The Nuclear Factor YY1 Suppresses the Human Gamma ... - NCBI

MOLECULAR AND CELLULAR BIOLOGY, Sept. 1996, p. 4744–4753 0270-7306/96/$04.0010 Copyright q 1996, American Society for Microbiology

Vol. 16, No. 9

The Nuclear Factor YY1 Suppresses the Human Gamma Interferon Promoter through Two Mechanisms: Inhibition of AP1 Binding and Activation of a Silencer Element JIANPING YE,1† MARCO CIPPITELLI,2 LINDA DORMAN,2 JOHN R. ORTALDO,1 1 AND HOWARD A. YOUNG * Laboratory of Experimental Immunology, Division of Basic Sciences,1 and Intramural Research Support Program, SAIC Frederick,2 National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, Maryland 21702-1201 Received 8 February 1996/Returned for modification 10 April 1996/Accepted 29 May 1996

Our group has previously reported that the nuclear factor Yin-Yang 1 (YY1), a ubiquitous DNA-binding protein, is able to interact with a silencer element (BE) in the gamma interferon (IFN-g) promoter region. In this study, we demonstrated that YY1 can directly inhibit the activity of the IFN-g promoter by interacting with multiple sites in the promoter. In cotransfection assays, a YY1 expression vector significantly inhibited IFN-g promoter activity. Mutation of the YY1 binding site in the native IFN-g promoter was associated with an increase in the IFN-g promoter activity. Analysis of the DNA sequences of the IFN-g promoter revealed a second functional YY1 binding site (BED) that overlaps with an AP1 binding site. In this element, AP1 enhancer activity was suppressed by YY1. Since the nuclear level of YY1 does not change upon cell activation, our data support a model that the nuclear factor YY1 acts to suppress basal IFN-g transcription by interacting with the promoter at multiple DNA binding sites. This repression can occur through two mechanisms: (i) cooperation with an as-yet-unidentified AP2-like repressor protein and (ii) competition for DNA binding with the transactivating factor AP1. initiate transcription when positioned at transcription initