region of interest. TgPWSdel and TgASdel immortalized mouse fibroblasts were crosslinked and
70
Percent of input
60 50 40 30 20 10 0
MP
m- p-
MP
m- p-
Upstream
Promoter
-1091 to -997
-105 to -5
MP
m- p-
HS2 +498 to +594
MP
m- p-
MP
m- p-
Body
Downstream
+1526 to +1619
+4.5kb
Figure 3-5: ChIP analysis of NRF2 within the Mkrn3 gene and flanking regions. Maternal and paternal alleles were analyzed separately in TgPWSdel and TgASdel mouse fibroblasts, respectively. Immunoprecipitation using an antibody specific for NRF2 (Gabpa, Santa Cruz Biotechnology) was repeated twice and a minimum of two real-time PCR reactions per immunoprecipitation were performed. The average of all experiments for each cell line and each primer set utilized are shown, with standard deviations across experiments depicted in the error bars. M and P represent the results for the maternal and paternal alleles, respectively. m- and p- represent results of the no antibody controls for each cell line. Detailed methods are described in chapter 5.
64 immunoprecipitated with antibodies for NRF2, SP1, and YY1. Five regions located upstream (-1091 to -997), in the Mkrn3 promoter (-105 to -5), in the region corresponding to the second hypersensitive site (HS2) between the two previously identified CpG islands (+498 to +594), in the body of the Mkrn3 gene (+1526 to +1619), and >4 kb downstream of Mkrn3 were analyzed for their in vivo interaction with these factors. NRF2 was highly enriched on the paternally-inherited allele in the promoter region of Mkrn3 (Figure 3-5). Levels of NRF2 in this region averaged 50% of input on the paternally-inherited allele as compared to < 3% of input on the same allele in adjacent regions. These results confirm our earlier in vivo footprinting results and indicate that NRF2 is bound in the Mkrn3 promoter. Because data from our lab suggests that factors 2
Percent of input
1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0
M P
M P
M P
Snurf-snrpn
Necdin
Magel2
m- p-
Figure 3-6: Analysis of NRF2 binding at additional genes within the PWS / AS cluster. Putative binding sites for NRF2 were identified and analyzed using ChIP and real-time PCR analysis. A minimum of two real-time PCR reactions per immunoprecipitation were performed in each region. The average of all experiments for each cell line and each primer set utilized are shown, with standard deviations across experiments depicted in the error bars. Symbols and abbreviations are as described in Figure 3-5. common to the regulation of genes important for nuclear respiration were also found in the 5’ region of Snrpn (within the imprinting center), we investigated whether NRF2 was also bound at Snrpn, Necdin, or Magel2. An initial transcription factor database search
65
Percent of input
A)
4 3.5 3 2.5 2 1.5 1 0.5 0
MP m- p-
M P m- p-
Upstream
Promoter
-1091 to -997
-105 to -5
M P m- p-
M P m- p-
M P m- p-
HS2
Body
Downstream
+498 to +594
+1526 to +1619
+4.5kb
B)
Percent of input
2.50 2.00 1.50 1.00 0.50 0.00
M P
m-
Promoter -105 to -5
p-
M P
m- p-
HS2 +498 to +594
M P
m-
p-
Body +1526 to +1619
Figure 3-7: Allele-specific in vivo interaction of Sp1 and YY1 with the Mkrn3 promoter region. Maternal and paternal alleles were analyzed separately, and immunoprecipitations using an antibody specific for A) SP1 and B) YY1 were repeated twice and a minimum of two real-time PCR reactions per immunoprecipitation were performed. The average of all experiments for each cell line and each primer set utilized are shown, with standard deviations across experiments depicted in the error bars. Symbols and abbreviations are as described in Figure 3-5.
66 suggested one or more NRF2 binding sites may be located in the 5’ flanking regions of each of these genes, however no NRF2 was observed using ChIP (Figure 3-6). Chromatin immunoprecipitations with antibodies specific for SP1 and YY1 were also performed, and each of these factors showed enrichment on the paternally-inherited allele of the Mkrn3 promoter region (Figure 3-7). These results are consistent with the paternal-specific in vivo footprints observed in the 5’ region of Mkrn3 at YY1 and SP1 binding sites. Allele-specific analysis of histone modifications throughout the Mkrn3 locus We have postulated that the paternal-specific hypersensitive site located between the two previously identified CpG islands of Mkrn3 could be indicative of a chromatin boundary which may act by preventing the spread of DNA methylation into the promoter. In order to determine if this boundary distinguishes other paternal-specific epigenetic marks in the region, we performed ChIP using antibodies specific to histone modifications, including acetylation of lysine 9 on histone H3 (H3K9 Ac), demethylation of lysine 4 on histone H3 (H3K4 diMe), and general acetylation of histone H4 (H4 Ac). Each of these marks is specific for active or potentiated regions of transcription (Grant and Berger, 1999; Schotta et al., 2004). The levels of histones containing H3K9 acetylation and dimethyl H3K4 were higher on the paternally-inherited allele compared to the maternally-inherited allele throughout the locus, with particular enrichment observed at the intragenic hypersensitive site (Figure 3-8A and B, respectively). Although the levels of dimethyl H3K4 were considerably lower on the paternal allele in the promoter of Mkrn3, recent evidence suggests that tri-methylation of H3K4 is enriched in actively transcribed promoters, whereas di-methylation of H3K4 is found elsewhere in the vicinity of active genes (Bernstein et al., 2005). Our analysis of H4 acetylation in this
67
A)
16
Percent of input
14 12 10 8 6 4 2 0
B)
MP
m - p-
- -
MP m p
- -
MP m p
- -
MP m p
- MP m p
Upstream
Promoter
HS2
Body
Downstream
-1091 to -997
-105 to -5
+498 to +594
+1526 to +1619
+4.5kb
m - p-
MPm p
Percent of input
60 50 40 30 20 10 0
MP
- -
- -
MP m p
- -
MP m p
- MP m p
Upstream
Promoter
HS2
Body
Downstream
-1091 to -997
-105 to -5
+498 to +594
+1526 to +1619
+4.5kb
m - p-
MPm p
35
Percent of input
C)
30 25 20 15 10 5 0
MP
- -
- -
MP m p
- -
MP m p
- MP m p
Upstream
Promoter
HS2
Body
Downstream
-1091 to -997
-105 to -5
+498 to +594
+1526 to +1619
+4.5kb
Figure 3-8: Differential histone modifications within the Mkrn3 locus. Maternal and paternal alleles were analyzed separately, and immunoprecipitations were repeated twice and a minimum of two real-time PCR reactions per immunoprecipitation were performed. The average of all experiments for each cell line and each primer set utilized are shown, with standard deviations across experiments depicted in the error bars. A) H3K9 Ac B) H3K4 diMe C) H4 Ac. Symbols and abbreviations are as described in Figure 3-5.
68 region showed a marked paternal-specific enrichment upstream of Mkrn3 as well as in the promoter and intragenic HS regions (Figure 3-8C). No significant difference in H4 acetylation was observed in the body of Mkrn3 or in a region greater than 4 kb downstream. Discussion In the preceeding work, we have identified potential allele-specific factor binding sites within the Mkrn3 proximal promoter and confirmed DNA-protein interactions in many of these regions by ligation mediated-PCR in vivo footprinting. The in vivo binding of specific factors was verified using chromatin immunoprecipitation analysis. The 5’ region of Mkrn3 is bound by NRF2, SP1, and YY1, which may implicate this gene as functional component of the nuclear respiration pathway or as a regulatory element of mitochondrial DNA transcription. Although Mkrn3 contains a zinc-finger motif which may indicate a potential role as a DNA-binding regulatory element, no current evidence suggests how Mkrn3 may be important in nuclear respiration or mitochondrial DNA transcription and replication. One hypothesis is that the common regulation of PWS / AS associated genes and genes important for metabolism may yield some insight into the phenotype of Prader-Willi syndrome patients, however this link requires more detailed study into the function of individual genes within the PWS / AS imprinted domain. Although the knockout of Mkrn3 has no discernable phenotype, neurobehavioral defects are difficult to assess in mice and / or the specific function of Mkrn3 may be redundant in the genome. We have also determined that histone modifications specific to potentiated or actively transcribed chromatin are enriched on the paternally-inherited allele using ChIP. The analysis of allele-specific regulatory elements and differential histone modifications
69 within the Mkrn3 gene may lend further understanding to the regulation of Mkrn3 expression. In combination with other data from our lab examining the imprinting center, these studies may also yield some insight into how imprinted gene expression is controlled throughout the region. A model for the coordinated regulation of imprinted genes within the PWS / AS imprinted domain is discussed further in chapter 5.
CHAPTER 4 MATERIALS AND METHODS Mating Strategy for Mkrn3 and Snrpn DNA Methylation Analysis Cells and tissues analyzed for DNA methylation were isolated from mice produced by mating C57BL/6 females (M.m.musculus) with B6.CastC7 congenic males. The B6.CastC7 congenic contains M.m.castaneus sequences spanning the entire PWS/AS syntenic region on a M.m.musculus genomic background (Wakeland et al., 1997). Single nucleotide sub-species-specific polymorphisms were identified in each of the genes analyzed for utilization in subsequent analyses. Mkrn3 contains a T/G (M.m.musculus / M.m.castaneus) polymorphism at position -278 and an A/G expressed polymorphism at position +742, both relative to the transcription initiation site. Snrpn also contains polymorphisms between M.m.musculus and M.m.castaneus at positions -105 (G/T), +324/5 (CG/AA), and +604 (C/T) relative to the transcription initiation site. Genomic DNA Isolation and Preparation E2.5 morula and E3.5 blastocyst stage mouse embryos were isolated from superovulated females (Hogan, 1994). Male germ cells from E13.5, pachytene spermatocytes, round spermatids, 6dpp primitive type A spermatogonia and vas deferens sperm as well as female germ cells from E13.5, E15.5, E18.5, 21.5dpp, were isolated as described (Bellve et al., 1977; Kafri et al., 1992; McCarrey et al., 1992; McCarrey et al., 1987; Romrell et al., 1976). E9.5 and E12.5 embryos were produced from natural matings. Genomic DNA from the majority of samples was purified by standard phenol extractions and ethanol precipitation (Strauss, 2000). To reduce the loss of genomic
70
71 DNA in samples which contained a limited number of cells, including germ cells collected at E13.5, E15.5, E18.5 and 21.5 dpc as well as E2.5 morula and E3.5 blastocysts, a lysis buffer consisting of 1mM SDS, 0.28 mg proteinase K, and 2 μg of tRNA was added and the samples were stored at -80oC until sodium bisulfite treatment. Sodium bisulfite-treated genomic DNA from primordial germ cells isolated at E10.5 was generously provided by D. Maatouk and J. Resnick. High-Resolution Sodium Bisulfite Genomic Sequencing DNA methylation analyses were performed essentially as described by Clark, et al. (Clark et al., 1994; Kang et al., 2003). Briefly, five micrograms of genomic DNA were sheared by vortexing and denatured in 0.3 M NaOH at 37oC for 30 minutes. Alternatively, samples stored in lysis buffer at -80oC were initially lysed at 55oC for 2 hours, heat inactivated for 10 minutes at 95oC, and then denatured in 0.3 M NaOH at 37oC for 30 minutes. A solution of sodium bisulfite and hydroquinone, pH 5.0, was added to the denatured DNA to a final concentration of 1.55 M sodium bisulfite and 0.5 mM hydroquinone. The samples were repeatedly cycled in a PTC-100 Programable Thermal Controller (MJ Research, Inc.) at 55oC for 30 minutes and 95oC for 30 seconds for 20 hours in the dark. Free bisulfite ion was removed using the Wizard DNA CleanUp kit (Promega), desulphonated in 0.3 M NaOH for 15 minutes at 37oC, and ethanol precipitates were resuspended in 50-100μL of ddH2O. Ten to fifty percent of the recovered bisulfite-treated sample was subjected to PCR using HotStarTaq™ Polymerase in the provided buffer (Qiagen) under the following conditions: 94oC for 15 minutes, followed by 35 cycles of 94ºC for 45 seconds, 51ºC for 30 seconds, 72ºC for 90 seconds, and a final extension at 72ºC for 10 minutes. PCR products were gel-purified using
72 Qiagen’s QIAquick kit, ligated into the TA cloning vector pCR2.1 or pCR2.1-TOPO (Invitrogen), and transformed into competent bacterial cells. Plasmids from individual colonies were isolated using the QIAprep Miniprep Kit (Qiagen) and subjected to automated sequencing using a M13 reverse primer specific to the TA vector and the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit with AmpliTaq DNA Polymerase. Clones were chosen for sequencing from multiple treatments / PCR reactions to control for PCR or cloning biases. In addition, to ensure minimal allele bias in the PCR amplification step which may yield inaccurate or skewed results after sequencing, each sample was ligated after a single amplification by PCR, i.e. no nested primers were used for a secondary amplification step. Table 4-1: PCR primers utilized for DNA methylation analysis after sodium bisulfite conversion of DNA. All primers are shown in a 5’ to 3’ orientation.
Mkrn3 -336 to +145 AAGTAGTAGAYGGTAAAGGTAATGTGTGTA reverse: ACCTCAATAAAAACTATAAACTCTTCCAT +708 to +1189 forward: AGATTGATAATGTAAGTTTTGTAGTAGGTG reverse: AACTTTCTCATAAACCACCTCCAT forward:
Snrpn -175 to +188 GTAGTAGGAATGTTCAAGCATTCCTTTTGG reverse: CCAATTCTCAAAAATAAAAATATCTAAATT +160 to +534 forward: AATTTAGATATTTTTATTTTTGAGAATTGG reverse: TCTACAAATCCCTACAACAACAACA +499 to +899 forward: TTGTTGTTGTTGTAGGGATTTGTAGA reverse: AACACACAAACCATAACAACCAAAC forward:
73 Analysis of DNA Methylation Data All sequences obtained from individual clones were first compared to the genomic sequence, and conversion of every cytosine which is not part of a CpG dinucleotide was confirmed to verify complete conversion of the genomic DNA. The parental source of individual clones was determined by sub-species-specific single nucleotide polymorphisms between M.m.musculus (maternally-inherited) and M.m.castaneus (paternally-inherited) within the regions of Mkrn3 and Snrpn analyzed. Each individual cytosine within a CpG dinucleotide was then determined to be either a T (unmethylated) or C (methylated). A minimum of 10 clones was analyzed for each parental allele at each developmental stage of embryogenesis and gametogenesis, and the percentage of methylated CpGs out of the total number of CpGs analyzed in all clones for a specific allele and stage was determined (with the exception of E10.5 germ cells, 6dpp primitive type A spermatogonia, and vas deferens sperm in which the maternally- and paternallyinherited alleles could not be distinguished). DNase I Hypersensitivity Analysis Analysis of DNase I hypersensitivity was essentially performed as described in (Kang et al., 2003). Briefly, approximately 3 – 4 x 107 TgPWS del or TgAS del immortalized mouse fibroblast cells (Gabriel et al., 1999) were washed with phosphate buffered saline, trypsinized, and collected by centrifugation. The cells were washed once with solution A (150mM sucrose, 80mM KCl, 35mM HEPES (pH 7.4), 5mM K2HPO4, 5mM MgCl2, 0.5mM CaCl2), once with solution B (150mM sucrose, 80mM KCl, 35mM HEPES (pH 7.4), 5mM K2HPO4, 5mM MgCl2, 2mM CaCl2), and resuspended in 5 mLs of solution B containing 0.2% Nonident P40 (NP40). Cells were then divided equally into five aliquots and an additional 1 mL of solution B / 0.2% NP40 containing 20, 40, 60, 80, or 100
74 μg/mL of DNase I (Worthington) was added at 37oC. After a two minute incubation, the reaction was stopped by addition of lysis buffer (50mM Tris-HCl pH 8.0, 150 mM NaCl, 25 mM EDTA, 0.5% SDS and 300 µg/ml proteinase K). Immortalized fibroblast cells were then lysed overnight at room temperature and genomic DNA was purified by standard phenol extraction and ethanol precipitation (Strauss, 2000). Approximately 20 to 30 μg of genomic and DNase I treated DNA was digested with Eco RI, Southern blotted, and probed with an α-32P-dCTP radiolabeled, 667bp Eco RI / Bgl II fragment located approximately 3.7 kb upstream of the transcription initiation site. In vivo and in vitro DMS Treatment of Cells and DNA for in vivo Footprinting DMS treatment was performed as described by Hornstra and Yang (Hornstra and Yang, 1992). Briefly, approximately 2 X 107 TgPWS del or TgAS del immortalized mouse fibroblast cells (Gabriel et al., 1999) were washed with phosphate buffered saline, trypsinized, and collected by centrifugation. Intact cells were incubated at room temperature in 1ml of PBS containing 1% DMS for 60, 90 and 120 s. Cells were immediately washed with 50 ml of ice cold PBS three times and lysed overnight at room temperature in lysis buffer (described above). The lysate was sequentially extracted with equal volumes of phenol, phenol:chloroform (1:1) and chloroform, then treated with RNase (RNase cocktail by Amersham) and re-extracted with phenol:chloroform (1:1) and chloroform a second time. The genomic DNA was then ethanol precipitated, resuspended in 180 µl of double distilled water (ddH2O), and cleaved at the modified guanine residues in 10% piperidine at 95 °C for 30 minutes. Piperidine was eliminated by addition of 1 ml of double distilled water followed by drying in a vacuum concentrator
75 in the absence of heat two times. DNA was resuspended in 1x TE (pH 7.5) (10 mM TrisHCl (pH 7.5) and 1 mM EDTA (pH 8)) to a concentration of 1 mg/ml. For the treatment of naked genomic DNA with DMS, approximately 100 µg of DNA in 10 µl of ddH2O was incubated with 0.5 % DMS at room temperature for 45 sec. To reduce the viscosity of the DNA, the sample was vortexed for 2 sec after addition of the DMS. The reaction was immediately stopped by addition of 200 µl of DMS stop buffer (1.5 M NaOAc pH 5.0 and 1 M ß-mercaptoethanol) and the DNA was precipitated with 750 µl of 100% ethanol followed by a 20 minute incubation in a dry ice/ethanol mixture. The precipitated DNA was then washed in 75% ethanol and cleaved with piperidine as above. Ligation-Mediated PCR (LMPCR) LMPCR was essentially performed as described by Hornstra and Yang (Hornstra and Yang, 1992) with minor modifications and consists of extension using a gene specific primer (extension primer), ligation of a double stranded asymmetric oligonucleotide linker (LP1- 5’-gaattcagatc-3’ and LP2- 5’-gcggtgacccgggagatctgaattc-3’), and PCR amplification with a second gene specific primer (PCR primer) and a linker specific primer. Approximately 3 μg of DMS/piperidine-treated DNA was denatured at 95oC for 10 minutes and annealed to 0.6 pmols of extension primer at 47oC for 30 min. in a 15 µl of a solution containing 10 mM Tris-HCl (pH 8.9) and 40 mM NaCl. The subsequent primer extension was carried out by addition of 15 µl of a solution containing 10 mM Tris-HCl (pH 8.9), 40 mM NaCl, 0.5 mM each dNTPs and 2 units of the high fidelity Vent polymerase (New England Biolabs) and incubation at 53oC for 1 min., 55oC for 1 min., 57oC for 1 min., 60oC for 1 min., 62oC for 1 min., 66oC for 1
76 Table 4-2: PCR primers utilized for LM-PCR in vivo footprinting analysis. All primers are shown in a 5’ to 3’ orientation.
Upper Strand (1U) Extension primer CTTCAGCACCTGCCTCC LM-PCR primer GTGGGCCTCAATGGGAGCTGTAGACT
Lower Strand (1L) Extension primer ATCCCAGTGTCTCAAGCAG LM-PCR primer GAAACAGGCACGCGAAAAACATGGC
Lower Strand (1Lb) Extension primer ACCTGGAGAGTTTAAAACATCA LM-PCR primer TGAGGGGAAACACTGTGGAAACGGG min., 68oC for 3 min. and 76oC for 3 min. Twenty microliters of a dilution buffer (10 mM Tris-HCl (pH 7.5), 18 mM MgCl2, 50 mM dithiothreitol (DTT) and 0.0125% bovine serum albumin (BSA)) were added followed by 100 pmols of asymmetric double stranded linker in a 25 µl solution containing 10 mM MgCl2, 20 mM DTT, 3 mM ATP, 0.005% BSA and 4.5 units of T4 ligase (Ambion). The double stranded linker was generated by combining LP1 and LP2 to a final concentration of 20 µM each in 250 mM Tris-HCl (pH 7.7) followed by denaturation at 95oC, cooling to room temperature at a rate of 1oC/min, and overnight incubation at 4oC. The ligation proceeded overnight at 17oC and DNA was then purified by standard phenol/chloroform extractions and ethanol precipitation in the presence of 10 µg of tRNA . Electrophoresis, Transfer, and Hybridization of Sequencing Gels The PCR-amplified products from the LM-PCR reaction were phenol/chloroform extracted, ethanol precipitated and resuspended in 20 μl of ddH2O. Initially, 2μl were size-fractionated in a 5% polyacrylamide denaturing gel (Long Ranger Gel Solution from
77 BioWhitaker Molecular Applications) in 1xTBE. DNA was electrotransfered to a nylon membrane (Hybond N+, Amersham) for 30 minutes and dried for 1h at 80oC. The membrane was pre-hybridized for 20 minutes at 65oC in hybridization buffer (250 mM Na2PO4, 3.5 % SDS, 1% BSA). The blot was hybridized to a gene specific α-32P radiolabeled probe that was synthesized from a plasmid template using the Prime a Probe kit (Ambion) with the following modifications: A plasmid containing the region to be analyzed was digested with an appropriate enzyme flanking that region and purified by phenol/chloroform extraction. Approximately 1.5 μg of digested plasmid and 0.3 μg of gene specific PCR primer used for the LM-PCR were denatured in 9 μl of ddH2O at 95oC for 10 minutes followed by snap freeze in dry ice. This solution was supplemented with 5 μl of 5X DecaPrime Buffer minus dCTP (Ambion), 10μl of α-32P dCTP (3,000Ci/mmol) and 1 unit of Klenow DNA polymerase (Gibco-BRL) and incubated at 37oC for 1 hour. The probe was then denatured at 95oC for 10 minutes, immediately purified by denaturing polyacrylamide gel electrophoresis in 1xTBE, detected by exposure to a Polaroid film (Type 57, Polaroid), and excised. The probe containing polyacrylamide gel piece was crushed and soaked in 4 ml of hybridization buffer and directly added to the pre-hybridized membrane. The hybridization proceeded overnight at 65oC, washed in (20 mM Na2PO4, 0.5% SDS), and detected by autoradiography. Chromatin Immunoprecipitation Analysis Using Real-Time PCR This technique was performed as described by Leach et al. (Leach et al., 2003). Approximately ten million cells were used in each immunoprecipitation (IP) reaction. The experimental conditions indicated below are adjusted for 10 IP reactions and therefore start off with 1X108 cells. TgPWS del or TgAS del immortalized mouse fibroblast
78 cells (Gabriel et al., 1999) were washed with phosphate buffered saline and incubated in cell culture media containing 1% formaldehyde (27 µl of 37% formaldehyde/ml of media) for 10 minutes at room temperature with gentle rocking. The crosslinking reaction was stopped by addition of glycine to a final concentration of 0.125 M (62.5 µl 2 M glycine/ml of media) and gentle rocking for 5 minutes at room temperature. Cells were scraped and collected using a rubber policeman and washed twice with 25 mls of ice cold PBS containing protease inhibitors (Complete Protease Inhibitor tablets, Roche). Formaldehyde-treated cells were resuspended in 1 ml of ice cold nuclei swelling buffer (5 mM PIPES (pH 8.0), 85 mM KCl, 0.5% NP-40, 1.1 mg/ml sodium butyrate and protease inhibitors), transferred to a microfuge tube and incubated on ice for 10 minutes. Nuclei were collected by centrifugation for 5 minutes at 5,000 rpm / 4oC in a microcentrifuge, resuspended in 1ml of SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl (pH 8), 1.1 mg/ml sodium butyrate and protease inhibitors) and incubated on ice for 10 minutes. Lysed nuclei were sonicated on ice in a 4 ml plastic culture tube and cleared by centrifugation for 10 minutes at 13000 rpm at 4oC. Thirty microliters of the supernatant were set aside an incubated at 65oC for at least 2 hours, and then phenol/chloroform extracted, treated with RNase, and fractionated by electrophoreses in a 1.6 % agarose gel in TBE buffer in order to verify that the average size of the fragments was between 100 and 500 bp. The remaining supernatant was transferred to a 15 ml conical tube with 9 ml of ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 167 mM TrisHCl (pH 8) 167 mM NaCl, 1.1 mg/ml sodium butyrate and protease inhibitors). A fifty percent slurry of Protein A Sepharose beads was prepared by rocking 0.2g dry beads in 40 ml ddH2O for 2 hours followed by two washes with ddH2O. Beads were
79 collected each time by centrifugation at 4000 rpm in a tabletop centrifuge and finally resuspended in approximately 1 ml of TE (pH 8) containing 0.05% sodium azide. In all the subsequent steps, beads were handled with wide bore tips. Non-specific DNA/beads interactions were removed by addition of 500 µl of 50% slurry of Protein A Sepharose beads to the sonicated chromatin and incubation in a spinning wheel with for 2 hours at 4oC. Beads were pelleted by centrifugation for 10 minutes at 4000 rpm / 4oC in a tabletop centrifuge and the supernatant divided into 1 ml aliquots to which the antibodies were added as follows: anti-H3 dimethyl-K4 (Abcam ab7766-50; 2 µg); anti-H3 dimethyl K9 (Abcam, ab7312-100, 5 μg);anti-H3 acetyl-K9 (Upstate Biotechnology 06-942; 5 µg); anti-acetyl-H4 (Upstate Biotechnology 06-866; 1 µl of rabbit antiserum); anti-Gabp-α (NRF-2) (Santa Cruz Biotechnology sc-22810, 5 μg); anti-YY1 (Santa Cruz Biotechnology sc-1703; 5 µg); and anti-SP1 (Santa Cruz Biotechnology sc-59; 10-12.5 µg). A control sample using no antibody was included for each cell-line in each experiment. Sonicated chromatin was then incubated with each of the antibodies overnight at 4oC with gentle rocking. At the same time sepharose beads in 1x TE were collected by a quick pulse of centrifugation in a microcentrifuge and blocked overnight in 3% BSA. The next day 60 µl of the blocked Protein A Sepharose beads were added to each reaction and incubated for 2 hours at 4oC on a rotating wheel to capture immune complexes. Beads were collected by a quick pulse of centrifugation and supernatants discarded with the exception of 500 µl of supernatant of the control sample with no antibody which was saved to use as the input control. Beads were then washed at 4oC on the rotating wheel for 5 minutes per wash sequentially with 1 ml of each of the following: low salt wash
80 solution (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 200 mM Tris-HCl (pH 8) and 150 mM NaCl ), high salt wash solution (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 200 mM Tris-HCl (pH 8) and 500 mM NaCl), LiCl wash solution (0.25 M LiCl, 1% NP-40, 1% Na desoxycholate, 1 mM EDTA and 100 mM Tris-HCl (pH 8)), and twice with 1x TE (pH 8). The immune complexes were eluted from the beads with 275 µl of freshly made elution buffer (1% SDS and 0.1 M NaHCO3) under vigorous shaking in a dry heating block/shaker (950 rpm) at 65oC for 15 minutes. The elution was repeated once with an additional 250 µl of elution buffer. The collected elutants were pooled together, supplemented with NaCl to a final concentration of 200 mM and, together with the input sample collected earlier, were incubated at 65oC for 4 hours to reverse the crosslinking followed by overnight incubation at 4oC. Samples were then treated with 40 µg/ml of RNase A for 30 minutes at 37oC and proteinase K in the additional presence of 10 µM EDTA and 40 µM Tris-HCl (pH 6.5) for 1 hour at 37oC. The DNA was then purified using a PCR purification kit by Qiagen and eluted in100 µl 0.5x TE (pH 7.5). The DNA isolated after the immunoprecipitation was then analyzed by real-time PCR (Opticon Monitor 2, MJ Research Inc.). Two microliters of template DNA was amplified in a 20 µl reaction containing 10 μL of SYBR Green Supermix (MJ Research, Inc.) and 0.5 µM each of the forward and reverse primers. The parameters for real-time PCR primer design included a melting temperature of 60oC and an amplicon size of 90 to 120 bp. The conditions for the PCR amplification were as follow: denaturation and activation of the polymerase for 10 minutes, followed by 40 cycles of (95oC for 10 seconds, 59oC for 20 seconds and 72oC for 30 seconds) with a plate read after each cycle, a final extension of 5 minutes at 72oC, and a melting curve read every 0.5oC from 55oC to
81 Table 4-3: PCR primers utilized for chromatin immunoprecipitation analysis. All primers are shown in a 5’ to 3’ orientation.
Upstream (-1091 to -997) forward: CCCTTAGGTTGTGAGACTCCTTCCAATA reverse: TCTTCCTTTCCTCACCCACTAACTTGAA
Promoter (-105 to -5) forward: CGGTGAAGCCCTAGGAATGGTGT reverse: GGAGCGAAGTGCATCGATTTTTGT
HS2 (+498 to +594) forward: AAGATGCTCAGCCTCGGGCC reverse: CAGAGGCAAGGAGCTTGAGGATG
Body (+1526 to +1619) forward: GGTGGTGGATCATCAAGCGCA reverse: GGCCAGGCGAAGCACAGAATG
Downstream (+4.5 kb) forward: CTTCCTTCTCTGATGACCGTTGGCT reverse: CAGAGCTTTAGCAGACCAGACCACTG 95oC. For each primer set and each experiment, the input DNA control from the TgPWS del fibroblast cell line was serially diluted 1:10, 1:100 and 1:1000 and amplified by real-time PCR. A standard curve was generated by the undiluted and diluted input DNA within the Opticon Monitor 2 software and all test samples for a particular experiment were quantitated using this standard curve. An undiluted TgAS del fibroblast input sample was also run for each experiment. The percentage of immunoprecipitated DNA compared to input DNA within each region was generated either directly using the Opticon Monitor 2 software (in the case of the TgPWS del fibroblast samples which contain a single maternal allele) or were calculated by normalizing to the undiluted TgAS del fibroblast input sample
82 (harboring a single paternal allele). In each real-time PCR for a particular primer set, a no antibody control was also amplified and normalized as described.
CHAPTER 5 CONCLUDING REMARKS AND FUTURE DIRECTIONS This dissertation has focused on the study of genomic imprinting, specifically on the Prader-Willi and Angelman syndromes gene cluster in mouse. This ~3Mb domain includes both maternally- and paternally- expressed genes which are coordinately regulated by a centrally located imprinting center (IC). One of the overall goals in our laboratory is to better understand how the imprinting center in this region governs the establishment and/or maintenance of the correct pattern of epigenetic marks (the epigenotype) and thus imprinted gene expression throughout the domain. We have characterized the epigenotype of the most distal gene in the cluster, Mkrn3, which is located ~2.3Mb from the IC in mouse. Using sodium bisulfite genomic sequencing technique for identifying DNA methylation patterns at the nucleotide level, we determined the specific changes in the DNA methylation patterns of two newly identified CpG islands within Mkrn3 at fourteen stages throughout mouse embryogenesis and gametogenesis and compared these results to the developmental changes observed in the IC. Changes in the 5’ CpG island of Mkrn3 were similar to those observed within the imprinting center. Thus, DNA methylation in this region reflects a DNA methylation imprint that may play a role in the regulation of imprinted expression of Mkrn3. The intragenic CpG island was biallelically methylated in almost all tissues analyzed, indicating that this region does not serve as a genomic imprint and may play an alternate role in the tissue-specific expression of Mkrn3 independent of genomic imprinting.
83
84
1kb
-3715
DNaseI hypersensitivity
+6134 -254
+551 +786 +985
*
DNA Methylation -336
CpG Islands
* +145
+708
+1189
ChIP in vivo footprinting
Figure 5-1: Identification of allele-specific epigenetic marks and regulatory elements within the imprinted Mkrn3 gene. The intronless Mkrn3 gene is represented by the orange box and the transcription initiation site by the bent arrow. Paternal-specific hypersensitive sites are represented by the purple arrows. Predicted CpG islands are shown by the horizontal black bars and regions analyzed by high resolution sodium bisulfite genomic sequencing are shown in blue. Single nucleotide polymorphisms are indicated by the asterisks above each line. Regions analyzed by ChIP and in vivo footprinting are shown in red and green, respectively. Interestingly, these two dissimilar CpG islands are physically separated by only a few hundred base pairs. We identified two novel paternal allele-specific DNaseI hypersensitive sites which are approximately located in the promoter of Mkrn3 and near the region between the previously mentioned CpG islands. Although the hypersensitive site (HS1) near the promoter may be indicative of transcription factor binding and a more open and accessible chromatin structure on the paternally expressed allele, the intragenic site (HS2) may act as a chromatin boundary which could help to establish or maintain the dissimilar DNA methylation patterns observed in the two CpG islands. To further characterize the promoter (and potentially HS1), we performed a transcription factor database search to identify potential regions for transcription factor binding within the Mkrn3 promoter. We then verified allele-specific factor binding in these regions using in vivo footprinting at potential sites for NRF2 (Gapbα), SP1, and YY1. Confirmation of the paternal allele-
85 specific binding of these factors to Mkrn3 in vivo was achieved using chromatin immunoprecipitation analysis (ChIP). Additional ChIP experiments determined the differential allele-specific histone modifications at five regions proximal to and within the Mkrn3 gene. Further studies are required to understand the imprinted and tissue-specific expression of Mkrn3. Although transcription factor database searches within HS2 do not indicate any specific insulator binding sites (such as CTCF), a more detailed and finemapping of the position of this hypersensitive site may be required. This may help to narrow the region of localized hypersensitivity to DNase I and allow for subsequent LMPCR in vivo footprinting and ChIP analysis in this region. Additionally, as higher quality ChIP antibodies become available, it will be important to examine histone modifications in the region that are specific to silenced transcription, such as tri-methylation of histone H3 lysine 9, to determine if these modifications are enriched on the maternally-inherited allele. Previous work in our lab examining the human IC region identified the binding of YY1, SP1, and an additional nuclear respiratory factor, NRF1. The observation that both the imprinting control region and a distal gene interact with similar trans-acting factors led us to propose an active chromatin hub model for the coordinated regulation of paternal gene expression within the PWS / AS gene cluster. In addition to these factors playing a potential role in the active transcription of Mkrn3, they may also help to mediate the interaction of Mkrn3 with the imprinting center, either directly or via additional intervening factors. Our model suggests how the IC may establish and maintain the correct epigenotype and imprinted expression of all the genes in the cluster.
86 Similar to the proposed formation of an active chromatin hub in the βglobin locus, where the developmental coordination of gene expression is achieved by a co-localization of the locus control region (LCR) and the appropriate genes at specific developmental stages (de Laat and Grosveld, 2003), we propose that the formation of an active chromatin hub is facilitated by the recruitment of the imprinting center and regulatory regions (including promoters) within each of the paternally-expressed genes in the cluster, along with transacting positive regulators of transcription. This results in the transcriptional activation of these genes. Additionally, evidence utilizing DNA fluorescence in situ hybridization (FISH) reflects the predicted localization of the IC and distal genes within interphase nuclei based on our proposed model. Specifically, the distance observed between the IC and distal genes including Mkrn3 is shorter on the paternally-inherited chromosome and farther away on the maternally-inherited chromosome. Future studies will continue to pursue this model using additional techniques to detect long-range interactions in this region, including chromosome conformation capture (3C), a ChIP-based PCR technique that has been successful in identifying long range interactions and chromatin loops between sequences at other imprinted loci.
APPENDIX A LOW PROTEIN DIET AFFECTS DNA METHYLATION IMPRINTS IN THE PLACENTA Introduction Malnutrition in utero has been demonstrated in both humans and animal models to have long-term effects on the metabolic and physiological states of individuals and their offspring. This suggests a form of nutritional “programming”, whereby a nutrientdeficient diet early in development results in health-related consequences that persist throughout an individual’s lifetime and may also be inherited to some degree by subsequent generations (Desai and Hales, 1997). A growing body of evidence suggests that epigenetics, or heritable mechanisms that effect the transcriptional state of a gene independent of DNA sequence, may be functionally related to nutrition. Depletion of folate and other components required for one-carbon metabolism result in a reduction of genome-wide DNA methylation in lymphocytes and leukocytes of post-menopausal women (Jacob et al., 1998; Rampersaud et al., 2000) and hypomethylation of specific genes in rodents (Balaghi and Wagner, 1993; Christman et al., 1993; Kim et al., 1997; Zapisek et al., 1992). Additionally, maternal protein deficiency during pregnancy, a condition known to cause intra-uterine growth retardation (IUGR), has been associated with changes in the methylation status of offspring (Rees et al., 2000). DNA methylation is the most well-studied epigenetic mark in mammalian cells, and it plays an important regulatory role in the silencing of transcription, particularly within tissue-specific genes, imprinted genes, or genes subject to X-inactivation (Bird,
87
88 1992). Indeed, allele-specific DNA methylation is a hallmark of genomic imprinting, an epigenetic process that confers mono-allelic gene expression dependent on the parent-oforigin of the allele (Delaval and Feil, 2004). Imprinted genes are often clustered into domains containing both genes expressed from the maternally-inherited chromosome as well as genes expressed from the paternally-inherited chromosome (Rand and Cedar, 2003). DNA methylation imprints (that is, regions of differential methylation between maternally- and paternally-inherited alleles, termed differentially methylated regions (DMRs)) have been found within most imprinted loci analyzed to date, either within gene promoters or within imprinting control regions (ICRs) (Mann et al., 2000). In both human and mouse, ICRs have been shown to play a critical role in the establishment and / or maintenance of DNA methylation imprints and imprinted gene expression throughout their associated imprinted domain (Ben-Porath and Cedar, 2000). The majority of evidence suggests that DNA methylation imprints are established during gametogenesis, when the male and female genomes are physically separate (Li, 2002; Reik et al., 2001). Limited evidence within a few ICRs indicates that upon fertilization DNA methylation patterns are preserved and protected to some degree despite the global changes to DNA methylation that occur during pre- and post-implantation development. Because many critical stages in the process of genomic imprinting occur in utero, normal patterns of epigenetic modification that establish and maintain imprints could be susceptible to alteration by nutritional deprivation (or excess) during pregnancy. Moreover, the DNA demethylation and/or remethylation events that occur during embryogenesis and gametogenesis may provide specific developmental windows in which maternal diet may affect normal DNA methylation patterns of imprinted (and non-
89 imprinted) loci, contributing to aberrant fetal and/or post-natal development. The potential epigenetic effects of environment and diet on fetal development and the subsequent predisposition to diseases in adult life are crucial human health issues that are becoming an increasingly active area of public interest. We have examined the effects of a low protein diet in utero on the DNA methylation patterns within imprinted genes in the rat placenta. Timed-pregnant Sprague-Dawley rats were fed either a normal diet (19.8% protein, NPD) or an isocaloric low protein diet (8% protein, LPD) from day 5 of pregnancy until they were sacrificed at 19 days of gestation. Differentially methylated regions of three well-characterized imprinted genes, Igf2, H19, and Snrpn, exhibited a significant loss of DNA methylation in response to a low protein diet in placental tissue. Each of these genes is associated with a differentially methylated region (DMR) whose methylation pattern is dependent on the parent-of-origin of each allele. Placental gene expression of Igf2 and Snrpn was also affected by maternal protein deficiency. Finally, in contrast to previously published data from Rees and colleagues which demonstrated an increase in global DNA methylation in LPD fetal liver, we determined that the levels of DNA methylation observed in placentas from female rats fed a low protein diet during pregnancy were not globally reduced. These results suggest that DNA methylation imprints and the expression of imprinted genes in placental tissue are specifically altered in response to a low protein diet in utero. Materials and Methods Control and low protein diets Timed-pregnant female Sprague-Dawley rats were fed either a normal control (NPD) or low protein diet (LPD) beginning at day 5 of pregnancy until sacrifice at day
90 19. The experimental diets were as described in (Malandro et al., 1996). The control diet consisted of 19.3% protein, 60.6% carbohydrate, 10% fat, and 4.3% fiber. The low protein diet contained 8% protein, 71% carbohydrate, and the same levels of fat and fiber. The low protein diet was made isocaloric by the addition of sucrose. Both diets were fed without supplementation. Placenta collection and genomic DNA and RNA isolation Rat placenta was isolated from pregnant female Sprague Dawley rats which had been fed either the control or low protein diet at 19 days of gestation. Three placentas were collected randomly from three different timed pregnant females fed a NPD or a LPD, for a total of six placentas. Samples were initially frozen in liquid nitrogen and stored at -80oC. Genomic DNA was purified after homogenization by standard phenol extractions and ethanol precipitation (Strauss, 2000). For total RNA isolation, the tissue was homogenized in 3 mLs of TRIzol® reagent (Invitrogen) using a glass-Teflon® homogenizer and transferred to 15mL conical tubes. After incubation at room temperature for 5 minutes to permit complete dissociation of nucleoprotein complexes, 0.6 mLs of chloroform was added and securely closed tubes were shaken by hand for 15 seconds. An additional 2-3 minute incubation was followed by centrifugation at 3000 x g for 60 minutes. The colorless, aqueous phase was transferred to another tube and precipitated using 1.5mL isopropanol for 10 minutes at room temperature. Precipitated total RNA was then spun down, washed with 75% ethanol, and resuspended in 300μL RNase-free water. Genomic DNA and total RNA was quantitated by UV spectrometry. Sodium bisulfite genomic sequencing DNA methylation analyses were performed essentially as described by Clark, et al. (Clark et al., 1994; Kang et al., 2003). Briefly, five micrograms of placental genomic
91 DNA were sheared by vortexing and denatured in 0.3 M NaOH at 37oC for 30 minutes. A solution of sodium bisulfite and hydroquinone, pH 5.0, was added to the denatured DNA to a final concentration of 1.55 M sodium bisulfite and 0.5 mM hydroquinone. The samples were repeatedly cycled in a PTC-100 Programmable Thermal Controller (MJ Research, Inc.) at 55oC for 30 minutes and 95oC for 30 seconds for 20 hours in the dark. Free bisulfite ion was removed using the Wizard DNA Clean-Up kit (Promega), desulphonated in 0.3 M NaOH for 15 minutes at 37oC, and ethanol precipitates were resuspended in 50-100μL of 1x TE (10mM Tris, pH 8.0, 1mM EDTA, pH 8.0) or ddH2O. Ten percent of the recovered bisulfite-treated sample was subjected to PCR using HotStarTaq™ Polymerase in the provided buffer (Qiagen) under the following conditions: 94oC for 15 minutes, followed by 35 cycles of 94ºC for 45 seconds, 51ºC for 30 seconds, 72ºC for 90 seconds, and a final extension at 72º C for 10 minutes. PCR products were gel-purified using Qiagen’s QIAquick kit, ligated into the TA cloning vector pCR2.1 or pCR2.1-TOPO (Invitrogen), and transformed into competent bacterial cells. Plasmids from individual colonies were isolated using the QIAprep Miniprep Kit (Qiagen) and subjected to automated sequencing using a M13 reverse primer specific to the TA vector and the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit with AmpliTaq DNA Polymerase. Clones were chosen for sequencing from multiple treatments / PCR reactions to control for PCR or cloning biases. In addition, to ensure minimal allele bias in the PCR amplification step which may yield inaccurate or skewed results after sequencing, each sample was ligated after a single amplification by PCR, that is, no nested primers were used for a secondary amplification step. The PCR primers used were: Igf2 DMR0 – 5’ ttttgtagtattttgttggtatattatttttt 3’ and 5’
92 cataaacaaaaaaaaatcaattaattaccta 3’, H19-DMR – 5’ tagaatgaatgagttttttagggagg 3’ and 5’ taaataactatccttctatcctctccatc 3’, Snrpn 5’ CpG island – 5’ gtaaatgtgattataagaagttggatgg 3’ and 5’ aaaatccaccacaaaaatttactattacta 3’. Expression analysis by qPCR A one-step reaction containing 500ng total RNA template, SYBR green PCR master mix (ABI), MultiScribe reverse transcriptase (ABI), RNase inhibitor, and genespecific primers was utilized to assess the level of gene expression. Each NPD and LPD placenta was analyzed twice using real-time PCR (Opticon2, MJ Research Inc.) using the following conditions: (reverse-transcription) 42oC 15 minutes, (PCR) 95oC 10 minutes, 40 cycles of 94oC 10 seconds, 59oC 20 seconds, 72oC 30 seconds, and a final extension of 72oC for 5 minutes. Each individual sample was first quantitated by comparison to a standard curve generated during the RT-qPCR and than normalized to the expression levels of βactin as an internal control. PCR primers were as follows: Igf2 (spanning intron 4) – 5’ tctgtgcggaggggagcttgtt 3’ and 5’ cttccacgatgccacggctg 3’, H19 (spanning intron 1) – 5’ gcggcgacggagcagtgat 3’ and 5’ cagtgactggcaggcacatcca 3’, Snrpn (spanning intron 7) – 5’ aggcccatcccagcaggtca 3’ and 5’ gcagtagcagcaacagcagcagc 3’, and βactin – 5’ agaccttcaacaccccagccat 3’ and 5’ cgaccagaggcatacagggacaa 3’. The average expression of each gene analyzed over a total of six trials for either the NPD or LPD was then calculated as well as the standard deviation for each group (NPD and LPD) and plotted. Methyl acceptance assay Global levels of DNA methylation were determined essentially as described in (Choumenkovitch et al., 2002). Briefly, 2 μg of genomic DNA from each sample was
93 incubated with SssI methylase (New England Biolabs) in the supplied 10x buffer along with 5μCi (80 Ci / mmol, Amersham) S-adenosyl-L-[methyl-3H] methionine for 2 hours at 37oC. Each sample was then ethanol precipitated, washed, and dried briefly. Incorporation of 3H was measured using liquid scintillation counting. In each experiment, one sample lacking SssI methylase was utilized as a blank to determine background 3H levels. All samples were analyzed in duplicate in two separate experiments. The average and standard deviation for each genomic DNA sample were plotted. Results DNA methylation analysis of the Igf2 P0 promoter DMR Insulin-like growth factor II (Igf2) is imprinted and expressed from the paternallyinherited chromosome during fetal and adult life. Control of Igf2 gene expression and DNA methylation patterns are complex and tissue-specific (Eden et al., 2001; Hu et al., 1998; Moore et al., 1997; Murrell et al., 2001) with multiple promoters and multiple differentially methylated regions (DMRs) (Lopes et al., 2003; Moore et al., 1997).We focused our initial analysis on the region associated with the P0 promoter of Igf2 (Figure A-1A) which has been shown to function specifically in the placenta (Constancia et al., 2002). Deletion of the P0 promoter is associated with fetal growth retardation (Constancia et al., 2002; Murrell et al., 2001) demonstrating its importance in the biogenesis and function of the placenta. The P0 promoter is associated with a DMR, termed DMR0, that is differentially methylated only in the placenta, with hypermethylation of the maternal allele (Lopes et al., 2003; Moore et al., 1997).
94
B)
A) Igf2 Gene
Control Placenta (normally fed)
Placenta-specific P0 promoter (DMR0)
Methylated CpG Unmethylated CpG
45.7% Unmethylated clones 54.3% Methylated clones
C)
Low Protein Placentas
Placenta #1
Placenta #2
Placenta #3
Figure A-1: Placental DNA methylation is significantly reduced in the placenta-specific P0 promoter region of the rat Igf2 gene after gestation in pregnant females fed a low protein diet. High resolution DNA methylation analysis was performed by sodium bisulfite genomic sequencing. A) Diagram of the mouse H19-Igf2 imprinted domain representing the likely organization of the rat H19-Igf2 domain. Bent arrows depict transcription initiation sites, and filled boxes above the horizontal line indicate exons. Half-filled rectangles depict the positions of differentially methylated regions (DMRs), with the upper half of the rectangle indicating the DNA methylation status of the maternallyinherited allele and the lower half of the rectangle indicating the methylation status of the paternal allele; filled shading indicates hypermethylation, and open shading indicates hypomethylation. The location of the placenta-specific DMR0 is indicated by the red arrow. B) The combined DNA methylation patterns of 3 control NPD placentas (i.e., from 3 different normally-fed pregnant females). Each line represents the DNA methylation pattern of a single allele of the Igf2 DMR0; each circle represents an individual CpG dinucleotide, with filled circles indicating a methylated CpG and an open circle representing an unmethylated CpG. C) DNA methylation patterns of 3 individual placentas from 3 different pregnant females fed a low protein diet during pregnancy.
95 We anticipated that DMR0 in the Igf2 gene in normal rat placentas would show the same pattern of differential methylation as previously reported in mouse placentas (Mann et al., 2000; Moore et al., 1997). As shown in Figure A-1B, the combined pattern of all 3 NPD placentas exhibited differential methylation, with approximately half (45.7%) of the sequenced clones showing a large block of unmethylated cytosines, and the other half (54.3%) showing hypermethylation of cytosines across the entire region analyzed. We were unable to distinguish the maternal and paternal alleles without a parent-of-origin-specific polymorphism, however we presume that the hypomethylated clones were derived from the paternally-inherited allele, while the hypermethylated clones were derived from the maternally-inherited allele, as has been shown for DMR0 in mouse placentas (Mann et al., 2000; Moore et al., 1997). In contrast, as shown in Figure A-1C, all three of the placentas derived from pregnant mothers fed a LPD showed profound demethylation of DMR0. Indeed, nearly total demethylation is observed at all CpG sites on both the presumptive paternal and maternal alleles, and the overall methylation of the Igf2 DMR0 in each of the three LPD placentas was reduced >95% compared to the overall level of DMR0 methylation in the control placenta. These results strongly indicate that exposure to a LPD in utero leads to widespread demethylation of DMR0 in the Igf2 gene in the placenta. However, because placental tissue contains maternal cells from maternal blood and decidual tissue (our placental dissection technique eliminates most decidual tissue), it is conceivable that a small proportion of the alleles in our analyses represents methylation patterns of maternal cells. If so, these cells must also be undergoing dramatic DNA demethylation in DMR0 in response to LPD. DNA methylation analysis of the H19-Igf2 imprinting control region A similar analysis was performed in the DMR associated with the imprinting
96
A)
B)
H19 Gene
Control placenta (normally fed)
(H19 DMR)
61% hypomethylated 39% fully methylated
C) Low Protein Placentas Placenta #1
Placenta #2
Placenta #3
Figure A-2: Reduction of placental DNA methylation in the rat H19-DMR after gestation in pregnant females fed a low protein diet. A) Diagram of the mouse H19-Igf2 imprinted domain representing the likely organization of the rat H19-Igf2 domain. All symbols are identical to those in Figure A-1 above. The position of the DMR associated with the rat H19 gene is indicated by the blue arrow. B) Combined DNA methylation patterns of the H19 DMR from 3 control NPD placentas (i.e., from 3 different normally-fed pregnant females). All symbols representing the methylation status of the H19 gene are identical to those in Figure A-1. C) DNA methylation patterns of three individual rat placentas from three different pregnant mothers fed a low protein diet during pregnancy. All symbols are identical to those shown for methylation analysis of the control placentas after gestation in pregnant females fed a low protein diet. control region for the H19-Igf2 imprinted gene cluster (H19-DMR; Figure A-2A). The H19-DMR is located 2-4 kb upstream of the H19 gene and has been shown to be critical for the establishment and maintenance of H19 and Igf2 coordinated imprinted gene expression. This DMR exhibits the reverse pattern of methylation to that of Igf2 DMR0, where the paternal allele is hypermethylated and the maternal allele is hypomethylated
97 (Bartolomei et al., 1993). Imprinted expression of H19 is also reversed from Igf2, where H19 is expressed from the maternal allele and silenced from the paternal allele. As shown in Figure A-2B, combined DNA methylation analysis of the three control placentas sample showed the expected pattern of differential methylation of the rat H19 DMR (similar to the well-characterized differential DNA methylation pattern of the mouse H19 DMR) (Bartolomei et al., 1993). Although we again were unable to correlate the methylation pattern of each sequenced allele with either the maternal or paternal chromosome specifically, we presumed that the hypomethylated alleles were derived from the expressed maternal allele, and the hypermethylated alleles were from the repressed paternal allele. Placentas derived from pregnant mothers fed a LPD showed significant demethylation of the H19-DMR (Figure A-2C). For example, compared to the control sample where 39% of the clones were fully methylated at all CpG sites, not a single clone in any of the LPD placentas showed methylation at all CpGs. Overall methylation of the H19-DMR in each of the three LPD placentas was reduced by ~57% compared to the overall level of H19-DMR methylation in the combined control placentas. This decrease in overall methylation levels of the H19-DMR in response to the LPD was significant, but not to the same extent observed in the Igf2 DMR0. Importantly, these results for the Igf2 and H19 genes also demonstrate that the demethylation of imprinted genes in the placenta triggered by LPD in utero does not occur only on the maternal or paternal allele. DNA methylation analysis of the Snrpn 5’ CpG island The paternally expressed Snrpn gene is located within the Prader-Willi and Angelman (PWS/AS) syndromes associated imprinted domain and encodes a factor
98
-A S A A A TP 10 C
U B E3
A
U B E3
N
N
A IP W sn oR
sn oR
R FSN ND
N
SN U
EL 2 A G
M
K R M
M
K R
N 3
N 3A S
R PN
A) Snrpn Gene IC
DMR
B)
Control Placenta (Normally fed)
C) Low Protein Placentas Placenta #1
Placenta #2
Placenta #3
Figure A-3: Placental DNA methylation is reduced in the rat Snrpn promoter region after gestation in pregnant females fed a low protein diet. A) Diagram of the imprinted human Prader-Willi / Angelman syndrome (PWS / AS) region representing the likely organization of the rat AS/PWS domain. Filled circles represent individual genes in the region; blue circles represent genes expressed only from the paternally-inherited chromosome, pink circles represent genes expressed only from the maternally-inherited chromosome. Bent arrows indicate transcription initiation sites and the direction of transcription. The long dashed arrow depicts a long continuous transcript originating from the SNRPN promoter. IC represents the position of the PWS / AS imprinting center. The position of the SNRPN DMR is indicated by the green arrow. B) Combined DNA methylation patterns of the rat Snrpn DMR from 3 different control NPD placentas (i.e., from 3 different normally-fed pregnant females). All symbols representing the methylation status of the rat Snrpn gene are identical to those in Figure A-1. C) DNA methylation patterns of three individual rat placentas from three different pregnant mothers fed a low protein diet during pregnancy. All symbols are identical to those shown for methylation analysis of the control placentas. involved in RNA splicing in the brain (McAllister et al., 1988). The Snrpn promoter colocalizes with the PWS imprinting center (PWS-IC) and contains a CpG island and DMR that is unmethylated on the paternal allele and hypermethylated on the maternal allele
99 (Figure A-3A) (Buiting et al., 1994; Glenn et al., 1996). Methylation analysis of the Snrpn gene in the 3 control placentas collectively showed differential methylation in the rat Snrpn promoter region similar to that of the mouse gene (Figure A-3B), with ~50% of the alleles showing hypomethylation and ~50% of the alleles hypermethylation. Based on the well-studied differential methylation patterns of the human and mouse DMR in the Snrpn promoter region, it is highly likely that the hypomethylated alleles are derived from the paternal chromosome and the hypermethylated alleles are from the maternal chromosome. All three of the placentas from pregnant mothers fed a LPD showed significant demethylation of the Snrpn DMR (Figure A-3C). Furthermore, not a single allele in any of the samples from LPD placenta showed complete methylation at all CpGs, whereas the control samples showed complete methylation in ~32% of the total number of alleles analyzed. Overall methylation in each of the three LPD placentas was reduced by ~48% compared to the overall level of methylation of the Snrpn DMR in the control NPD placentas. This degree of demethylation of the Snrpn DMR in these placentas in response to LPD in utero was slightly less than that observed in the H19DMR. A low protein diet affects imprinted gene expression To determine whether the levels of Igf2, H19, and Snrpn imprinted gene expression in placenta were also affected by a low protein diet, reverse transcription-PCR of total placental RNA was quantitated using real-time PCR (Opticon2, MJ Research Inc.) and compared to results from NPD placentas. Based on the demethylation observed in placental DNA in response to LPD in utero, we would expect a change in mRNA levels
Expression level relative to control
100
20 18 15.06
16 14 12
Control
10
LPD 1-3
8 6 2.11
4 2 0
1.15
rIgf2
0.41 0.49
rH19
0.61
rSnrpn
Figure A-4: Analysis of imprinted gene mRNA levels in the placenta after gestation in pregnant females fed a low protein diet. mRNA levels from each gene were determined by real-time quantitative PCR. Control denotes placentas from mothers fed a normal protein diet; LPD denotes placentas from mothers fed a low protein diet. Each bar represents the average values for duplicate analyses on three placentas, after normalization to a βactin control. Standard deviations are indicated by the error bars. of each gene if DNA methylation was involved in maintaining transcriptional silencing of the repressed allele. The most likely change would be an increase in mRNA levels if the major effect of DNA demethylation was direct repression of the methylated allele (i.e., reactivation of the hypermethylated repressed allele). PCR primers which span intron 4, 1, or 7 for the imprinted Igf2, H19, and Snrpn genes, respectively, were utilized. Importantly, the Igf2 primers were designed to detect transcripts beginning at any of the alternate Igf2 promoters (including the placental-specific P0). A one-step reverse transcription and PCR amplification reaction (RT-qPCR) was performed utilizing only the gene-specific primers and were repeated twice. The average of all control (NPD) or low protein (LPD) placental RNA samples (a total of 6 reactions for each) is shown in Figure A-4, with error bars representing the standard deviation of each sample set. Low protein placentas appeared to exhibit an approximately two-fold increase in expression of
101 Igf2, consistent with the reactivation of the maternally-inherited Igf2 allele. However, a student’s T-test was performed to determine statistical significance, and a P value of 0.072 at a level of 95% significance was calculated, indicating the difference between control and low protein placentas is not clearly statistically significant (P > 0.05). No major difference in H19 expression levels between control NPD and LPD placentas was detected, however, results of the analysis of Snrpn expression were contrary to our expectations. Our data indicate that exposure to a LPD during pregnancy decreases placental Snrpn mRNA levels drastically. This is particularly surprising in light of published studies that have shown that inhibition of DNA methylation by 5azadeoxycytidine (5-aza-dC) or abolishing histone H3K9 methylation by knockout of the G9a histone methyltransferases results in the re-activation of the normally silenced maternally-inherited Snrpn allele (Saitoh and Wada, 2000; Xin et al., 2003). The data suggest that there may be an effect on Snrpn regulation and expression that is mediated by a mechanism other than simple demethylation of the Snrpn DMR in response to LPD. Global levels of DNA methylation are not affected by a low protein diet We utilized a methylation acceptance assay to determine whether the loss of DNA methylation observed at imprinted loci was a reflection of a global effect on overall levels of DNA methylation. We measured the incorporation of [3H]-labeled methyl groups into unmethylated CpG dinucleotides after incubation of genomic DNA with SssI methylase and s-adenosyl-L [methyl-3H] methionine ([3H]-SAM) (Choumenkovitch et al., 2002). In this assay, the levels of incorporation are inversely proportional to the level of DNA methylation in the sample, that is, higher levels of incorporation are indicative of reduced global DNA methylation, whereas less incorporation represents an increase in overall methylation levels. We compared the levels of DNA methylation in placental genomic
102
[3H] incorporation (cpm)
700000 600000 500000 400000 300000 200000 100000 0 NPD
LPD
rLiver
mSperm
HCCT116 HCCT116 -/-
Figure A-5: Global DNA methylation levels are not significantly affected by a low protein diet. Global DNA methylation levels were determined using a methylation acceptance assay (Choumenkovitch et al., 2002). Values are shown as counts per minute (cpm) as determined by liquid scintillation counting. Control and LPD indicate the average level of [3H]-methyl incorporation in three placentas isolated from NPD or LPD fed pregnant females, respectively. Liver and sperm indicate normal rat tissue / mouse cells. HCCT116 – human colon cancer cell line. HCCT116-/- – double knockout cells lacking DNMT1 and DNMT3 (Rhee et al., 2002). Each bar represents an average cpm across at minimum of 4 experiments, and standard deviations across experiments are indicated by the error bars. DNA derived from NPD- and LPD-fed females and observed a slight but not statistically significant difference in the level of global methylation between the control and low protein samples (Figure A-5). As expected, the level of DNA methylation in placenta was considerably lower than rat somatic tissue (liver) or mouse sperm, consistent with the overall lower levels of DNA methylation in placenta compared to embryonic tissues (reviewed in Li, 2002). Additionally, the level of global DNA methylation in our positive control human cancer cells containing a double-knockout of Dnmt1, the maintenance methyltransferase, and Dnmt3b, a de novo methyltransferase, was lower than rat placenta, and, as expected, considerably lower than the parental cancer cell line (Rhee et al., 2002).
103 Discussion These data present strong evidence that exposure of mothers to a low protein diet during pregnancy results in placentas that are abnormally hypomethylated within the DMRs of imprinted genes. As summarized graphically in Figure A-6, the overall degree of demethylation within DMRs associated with imprinted genes ranges from ~48% for the Snrpn gene to >95% for the Igf2 DMR0. This would suggest that the extent of
% mCpG / Total CpG analyzed
60 50 40
Control LPD1
30
LPD2 LPD3
20 10 0
C 1 2 3
C 1 2 3
C 1 2 3
Igf2 DMR0
H19 DMR
Snrpn
Figure A-6: Summary of the effects of a low protein diet on DNA methylation at three imprinted loci in the placenta. Control denotes placentas from mothers fed a normal diet. DNA methylation levels for the controls is a collective number representing the summation of data from 3 separate NPD control placentas. LPD1-3 denotes overall DNA methylation values displayed separately for 3 individual placentas from mothers fed a low protein diet. mCpG denotes methylated CpG dinucleotide. The overall level of methylation indicated on the y-axis is the sum of methylated sites from both alleles (maternal & paternal). demethylation of imprinted genes in placental DNA in response to LPD during pregnancy is dependent on the gene (or DMR). Nonetheless, all 3 of the LPD placentas and DMRs analyzed in these studies showed substantial demethylation after exposure to a LPD in utero.
104 These results are in contrast to those in a published study of genome-wide DNA methylation in the livers from rat fetuses exposed to low protein diets (Rees et al., 2000). This study reported that overall genome-wide DNA methylation levels in the livers of rat fetuses from dams fed a LPD (9%) diet during pregnancy was greater than that of livers from fetuses of dams fed a NPD. The level of methylation in genomic DNA of the LPD fetal livers was 22% higher than that of normal control livers. The contrasting results between our analysis of imprinted genes in the placenta and those of Rees et al. on genomic DNA in fetal livers could be due to differences in the effects of a LPD in utero on DNA methylation in the placenta versus the fetus and / or fetal liver specifically. In fact, Rees et al. found that effects of a LP diet during pregnancy on DNA methylation occurred only in the liver, and not in the heart or kidney, of fetuses, suggesting that the effects of LPD in utero on genome-wide DNA methylation levels in the fetus appear to be organ-specific. Our results suggest that a LPD in utero can have significant epigenetic effects on imprinted genes in the placenta. The altered levels of imprinted gene expression in response to a low protein diet in utero are less clear. The level of Igf2 expression appears to be approximately two-fold higher in the LPD samples and is consistent with a loss of DNA methylation and reactivation of the normally silenced maternal allele, however, these results have not proven to be statistically significant. Although a significant loss of DNA methylation was observed within the H19-DMR, expression levels of H19 in NPD and LPD placentas were similar. Surprisingly, although DNA methylation within the Snrpn promoter was also reduced in LPD placentas, we also observed a significant reduction in expression of Snrpn. Significantly, our expression data point to the importance of recognizing that a
105 low protein diet may result in additional perturbations that directly or indirectly affect the expression of these imprinted genes. For example, the reduction of Snrpn expression may be a consequence of indirect effects such as a change in the expression of a transcription factor(s) that in turn regulates Snrpn in the placenta. Alternatively, it is possible that the decrease in Snrpn expression was related to the loss of certain histone methylation patterns associated with transcriptionally active genes. The specific reduction of DNA methylation at imprinted loci observed in these studies indicate that in utero depletion of protein can have significant effects on epigenetic mechanisms in placental tissue. There is considerable evidence that imprinted genes, specifically Igf2, play a critical role in the development of placental tissue and fetal growth (Constancia et al., 2002; John and Surani, 2000; Reik and Walter, 2001). These results and others also associate the loss of Igf2 expression with an overall reduction in the transport of nutrients into the placenta (Constancia et al., 2002; Sibley et al., 2004). One critical question is whether our observations are unique to imprinted genes or whether other loci specifically regulated by DNA methylation are also affected, including tissue-specific genes and genes subject to X-inactivation. The latter may be particularly important in light of the increased X linkage of highly expressed placental genes (Khil et al., 2004) and the imprinted, non-random inactivation of the Xchromosome in female extraembryonic tissues (Hemberger, 2002; Takagi, 2003). We are also investigating whether the changes observed in placenta occur in fetal tissue as well, and in particular fetal germ cells which could result in heritable changes in DNA methylation and / or other epigenetic marks that may affect future progeny.
LIST OF REFERENCES Ahmad, K., and Henikoff, S. (2002a). Histone H3 variants specify modes of chromatin assembly. Proc Natl Acad Sci U S A 99 Suppl 4, 16477-16484. Ahmad, K., and Henikoff, S. (2002b). The histone variant H3.3 marks active chromatin by replication-independent nucleosome assembly. Mol Cell 9, 1191-1200. Albrecht, U., Sutcliffe, J. S., Cattanach, B. M., Beechey, C. V., Armstrong, D., Eichele, G., and Beaudet, A. L. (1997). Imprinted expression of the murine Angelman syndrome gene, Ube3a, in hippocampal and Purkinje neurons. Nat Genet 17, 75-78. Ariel, M., Cedar, H., and McCarrey, J. (1994). Developmental changes in methylation of spermatogenesis-specific genes include reprogramming in the epididymis. Nat Genet 7, 59-63. Autran, D., Huanca-Mamani, W., and Vielle-Calzada, J. P. (2005). Genomic imprinting in plants: the epigenetic version of an Oedipus complex. Curr Opin Plant Biol 8, 19-25. Balaghi, M., and Wagner, C. (1993). DNA methylation in folate deficiency: use of CpG methylase. Biochem Biophys Res Commun 193, 1184-1190. Bartolomei, M. S., Webber, A. L., Brunkow, M. E., and Tilghman, S. M. (1993). Epigenetic mechanisms underlying the imprinting of the mouse H19 gene. Genes Dev 7, 1663-1673. Bartolomei, M. S., Zemel, S., and Tilghman, S. M. (1991). Parental imprinting of the mouse H19 gene. Nature 351, 153-155. Bell, A. C., and Felsenfeld, G. (2000). Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene. Nature 405, 482-485. Bellve, A. R., Millette, C. F., Bhatnagar, Y. M., and O'Brien, D. A. (1977). Dissociation of the mouse testis and characterization of isolated spermatogenic cells. J Histochem Cytochem 25, 480-494. Ben-Porath, I., and Cedar, H. (2000). Imprinting: focusing on the center. Curr Opin Genet Dev 10, 550-554. Berger, S. L. (2002). Histone modifications in transcriptional regulation. Curr Opin Genet Dev 12, 142-148.
106
107 Bernstein, B. E., Kamal, M., Lindblad-Toh, K., Bekiranov, S., Bailey, D. K., Huebert, D. J., McMahon, S., Karlsson, E. K., Kulbokas, E. J., 3rd, Gingeras, T. R.,Schreiber, S. L., and Lander, E. S. (2005). Genomic maps and comparative analysis of histone modifications in human and mouse. Cell 120, 169-181. Bestor, T. H. (2000). The DNA methyltransferases of mammals. Hum Mol Genet 9, 2395-2402. Bielinska, B., Blaydes, S. M., Buiting, K., Yang, T., Krajewska-Walasek, M., Horsthemke, B., and Brannan, C. I. (2000). De novo deletions of SNRPN exon 1 in early human and mouse embryos result in a paternal to maternal imprint switch. Nat Genet 25, 74-78. Bird, A. (1992). The essentials of DNA methylation. Cell 70, 5-8. Bird, A. (2002). DNA methylation patterns and epigenetic memory. Genes Dev 16, 6-21. Blaydes, S. M., Elmore, M., Yang, T., and Brannan, C. I. (1999). Analysis of murine Snrpn and human SNRPN gene imprinting in transgenic mice. Mamm Genome 10, 549-555. Boccaccio, I., Glatt-Deeley, H., Watrin, F., Roeckel, N., Lalande, M., and Muscatelli, F. (1999). The human MAGEL2 gene and its mouse homologue are paternally expressed and mapped to the Prader-Willi region. Hum Mol Genet 8, 2497-2505. Bongiorni, S., and Prantera, G. (2003). Imprinted facultative heterochromatization in mealybugs. Genetica 117, 271-279. Bourc'his, D., Xu, G. L., Lin, C. S., Bollman, B., and Bestor, T. H. (2001). Dnmt3L and the establishment of maternal genomic imprints. Science 294, 2536-2539. Boyes, J., and Felsenfeld, G. (1996). Tissue-specific factors additively increase the probability of the all-or-none formation of a hypersensitive site. Embo J 15, 24962507. Brandeis, M., Kafri, T., Ariel, M., Chaillet, J. R., McCarrey, J., Razin, A., and Cedar, H. (1993). The ontogeny of allele-specific methylation associated with imprinted genes in the mouse. Embo J 12, 3669-3677. Brannan, C. I., and Bartolomei, M. S. (1999). Mechanisms of genomic imprinting. Curr Opin Genet Dev 9, 164-170. Bressler, J., Tsai, T. F., Wu, M. Y., Tsai, S. F., Ramirez, M. A., Armstrong, D., and Beaudet, A. L. (2001). The SNRPN promoter is not required for genomic imprinting of the Prader-Willi/Angelman domain in mice. Nat Genet 28, 232-240.
108 Buiting, K., Dittrich, B., Gross, S., Lich, C., Farber, C., Buchholz, T., Smith, E., Reis, A., Burger, J., Nothen, M. M., Barth-Witte, U., Janssen, B., Abeliovich, D., Lerer, I., van den Ouweland, A. M., Halley, D. J., Schrander-Stumpel, C., Smeets, H., Meinecke, P., Malcolm, S., Gardner, A., Lalande, M., Nicholls, R. D., Friend, K., Horsthemke, B. (1998). Sporadic imprinting defects in Prader-Willi syndrome and Angelman syndrome: implications for imprint-switch models, genetic counseling, and prenatal diagnosis. Am J Hum Genet 63, 170-180. Buiting, K., Dittrich, B., Robinson, W. P., Guitart, M., Abeliovich, D., Lerer, I., and Horsthemke, B. (1994). Detection of aberrant DNA methylation in unique PraderWilli syndrome patients and its diagnostic implications. Hum Mol Genet 3, 893895. Buiting, K., Lich, C., Cottrell, S., Barnicoat, A., and Horsthemke, B. (1999). A 5-kb imprinting center deletion in a family with Angelman syndrome reduces the shortest region of deletion overlap to 880 bp. Hum Genet 105, 665-666. Buiting, K., Saitoh, S., Gross, S., Dittrich, B., Schwartz, S., Nicholls, R. D., and Horsthemke, B. (1995). Inherited microdeletions in the Angelman and Prader-Willi syndromes define an imprinting centre on human chromosome 15. Nat Genet 9, 395-400. Butler, M. G., and Palmer, C. G. (1983). Parental origin of chromosome 15 deletion in Prader-Willi syndrome. Lancet 1, 1285-1286. Carlson, L. L., Page, A. W., and Bestor, T. H. (1992). Properties and localization of DNA methyltransferase in preimplantation mouse embryos: implications for genomic imprinting. Genes Dev 6, 2536-2541. Cassidy, S. B., Dykens, E., and Williams, C. A. (2000). Prader-Willi and Angelman syndromes: sister imprinted disorders. Am J Med Genet 97, 136-146. Chai, J. H., Locke, D. P., Ohta, T., Greally, J. M., and Nicholls, R. D. (2001). Retrotransposed genes such as Frat3 in the mouse Chromosome 7C Prader-Willi syndrome region acquire the imprinted status of their insertion site. Mamm Genome 12, 813-821. Chamberlain, S. J., and Brannan, C. I. (2001). The Prader-Willi syndrome imprinting center activates the paternally expressed murine Ube3a antisense transcript but represses paternal Ube3a. Genomics 73, 316-322. Chamberlain, S. J., Johnstone, K. A., DuBose, A. J., Simon, T. A., Bartolomei, M. S., Resnick, J. L., and Brannan, C. I. (2004). Evidence for genetic modifiers of postnatal lethality in PWS-IC deletion mice. Hum Mol Genet 13, 2971-2977. Chen, K.-S., Tsai, T.-F., and L., B. A. (2002). An insertion/duplication mutation 11 kb upstream of snurf-snrpn produces a mouse model of an angelman syndrome imprinting mutation. Paper presented at: ASHG Meeting.
109 Choumenkovitch, S. F., Selhub, J., Bagley, P. J., Maeda, N., Nadeau, M. R., Smith, D. E., and Choi, S. W. (2002). In the cystathionine beta-synthase knockout mouse, elevations in total plasma homocysteine increase tissue S-adenosylhomocysteine, but responses of S-adenosylmethionine and DNA methylation are tissue specific. J Nutr 132, 2157-2160. Christman, J. K., Sheikhnejad, G., Dizik, M., Abileah, S., and Wainfan, E. (1993). Reversibility of changes in nucleic acid methylation and gene expression induced in rat liver by severe dietary methyl deficiency. Carcinogenesis 14, 551-557. Clark, S. J., Harrison, J., Paul, C. L., and Frommer, M. (1994). High sensitivity mapping of methylated cytosines. Nucleic Acids Res 22, 2990-2997. Coffigny, H., Bourgeois, C., Ricoul, M., Bernardino, J., Vilain, A., Niveleau, A., Malfoy, B., and Dutrillaux, B. (1999). Alterations of DNA methylation patterns in germ cells and Sertoli cells from developing mouse testis. Cytogenet Cell Genet 87, 175181. Constancia, M., Hemberger, M., Hughes, J., Dean, W., Ferguson-Smith, A., Fundele, R., Stewart, F., Kelsey, G., Fowden, A., Sibley, C., and Reik, W. (2002). Placentalspecific IGF-II is a major modulator of placental and fetal growth. Nature 417, 945948. Costanzi, C., and Pehrson, J. R. (1998). Histone macroH2A1 is concentrated in the inactive X chromosome of female mammals. Nature 393, 599-601. Cuthbert, G. L., Daujat, S., Snowden, A. W., Erdjument-Bromage, H., Hagiwara, T., Yamada, M., Schneider, R., Gregory, P. D., Tempst, P., Bannister, A. J., and Kouzarides, T. (2004). Histone deimination antagonizes arginine methylation. Cell 118, 545-553. Davis, T. L., Trasler, J. M., Moss, S. B., Yang, G. J., and Bartolomei, M. S. (1999). Acquisition of the H19 methylation imprint occurs differentially on the parental alleles during spermatogenesis. Genomics 58, 18-28. Davis, T. L., Yang, G. J., McCarrey, J. R., and Bartolomei, M. S. (2000). The H19 methylation imprint is erased and re-established differentially on the parental alleles during male germ cell development. Hum Mol Genet 9, 2885-2894. Delaval, K., and Feil, R. (2004). Epigenetic regulation of mammalian genomic imprinting. Curr Op Gen Dev 14, 188-195. Deng, G., Chen, A., Pong, E., and Kim, Y. S. (2001). Methylation in hMLH1 promoter interferes with its binding to transcription factor CBF and inhibits gene expression. Oncogene 20, 7120-7127. Desai, M., and Hales, C. N. (1997). Role of fetal and infant growth in programming metabolism in later life. BiolRevCambPhilosSoc 72, 329-348.
110 Dittrich, B., Buiting, K., Korn, B., Rickard, S., Buxton, J., Saitoh, S., Nicholls, R. D., Poustka, A., Winterpacht, A., Zabel, B., and Horsthemke, B. (1996). Imprint switching on human chromosome 15 may involve alternative transcripts of the SNRPN gene. Nat Genet 14, 163-170. Driscoll, D. J. (1994). Genomic imprinting in humans. Mol Genet Med 4, 37-77. Eden, S., and Cedar, H. (1994). Role of DNA methylation in the regulation of transcription. Curr Opin Genet Dev 4, 255-259. Eden, S., Constancia, M., Hashimshony, T., Dean, W., Goldstein, B., Johnson, A. C., Keshet, I., Reik, W., and Cedar, H. (2001). An upstream repressor element plays a role in Igf2 imprinting. Embo J 20, 3518-3525. El-Maarri, O., Buiting, K., Peery, E. G., Kroisel, P. M., Balaban, B., Wagner, K., Urman, B., Heyd, J., Lich, C., Brannan, C. I., Walter, J., and Horsthemke, B. (2001). Maternal methylation imprints on human chromosome 15 are established during or after fertilization. Nat Genet 27, 341-344. Farber, C., Dittrich, B., Buiting, K., and Horsthemke, B. (1999). The chromosome 15 imprinting centre (IC) region has undergone multiple duplication events and contains an upstream exon of SNRPN that is deleted in all Angelman syndrome patients with an IC microdeletion. Hum Mol Genet 8, 337-343. Farber, C., Gross, S., Neesen, J., Buiting, K., and Horsthemke, B. (2000). Identification of a testis-specific gene (C15orf2) in the Prader-Willi syndrome region on chromosome 15. Genomics 65, 174-183. Fedoriw, A. M., Stein, P., Svoboda, P., Schultz, R. M., and Bartolomei, M. S. (2004). Transgenic RNAi reveals essential function for CTCF in H19 gene imprinting. Science 303, 238-240. Feil, R., and Khosla, S. (1999). Genomic imprinting in mammals: an interplay between chromatin and DNA methylation? Trends Genet 15, 431-435. Fournier, C., Goto, Y., Ballestar, E., Delaval, K., Hever, A. M., Esteller, M., and Feil, R. (2002). Allele-specific histone lysine methylation marks regulatory regions at imprinted mouse genes. Embo J 21, 6560-6570. Fulmer-Smentek, S. B., and Francke, U. (2001). Association of acetylated histones with paternally expressed genes in the Prader--Willi deletion region. Hum Mol Genet 10, 645-652. Gabriel, J. M., Merchant, M., Ohta, T., Ji, Y., Caldwell, R. G., Ramsey, M. J., Tucker, J. D., Longnecker, R., and Nicholls, R. D. (1999). A transgene insertion creating a heritable chromosome deletion mouse model of Prader-Willi and angelman syndromes. Proc Natl Acad Sci U S A 96, 9258-9263.
111 Gallagher, R. C., Pils, B., Albalwi, M., and Francke, U. (2002). Evidence for the role of PWCR1/HBII-85 C/D box small nucleolar RNAs in Prader-Willi syndrome. Am J Hum Genet 71, 669-678. Gerard, M., Hernandez, L., Wevrick, R., and Stewart, C. L. (1999). Disruption of the mouse necdin gene results in early post-natal lethality. Nat Genet 23, 199-202. Geuns, E., De Rycke, M., Van Steirteghem, A., and Liebaers, I. (2003). Methylation imprints of the imprint control region of the SNRPN-gene in human gametes and preimplantation embryos. Hum Mol Genet 12, 2873-2879. Geyer, C. B., Kiefer, C. M., Yang, T. P., and McCarrey, J. R. (2004). Ontogeny of a demethylation domain and its relationship to activation of tissue-specific transcription. Biol Reprod 71, 837-844. Glenn, C. C., Saitoh, S., Jong, M. T., Filbrandt, M. M., Surti, U., Driscoll, D. J., and Nicholls, R. D. (1996). Gene structure, DNA methylation, and imprinted expression of the human SNRPN gene. Am J Hum Genet 58, 335-346. Gomperts, M., Garcia-Castro, M., Wylie, C., and Heasman, J. (1994). Interactions between primordial germ cells play a role in their migration in mouse embryos. Development 120, 135-141. Grandjean, V., O'Neill, L., Sado, T., Turner, B., and Ferguson-Smith, A. (2001). Relationship between DNA methylation, histone H4 acetylation and gene expression in the mouse imprinted Igf2-H19 domain. FEBS Lett 488, 165-169. Grant, P. A. (2001). A tale of histone modifications. Genome Biol 2, REVIEWS0003. Grant, P. A., and Berger, S. L. (1999). Histone acetyltransferase complexes. Semin Cell Dev Biol 10, 169-177. Gray, T. A., Saitoh, S., and Nicholls, R. D. (1999). An imprinted, mammalian bicistronic transcript encodes two independent proteins. Proc Natl Acad Sci U S A 96, 56165621. Greally, J. M., Gray, T. A., Gabriel, J. M., Song, L., Zemel, S., and Nicholls, R. D. (1999). Conserved characteristics of heterochromatin-forming DNA at the 15q11q13 imprinting center. Proc Natl Acad Sci U S A 96, 14430-14435. Gregory, R. I., Randall, T. E., Johnson, C. A., Khosla, S., Hatada, I., O'Neill, L. P., Turner, B. M., and Feil, R. (2001). DNA methylation is linked to deacetylation of histone H3, but not H4, on the imprinted genes Snrpn and U2af1-rs1. Mol Cell Biol 21, 5426-5436. Gribnau, J., Hochedlinger, K., Hata, K., Li, E., and Jaenisch, R. (2003). Asynchronous replication timing of imprinted loci is independent of DNA methylation, but consistent with differential subnuclear localization. Genes Dev 17, 759-773.
112 Gross, D. S., and Garrard, W. T. (1988). Nuclease hypersensitive sites in chromatin. Annu Rev Biochem 57, 159-197. Gugneja, S., Virbasius, C. M., and Scarpulla, R. C. (1996). Nuclear respiratory factors 1 and 2 utilize similar glutamine-containing clusters of hydrophobic residues to activate transcription. Mol Cell Biol 16, 5708-5716. Guo, B., Odgren, P. R., van Wijnen, A. J., Last, T. J., Nickerson, J., Penman, S., Lian, J. B., Stein, J. L., and Stein, G. S. (1995). The nuclear matrix protein NMP-1 is the transcription factor YY1. Proc Natl Acad Sci U S A 92, 10526-10530. Hajkova, P., Erhardt, S., Lane, N., Haaf, T., El-Maarri, O., Reik, W., Walter, J., and Surani, M. A. (2002). Epigenetic reprogramming in mouse primordial germ cells. Mech Dev 117, 15-23. Hanel, M. L., and Wevrick, R. (2001). Establishment and maintenance of DNA methylation patterns in mouse Ndn: implications for maintenance of imprinting in target genes of the imprinting center. Mol Cell Biol 21, 2384-2392. Harikrishnan, K. N., Chow, M. Z., Baker, E. K., Pal, S., Bassal, S., Brasacchio, D., Wang, L., Craig, J. M., Jones, P. L., Sif, S., and El-Osta, A. (2005). Brahma links the SWI/SNF chromatin-remodeling complex with MeCP2-dependent transcriptional silencing. Nat Genet 37, 254-264. Hark, A. T., and Tilghman, S. M. (1998). Chromatin conformation of the H19 epigenetic mark. Hum Mol Genet 7, 1979-1985. Hata, K., Okano, M., Lei, H., and Li, E. (2002). Dnmt3L cooperates with the Dnmt3 family of de novo DNA methyltransferases to establish maternal imprints in mice. Development 129, 1983-1993. Hemberger, M. (2002). The role of the X chromosome in mammalian extra embryonic development. Cytogenet Genome Res 99, 210-217. Henry, I., Bonaiti-Pellie, C., Chehensse, V., Beldjord, C., Schwartz, C., Utermann, G., and Junien, C. (1991). Uniparental paternal disomy in a genetic cancerpredisposing syndrome. Nature 351, 665-667. Hershko, A., Razin, A., and Shemer, R. (1999). Imprinted methylation and its effect on expression of the mouse Zfp127 gene. Gene 234, 323-327. Herzing, L. B., Kim, S. J., Cook, E. H., Jr., and Ledbetter, D. H. (2001). The human aminophospholipid-transporting ATPase gene ATP10C maps adjacent to UBE3A and exhibits similar imprinted expression. Am J Hum Genet 68, 1501-1505. Hogan, B. (1994). Manipulating the mouse embryo : a laboratory manual, 2nd edn (Plainview, N.Y., Cold Spring Harbor Laboratory Press).
113 Hornstra, I. K., and Yang, T. P. (1992). Multiple in vivo footprints are specific to the active allele of the X-linked human hypoxanthine phosphoribosyltransferase gene 5' region: implications for X chromosome inactivation. Mol Cell Biol 12, 53455354. Howell, C. Y., Bestor, T. H., Ding, F., Latham, K. E., Mertineit, C., Trasler, J. M., and Chaillet, J. R. (2001). Genomic imprinting disrupted by a maternal effect mutation in the Dnmt1 gene. Cell 104, 829-838. Howlett, S. K., and Reik, W. (1991). Methylation levels of maternal and paternal genomes during preimplantation development. Development 113, 119-127. Hu, J. F., Oruganti, H., Vu, T. H., and Hoffman, A. R. (1998). Tissue-specific imprinting of the mouse insulin-like growth factor II receptor gene correlates with differential allele-specific DNA methylation. Mol Endocrinol 12, 220-232. Iizuka, M., and Smith, M. M. (2003). Functional consequences of histone modifications. Curr Opin Genet Dev 13, 154-160. Jacob, R. A., Gretz, D. M., Taylor, P. C., James, S. J., Pogribny, I. P., Miller, B. J., Henning, S. M., and Swendseid, M. E. (1998). Moderate folate depletion increases plasma homocysteine and decreases lymphocyte DNA methylation in postmenopausal women. J Nutr 128, 1204-1212. Jaenisch, R., and Bird, A. (2003). Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat Genet 33 Suppl, 245254. Jay, P., Rougeulle, C., Massacrier, A., Moncla, A., Mattei, M. G., Malzac, P., Roeckel, N., Taviaux, S., Lefranc, J. L., Cau, P., Berta, P., Lalande, M., and Muscatelli, F. (1997). The human necdin gene, NDN, is maternally imprinted and located in the Prader-Willi syndrome chromosomal region. Nat Genet 17, 357-361. Jenuwein, T., and Allis, C. D. (2001). Translating the histone code. Science 293, 10741080. Jiang, Y. H., Sahoo, T., Michaelis, R. C., Bercovich, D., Bressler, J., Kashork, C. D., Liu, Q., Shaffer, L. G., Schroer, R. J., Stockton, D. W., Spielman, R. S., Stevenson, R. E., and Beaudet, A. L. (2004). A mixed epigenetic/genetic model for oligogenic inheritance of autism with a limited role for UBE3A. Am J Med Genet A 131, 110. John, R. M., and Surani, M. A. (2000). Genomic imprinting, mammalian evolution, and the mystery of egg-laying mammals. Cell 101, 585-588.
114 Jong, M. T., Carey, A. H., Caldwell, K. A., Lau, M. H., Handel, M. A., Driscoll, D. J., Stewart, C. L., Rinchik, E. M., and Nicholls, R. D. (1999a). Imprinting of a RING zinc-finger encoding gene in the mouse chromosome region homologous to the Prader-Willi syndrome genetic region. Hum Mol Genet 8, 795-803. Jong, M. T., Gray, T. A., Ji, Y., Glenn, C. C., Saitoh, S., Driscoll, D. J., and Nicholls, R. D. (1999b). A novel imprinted gene, encoding a RING zinc-finger protein, and overlapping antisense transcript in the Prader-Willi syndrome critical region. Hum Mol Genet 8, 783-793. Kafri, T., Ariel, M., Brandeis, M., Shemer, R., Urven, L., McCarrey, J., Cedar, H., and Razin, A. (1992). Developmental pattern of gene-specific DNA methylation in the mouse embryo and germ line. Genes Dev 6, 705-714. Kang, S. H., Kiefer, C. M., and Yang, T. P. (2003). Role of the promoter in maintaining transcriptionally active chromatin structure and DNA methylation patterns in vivo. Mol Cell Biol 23, 4150-4161. Kantor, B., Kaufman, Y., Makedonski, K., Razin, A., and Shemer, R. (2004a). Establishing the epigenetic status of the Prader-Willi/Angelman imprinting center in the gametes and embryo. Hum Mol Genet 13, 2767-2779. Kantor, B., Makedonski, K., Green-Finberg, Y., Shemer, R., and Razin, A. (2004b). Control elements within the PWS/AS imprinting box and their function in the imprinting process. Hum Mol Genet 13, 751-762. Kashiwagi, A., Meguro, M., Hoshiya, H., Haruta, M., Ishino, F., Shibahara, T., and Oshimura, M. (2003). Predominant maternal expression of the mouse Atp10c in hippocampus and olfactory bulb. J Hum Genet 48, 194-198. Kawasaki, H., and Taira, K. (2004). Induction of DNA methylation and gene silencing by short interfering RNAs in human cells. Nature 431, 211-217. Khil, P. P., Smirnova, N. A., Romanienko, P. J., and Camerini-Otero, R. D. (2004). The mouse X chromosome is enriched for sex-biased genes not subject to selection by meiotic sex chromosome inactivation. Nat Genet 36, 642-646. Khosla, S., Aitchison, A., Gregory, R., Allen, N. D., and Feil, R. (1999). Parental allelespecific chromatin configuration in a boundary-imprinting-control element upstream of the mouse H19 gene. Mol Cell Biol 19, 2556-2566. Kim, S. H., Kang, Y. K., Koo, D. B., Kang, M. J., Moon, S. J., Lee, K. K., and Han, Y. M. (2004). Differential DNA methylation reprogramming of various repetitive sequences in mouse preimplantation embryos. Biochem Biophys Res Commun 324, 58-63.
115 Kim, Y. I., Pogribny, I. P., Basnakian, A. G., Miller, J. W., Selhub, J., James, S. J., and Mason, J. B. (1997). Folate deficiency in rats induces DNA strand breaks and hypomethylation within the p53 tumor suppressor gene. American Journal of Clinical Nutrition 65, 46-52. Kishino, T., Lalande, M., and Wagstaff, J. (1997). UBE3A/E6-AP mutations cause Angelman syndrome. Nat Genet 15, 70-73. Kitsberg, D., Selig, S., Brandeis, M., Simon, I., Keshet, I., Driscoll, D. J., Nicholls, R. D., and Cedar, H. (1993). Allele-specific replication timing of imprinted gene regions. Nature 364, 459-463. Knoll, J. H., Glatt, K. A., Nicholls, R. D., Malcolm, S., and Lalande, M. (1991). Chromosome 15 uniparental disomy is not frequent in Angelman syndrome. Am J Hum Genet 48, 16-21. Knoll, J. H., Nicholls, R. D., Magenis, R. E., Graham, J. M., Jr., Lalande, M., and Latt, S. A. (1989). Angelman and Prader-Willi syndromes share a common chromosome 15 deletion but differ in parental origin of the deletion. Am J Med Genet 32, 285-290. Koide, T., Ainscough, J., Wijgerde, M., and Surani, M. A. (1994). Comparative analysis of Igf-2/H19 imprinted domain: identification of a highly conserved intergenic DNase I hypersensitive region. Genomics 24, 1-8. Kono, T., Obata, Y., Wu, Q., Niwa, K., Ono, Y., Yamamoto, Y., Park, E. S., Seo, J. S., and Ogawa, H. (2004). Birth of parthenogenetic mice that can develop to adulthood. Nature 428, 860-864. Kubicek, S., and Jenuwein, T. (2004). A crack in histone lysine methylation. Cell 119, 903-906. Landers, M., Bancescu, D. L., Le Meur, E., Rougeulle, C., Glatt-Deeley, H., Brannan, C., Muscatelli, F., and Lalande, M. (2004). Regulation of the large (approximately 1000 kb) imprinted murine Ube3a antisense transcript by alternative exons upstream of Snurf/Snrpn. Nucleic Acids Res 32, 3480-3492. Lane, N., Dean, W., Erhardt, S., Hajkova, P., Surani, A., Walter, J., and Reik, W. (2003). Resistance of IAPs to methylation reprogramming may provide a mechanism for epigenetic inheritance in the mouse. Genesis 35, 88-93. Lau, J. C., Hanel, M. L., and Wevrick, R. (2004). Tissue-specific and imprinted epigenetic modifications of the human NDN gene. Nucleic Acids Res 32, 33763382. Leach, K. M., Vieira, K. F., Kang, S. H., Aslanian, A., Teichmann, M., Roeder, R. G., and Bungert, J. (2003). Characterization of the human beta-globin downstream promoter region. Nucleic Acids Res 31, 1292-1301.
116 Lee, S., Kozlov, S., Hernandez, L., Chamberlain, S. J., Brannan, C. I., Stewart, C. L., and Wevrick, R. (2000). Expression and imprinting of MAGEL2 suggest a role in Prader-willi syndrome and the homologous murine imprinting phenotype. Hum Mol Genet 9, 1813-1819. Li, E. (2002). Chromatin modification and epigenetic reprogramming in mammalian development. Nat Rev Genet 3, 662-673. Lopes, S., Lewis, A., Hajkova, P., Dean, W., Oswald, J., Forne, T., Murrell, A., Constancia, M., Bartolomei, M., Walter, J., and Reik, W. (2003). Epigenetic modifications in an imprinting cluster are controlled by a hierarchy of DMRs suggesting long-range chromatin interactions. Hum Mol Genet 12, 295-305. Lucifero, D., Mann, M. R., Bartolomei, M. S., and Trasler, J. M. (2004). Gene-specific timing and epigenetic memory in oocyte imprinting. Hum Mol Genet 13, 839-849. Lucifero, D., Mertineit, C., Clarke, H. J., Bestor, T. H., and Trasler, J. M. (2002). Methylation dynamics of imprinted genes in mouse germ cells. Genomics 79, 530538. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., and Richmond, T. J. (1997). Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389, 251-260. Lutz, S. E., Hilbish, T. J., and Dewey, M. J. (1989). Genetic control of juvenile growth rate in mice: variation between a congenic strain and its background strain. J Hered 80, 264-267. MacDonald, H. R., and Wevrick, R. (1997). The necdin gene is deleted in Prader-Willi syndrome and is imprinted in human and mouse. Hum Mol Genet 6, 1873-1878. Malandro, M. S., Beveridge, M. J., Kilberg, M. S., and Novak, D. A. (1996). Effect of a low-protein diet induced intrauterine growth retardation on rat placental amino acid transport. American Journal of Physiology 271, C295-C303. Malcolm, S., Clayton-Smith, J., Nichols, M., Robb, S., Webb, T., Armour, J. A., Jeffreys, A. J., and Pembrey, M. E. (1991). Uniparental paternal disomy in Angelman's syndrome. Lancet 337, 694-697. Mann, J. R., Szabo, P. E., Reed, M. R., and Singer-Sam, J. (2000). Methylated DNA sequences in genomic imprinting. Crit Rev Eukaryot Gene Expr 10, 241-257. Mann, M. R., and Bartolomei, M. S. (1999). Towards a molecular understanding of Prader-Willi and Angelman syndromes. Hum Mol Genet 8, 1867-1873. Mann, M. R., Chung, Y. G., Nolen, L. D., Verona, R. I., Latham, K. E., and Bartolomei, M. S. (2003). Disruption of imprinted gene methylation and expression in cloned preimplantation stage mouse embryos. Biol Reprod 69, 902-914.
117 Mann, M. R., Lee, S. S., Doherty, A. S., Verona, R. I., Nolen, L. D., Schultz, R. M., and Bartolomei, M. S. (2004). Selective loss of imprinting in the placenta following preimplantation development in culture. Development 131, 3727-3735. Manzur, K. L., Farooq, A., Zeng, L., Plotnikova, O., Koch, A. W., Sachchidanand, and Zhou, M. M. (2003). A dimeric viral SET domain methyltransferase specific to Lys27 of histone H3. Nat Struct Biol 10, 187-196. Matzke, M. A., and Birchler, J. A. (2005). RNAi-mediated pathways in the nucleus. Nat Rev Genet 6, 24-35. Mayer, W., Niveleau, A., Walter, J., Fundele, R., and Haaf, T. (2000). Demethylation of the zygotic paternal genome. Nature 403, 501-502. McAllister, G., Amara, S. G., and Lerner, M. R. (1988). Tissue-specific expression and cDNA cloning of small nuclear ribonucleoprotein-associated polypeptide N. Proc Natl Acad Sci U S A 85, 5296-5300. McCarrey, J. R., Berg, W. M., Paragioudakis, S. J., Zhang, P. L., Dilworth, D. D., Arnold, B. L., and Rossi, J. J. (1992). Differential transcription of Pgk genes during spermatogenesis in the mouse. Dev Biol 154, 160-168. McCarrey, J. R., Hsu, K. C., Eddy, E. M., Klevecz, R. R., and Bolen, J. L. (1987). Isolation of viable mouse primordial germ cells by antibody-directed flow sorting. J Exp Zool 242, 107-111. McGrath, J., and Solter, D. (1984). Completion of mouse embryogenesis requires both the maternal and paternal genomes. Cell 37, 179-183. Meguro, M., Kashiwagi, A., Mitsuya, K., Nakao, M., Kondo, I., Saitoh, S., and Oshimura, M. (2001a). A novel maternally expressed gene, ATP10C, encodes a putative aminophospholipid translocase associated with Angelman syndrome. Nat Genet 28, 19-20. Meguro, M., Mitsuya, K., Nomura, N., Kohda, M., Kashiwagi, A., Nishigaki, R., Yoshioka, H., Nakao, M., Oishi, M., and Oshimura, M. (2001b). Large-scale evaluation of imprinting status in the Prader-Willi syndrome region: an imprinted direct repeat cluster resembling small nucleolar RNA genes. Hum Mol Genet 10, 383-394. Meneghini, M. D., Wu, M., and Madhani, H. D. (2003). Conserved histone variant H2A.Z protects euchromatin from the ectopic spread of silent heterochromatin. Cell 112, 725-736. Mertineit, C., Yoder, J. A., Taketo, T., Laird, D. W., Trasler, J. M., and Bestor, T. H. (1998). Sex-specific exons control DNA methyltransferase in mammalian germ cells. Development 125, 889-897.
118 Min, J., Zhang, X., Cheng, X., Grewal, S. I., and Xu, R. M. (2002). Structure of the SET domain histone lysine methyltransferase Clr4. Nat Struct Biol 9, 828-832. Monk, M., Boubelik, M., and Lehnert, S. (1987). Temporal and regional changes in DNA methylation in the embryonic, extraembryonic and germ cell lineages during mouse embryo development. Development 99, 371-382. Moore, T., Constancia, M., Zubair, M., Bailleul, B., Feil, R., Sasaki, H., and Reik, W. (1997). Multiple imprinted sense and antisense transcripts, differential methylation and tandem repeats in a putative imprinting control region upstream of mouse Igf2. Proc Natl Acad Sci U S A 94, 12509-12514. Morgan, H. D., Dean, W., Coker, H. A., Reik, W., and Petersen-Mahrt, S. K. (2004). Activation-induced cytidine deaminase deaminates 5-methylcytosine in DNA and is expressed in pluripotent tissues: implications for epigenetic reprogramming. J Biol Chem 279, 52353-52360. Morris, K. V., Chan, S. W., Jacobsen, S. E., and Looney, D. J. (2004). Small interfering RNA-induced transcriptional gene silencing in human cells. Science 305, 12891292. Murrell, A., Heeson, S., Bowden, L., Constancia, M., Dean, W., Kelsey, G., and Reik, W. (2001). An intragenic methylated region in the imprinted Igf2 gene augments transcription. Embo J 2, 1101-1106. Muscatelli, F., Abrous, D. N., Massacrier, A., Boccaccio, I., Le Moal, M., Cau, P., and Cremer, H. (2000). Disruption of the mouse Necdin gene results in hypothalamic and behavioral alterations reminiscent of the human Prader-Willi syndrome. Hum Mol Genet 9, 3101-3110. Nicholls, R. D., and Knepper, J. L. (2001). Genome organization, function, and imprinting in Prader-Willi and Angelman syndromes. Annu Rev Genomics Hum Genet 2, 153-175. Nicholls, R. D., Knoll, J. H., Butler, M. G., Karam, S., and Lalande, M. (1989). Genetic imprinting suggested by maternal heterodisomy in nondeletion Prader-Willi syndrome. Nature 342, 281-285. Nicholls, R. D., Pai, G. S., Gottlieb, W., and Cantu, E. S. (1992). Paternal uniparental disomy of chromosome 15 in a child with Angelman syndrome. Ann Neurol 32, 512-518. Ohta, T., Buiting, K., Kokkonen, H., McCandless, S., Heeger, S., Leisti, H., Driscoll, D. J., Cassidy, S. B., Horsthemke, B., and Nicholls, R. D. (1999a). Molecular mechanism of angelman syndrome in two large families involves an imprinting mutation. Am J Hum Genet 64, 385-396.
119 Ohta, T., Gray, T. A., Rogan, P. K., Buiting, K., Gabriel, J. M., Saitoh, S., Muralidhar, B., Bilienska, B., Krajewska-Walasek, M., Driscoll, D. J., Horsthemke, B., Butler, M.G., and Nicholls, R. D. (1999b). Imprinting-mutation mechanisms in PraderWilli syndrome. Am J Hum Genet 64, 397-413. Okano, M., Bell, D. W., Haber, D. A., and Li, E. (1999). DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99, 247-257. Olek, A., and Walter, J. (1997). The pre-implantation ontogeny of the H19 methylation imprint. Nat Genet 17, 275-276. Oswald, J., Engemann, S., Lane, N., Mayer, W., Olek, A., Fundele, R., Dean, W., Reik, W., and Walter, J. (2000). Active demethylation of the paternal genome in the mouse zygote. Curr Biol 10, 475-478. Palmer, D. K., O'Day, K., Wener, M. H., Andrews, B. S., and Margolis, R. L. (1987). A 17-kD centromere protein (CENP-A) copurifies with nucleosome core particles and with histones. J Cell Biol 104, 805-815. Pant, V., Kurukuti, S., Pugacheva, E., Shamsuddin, S., Mariano, P., Renkawitz, R., Klenova, E., Lobanenkov, V., and Ohlsson, R. (2004). Mutation of a single CTCF target site within the H19 imprinting control region leads to loss of Igf2 imprinting and complex patterns of de novo methylation upon maternal inheritance. Mol Cell Biol 24, 3497-3504. Perk, J., Makedonski, K., Lande, L., Cedar, H., Razin, A., and Shemer, R. (2002). The imprinting mechanism of the Prader-Willi/Angelman regional control center. Embo J 21, 5807-5814. Peterson, C. L., and Laniel, M. A. (2004). Histones and histone modifications. Curr Biol 14, R546-551. Rampersaud, G. C., Kauwell, G. P., Hutson, A. D., Cerda, J. J., and Bailey, L. B. (2000). Genomic DNA methylation decreases in response to moderate folate depletion in elderly women. Am J Clin Nutr 72, 998-1003. Rand, E., and Cedar, H. (2003). Regulation of imprinting: A multi-tiered process. J Cell Biochem 88, 400-407. Razin, A., and Cedar, H. (1994). DNA methylation and genomic imprinting. Cell 77, 473-476. Rees, W. D., Hay, S. M., Brown, D. S., Antipatis, C., and Palmer, R. M. (2000). Maternal protein deficiency causes hypermethylation of DNA in the livers of rat fetuses. J Nutr 130, 1821-1826.
120 Reik, W., Dean, W., and Walter, J. (2001). Epigenetic reprogramming in mammalian development. Science 293, 1089-1093. Reik, W., Santos, F., and Dean, W. (2003). Mammalian epigenomics: reprogramming the genome for development and therapy. Theriogenology 59, 21-32. Reik, W., and Walter, J. (1998). Imprinting mechanisms in mammals. Curr Opin Genet Dev 8, 154-164. Reik, W., and Walter, J. (2001). Evolution of imprinting mechanisms: the battle of the sexes begins in the zygote. Nat Genet 27, 255-256. Reis, A., Dittrich, B., Greger, V., Buiting, K., Lalande, M., Gillessen-Kaesbach, G., Anvret, M., and Horsthemke, B. (1994). Imprinting mutations suggested by abnormal DNA methylation patterns in familial Angelman and Prader-Willi syndromes. Am J Hum Genet 54, 741-747. Rhee, I, Bachman, KE, Park, BH, Jair, K, Yen, RC, Schuebel, KE, Cui, H, Feinberg, AP, Lengauer, C, Kinzler, KW, Baylin, SB, and Vogelstein, B (2002). DNMT1 and DNMT3b cooperate to silence genes in human cancer cells. Nature 416, 552-556. Rhodes, K., Rippe, R. A., Umezawa, A., Nehls, M., Brenner, D. A., and Breindl, M. (1994). DNA methylation represses the murine alpha 1(I) collagen promoter by an indirect mechanism. Mol Cell Biol 14, 5950-5960. Richards, E. J., and Elgin, S. C. (2002). Epigenetic codes for heterochromatin formation and silencing: rounding up the usual suspects. Cell 108, 489-500. Rogakou, E. P., Pilch, D. R., Orr, A. H., Ivanova, V. S., and Bonner, W. M. (1998). DNA double-stranded breaks induce histone H2AX phosphorylation on serine 139. J Biol Chem 273, 5858-5868. Romrell, L. J., Bellve, A. R., and Fawcett, D. W. (1976). Separation of mouse spermatogenic cells by sedimentation velocity. A morphological characterization. Dev Biol 49, 119-131. Rougeulle, C., Glatt, H., and Lalande, M. (1997). The Angelman syndrome candidate gene, UBE3A/E6-AP, is imprinted in brain. Nat Genet 17, 14-15. Rougier, N., Bourc'his, D., Gomes, D. M., Niveleau, A., Plachot, M., Paldi, A., and Viegas-Pequignot, E. (1998). Chromosome methylation patterns during mammalian preimplantation development. Genes Dev 12, 2108-2113. Runte, M., Huttenhofer, A., Gross, S., Kiefmann, M., Horsthemke, B., and Buiting, K. (2001). The IC-SNURF-SNRPN transcript serves as a host for multiple small nucleolar RNA species and as an antisense RNA for UBE3A. Hum Mol Genet 10, 2687-2700.
121 Runte, M., Varon, R., Horn, D., Horsthemke, B., and Buiting, K. (2005). Exclusion of the C/D box snoRNA gene cluster HBII-52 from a major role in Prader-Willi syndrome. Hum Genet 116, 228-230. Saitoh, S., Buiting, K., Rogan, P. K., Buxton, J. L., Driscoll, D. J., Arnemann, J., Konig, R., Malcolm, S., Horsthemke, B., and Nicholls, R. D. (1996). Minimal definition of the imprinting center and fixation of chromosome 15q11-q13 epigenotype by imprinting mutations. Proc Natl Acad Sci U S A 93, 7811-7815. Saitoh, S., and Wada, T. (2000). Parent-of-origin specific histone acetylation and reactivation of a key imprinted gene locus in Prader-Willi syndrome. Am J Hum Genet 66, 1958-1962. Santos, F., and Dean, W. (2004). Epigenetic reprogramming during early development in mammals. Reproduction 127, 643-651. Santos, F., Hendrich, B., Reik, W., and Dean, W. (2002). Dynamic reprogramming of DNA methylation in the early mouse embryo. Dev Biol 241, 172-182. Santos, F., Peters, A. H., Otte, A. P., Reik, W., and Dean, W. (2005). Dynamic chromatin modifications characterise the first cell cycle in mouse embryos. Dev Biol 280, 225-236. Sarma, K., and Reinberg, D. (2005). Histone variants meet their match. Nat Rev Mol Cell Biol 6, 139-149. Scarpulla, R. C. (2002a). Nuclear activators and coactivators in mammalian mitochondrial biogenesis. Biochim Biophys Acta 1576, 1-14. Scarpulla, R. C. (2002b). Transcriptional activators and coactivators in the nuclear control of mitochondrial function in mammalian cells. Gene 286, 81-89. Schoenherr, C. J., Levorse, J. M., and Tilghman, S. M. (2003). CTCF maintains differential methylation at the Igf2/H19 locus. Nat Genet 33, 66-69. Schotta, G., Lachner, M., Peters, A. H., and Jenuwein, T. (2004). The indexing potential of histone lysine methylation. Novartis Found Symp 259, 22-37; discussion 37-47, 163-169. Schweizer, J., Zynger, D., and Francke, U. (1999). In vivo nuclease hypersensitivity studies reveal multiple sites of parental origin-dependent differential chromatin conformation in the 150 kb SNRPN transcription unit. Hum Mol Genet 8, 555-566. Shemer, R., Birger, Y., Riggs, A. D., and Razin, A. (1997). Structure of the imprinted mouse Snrpn gene and establishment of its parental-specific methylation pattern. Proc Natl Acad Sci U S A 94, 10267-10272.
122 Shemer, R., Hershko, A. Y., Perk, J., Mostoslavsky, R., Tsuberi, B., Cedar, H., Buiting, K., and Razin, A. (2000). The imprinting box of the Prader-Willi/Angelman syndrome domain. Nat Genet 26, 440-443. Shi, Y., Lan, F., Matson, C., Mulligan, P., Whetstine, J. R., Cole, P. A., and Casero, R. A. (2004). Histone demethylation mediated by the nuclear amine oxidase homolog LSD1. Cell 119, 941-953. Sibley, C. P., Coan, P. M., Ferguson-Smith, A. C., Dean, W., Hughes, J., Smith, P., Reik, W., Burton, G. J., Fowden, A. L., and Constancia, M. (2004). Placental-specific insulin-like growth factor 2 (Igf2) regulates the diffusional exchange characteristics of the mouse placenta. Proceedings Of The National Academy Of Sciences Of The United States Of America 101, 8204-8208. Simon, I., Tenzen, T., Reubinoff, B. E., Hillman, D., McCarrey, J. R., and Cedar, H. (1999). Asynchronous replication of imprinted genes is established in the gametes and maintained during development. Nature 401, 929-932. Smith, C. M., and Steitz, J. A. (1997). Sno storm in the nucleolus: new roles for myriad small RNPs. Cell 89, 669-672. Spotswood, H. T., and Turner, B. M. (2002). An increasingly complex code. J Clin Invest 110, 577-582. Strauss, W. M. (2000). Preparation of Genomic DNA from Mammalian Tissue. In Current Protocols in Molecular Biology, F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl, eds. (John Wiley & Sons, Inc.), pp. Unit 2.2. Sullivan, K. F., Hechenberger, M., and Masri, K. (1994). Human CENP-A contains a histone H3 related histone fold domain that is required for targeting to the centromere. J Cell Biol 127, 581-592. Surani, M. A., Barton, S. C., and Norris, M. L. (1984). Development of reconstituted mouse eggs suggests imprinting of the genome during gametogenesis. Nature 308, 548-550. Sutcliffe, J. S., Nakao, M., Christian, S., Orstavik, K. H., Tommerup, N., Ledbetter, D. H., and Beaudet, A. L. (1994). Deletions of a differentially methylated CpG island at the SNRPN gene define a putative imprinting control region. Nat Genet 8, 52-58. Svoboda, P., Stein, P., Filipowicz, W., and Schultz, R. M. (2004). Lack of homologous sequence-specific DNA methylation in response to stable dsRNA expression in mouse oocytes. Nucleic Acids Res 32, 3601-3606. Szabo, P. E., and Mann, J. R. (1995). Allele-specific expression and total expression levels of imprinted genes during early mouse development: implications for imprinting mechanisms. Genes Dev 9, 3097-3108.
123 Takagi, N. (2003). Imprinted X-chromosome inactivation: enlightenment from embryos in vivo. Semin Cell Dev Biol 14, 319-329. Takai, D., and Jones, P. A. (2003). The CpG island searcher: a new WWW resource. In Silico Biol 3, 235-240. Talbot, D., Collis, P., Antoniou, M., Vidal, M., Grosveld, F., and Greaves, D. R. (1989). A dominant control region from the human beta-globin locus conferring integration site-independent gene expression. Nature 338, 352-355. Thorvaldsen, J. L., Duran, K. L., and Bartolomei, M. S. (1998). Deletion of the H19 differentially methylated domain results in loss of imprinted expression of H19 and Igf2. Genes Dev 12, 3693-3702. Trasler, J. M., Hake, L. E., Johnson, P. A., Alcivar, A. A., Millette, C. F., and Hecht, N. B. (1990). DNA methylation and demethylation events during meiotic prophase in the mouse testis. Mol Cell Biol 10, 1828-1834. Tremblay, K. D., Duran, K. L., and Bartolomei, M. S. (1997). A 5' 2-kilobase-pair region of the imprinted mouse H19 gene exhibits exclusive paternal methylation throughout development. Mol Cell Biol 17, 4322-4329. Tsai, T. F., Armstrong, D., and Beaudet, A. L. (1999a). Necdin-deficient mice do not show lethality or the obesity and infertility of Prader-Willi syndrome. Nat Genet 22, 15-16. Tsai, T. F., Jiang, Y. H., Bressler, J., Armstrong, D., and Beaudet, A. L. (1999b). Paternal deletion from Snrpn to Ube3a in the mouse causes hypotonia, growth retardation and partial lethality and provides evidence for a gene contributing to Prader-Willi syndrome. Hum Mol Genet 8, 1357-1364. Ueda, T., Abe, K., Miura, A., Yuzuriha, M., Zubair, M., Noguchi, M., Niwa, K., Kawase, Y., Kono, T., Matsuda, Y., Fujimoto, H., Shibata, H., Hayashizaki, Y., and Sasaki, H. (2000). The paternal methylation imprint of the mouse H19 locus is acquired in the gonocyte stage during foetal testis development. Genes Cells 5, 649-659. Verona, R. I., Mann, M. R., and Bartolomei, M. S. (2003). Genomic imprinting: intricacies of epigenetic regulation in clusters. Annu Rev Cell Dev Biol 19, 237259. Vu, T. H., and Hoffman, A. R. (1997). Imprinting of the Angelman syndrome gene, UBE3A, is restricted to brain. Nat Genet 17, 12-13. Wakeland, E., Morel, L., Achey, K., Yui, M., and Longmate, J. (1997). Speed congenics: a classic technique in the fast lane (relatively speaking). Immunol Today 18, 472477.
124 Wang, Y., Wysocka, J., Sayegh, J., Lee, Y. H., Perlin, J. R., Leonelli, L., Sonbuchner, L. S., McDonald, C. H., Cook, R. G., Dou, Y., Roeder, R. G., Clark, S., Stallcup, M. R., Allis, C. D., and Coonrod, S. A. (2004). Human PAD4 regulates histone arginine methylation levels via demethylimination. Science 306, 279-283. Warnecke, P. M., Mann, J. R., Frommer, M., and Clark, S. J. (1998). Bisulfite sequencing in preimplantation embryos: DNA methylation profile of the upstream region of the mouse imprinted H19 gene. Genomics 51, 182-190. Wassenegger, M., Heimes, S., Riedel, L., and Sanger, H. L. (1994). RNA-directed de novo methylation of genomic sequences in plants. Cell 76, 567-576. Watanabe, H., Sawada, J., Yano, K., Yamaguchi, K., Goto, M., and Handa, H. (1993). cDNA cloning of transcription factor E4TF1 subunits with Ets and notch motifs. Mol Cell Biol 13, 1385-1391. Watanabe, T., Yoshimura, A., Mishima, Y., Endo, Y., Shiroishi, T., Koide, T., Sasaki, H., Asakura, H., and Kominami, R. (2000). Differential chromatin packaging of genomic imprinted regions between expressed and non-expressed alleles. Hum Mol Genet 9, 3029-3035. Weber, M., Hagege, H., Murrell, A., Brunel, C., Reik, W., Cathala, G., and Forne, T. (2003). Genomic imprinting controls matrix attachment regions in the Igf2 gene. Mol Cell Biol 23, 8953-8959. Wevrick, R., and Francke, U. (1997). An imprinted mouse transcript homologous to the human imprinted in Prader-Willi syndrome (IPW) gene. Hum Mol Genet 6, 325332. Wevrick, R., Kerns, J. A., and Francke, U. (1994). Identification of a novel paternally expressed gene in the Prader-Willi syndrome region. Hum Mol Genet 3, 18771882. Williams, C. A., Zori, R. T., Stone, J. W., Gray, B. A., Cantu, E. S., and Ostrer, H. (1990). Maternal origin of 15q11-13 deletions in Angelman syndrome suggests a role for genomic imprinting. Am J Med Genet 35, 350-353. Wirth, J., Back, E., Huttenhofer, A., Nothwang, H. G., Lich, C., Gross, S., Menzel, C., Schinzel, A., Kioschis, P., Tommerup, N., Ropers, H. H., Horsthemke, B., and Buiting, K. (2001). A translocation breakpoint cluster disrupts the newly defined 3' end of the SNURF-SNRPN transcription unit on chromosome 15. Hum Mol Genet 10, 201-210. Wolffe, A. P., Urnov, F. D., and Guschin, D. (2000). Co-repressor complexes and remodelling chromatin for repression. Biochem Soc Trans 28, 379-386. Wu, C.-t., and Morris, J. R. (2001). Genes, Genetics, and Epigenetics: A Correspondence. Science 293, 1103-1105.
125 Xin, Z., Allis, C. D., and Wagstaff, J. (2001). Parent-specific complementary patterns of histone H3 lysine 9 and H3 lysine 4 methylation at the Prader-Willi syndrome imprinting center. Am J Hum Genet 69, 1389-1394. Xin, Z., Tachibana, M., Guggiari, M., Heard, E., Shinkai, Y., and Wagstaff, J. (2003). Role of histone methyltransferase G9a in CpG methylation of the Prader-Willi syndrome imprinting center. J Biol Chem 278, 14996-15000. Xu, G. L., Bestor, T. H., Bourc'his, D., Hsieh, C. L., Tommerup, N., Bugge, M., Hulten, M., Qu, X., Russo, J. J., and Viegas-Pequignot, E. (1999). Chromosome instability and immunodeficiency syndrome caused by mutations in a DNA methyltransferase gene. Nature 402, 187-191. Yang, T., Adamson, T. E., Resnick, J. L., Leff, S., Wevrick, R., Francke, U., Jenkins, N. A., Copeland, N. G., and Brannan, C. I. (1998). A mouse model for Prader-Willi syndrome imprinting-centre mutations. Nat Genet 19, 25-31. Yang, Y., Li, T., Vu, T. H., Ulaner, G. A., Hu, J. F., and Hoffman, A. R. (2003). The histone code regulating expression of the imprinted mouse Igf2r gene. Endocrinology 144, 5658-5670. Yoder, J. A., Soman, N. S., Verdine, G. L., and Bestor, T. H. (1997). DNA (cytosine-5)methyltransferases in mouse cells and tissues. Studies with a mechanism-based probe. J Mol Biol 270, 385-395. Yu, W., Ginjala, V., Pant, V., Chernukhin, I., Whitehead, J., Docquier, F., Farrar, D., Tavoosidana, G., Mukhopadhyay, R., Kanduri, C., Oshimura, M., Feinberg, A. P., Lobanenkov, V., Klenova, E., and Ohlsson, R. (2004). Poly(ADP-ribosyl)ation regulates CTCF-dependent chromatin insulation. Nat Genet 36, 1105-1110. Zapisek, W. F., Cronin, G. M., Lyn-Cook, B. D., and Poirier, L. A. (1992). The onset of oncogene hypomethylation in the livers of rats fed methyl-deficient, amino aciddefined diets. Carcinogenesis 13, 1869-1872.
BIOGRAPHICAL SKETCH Christine Mione Kiefer was born Christine Mione in Ft. Lauderdale, FL, to Bobbie and Bal Mione. She became interested in a career in science after successfully competing in a science fair competition at the international level during high school, under the guidance of an incredibly talented high school teacher, Mrs. Beverly Grimm. Christine attended Florida Atlantic University, where she earned a B.S. in microbiology and graduated cum laude with a B.A. in chemistry in 1998. She attended graduate school at the University of Florida College of Medicine and worked in the lab of Dr. Thomas P. Yang on epigenetic gene regulation and genomic imprinting. Christine will continue her scientific career as a postdoctoral fellow and looks forward to ultimately earning a permanent position in academia.
126
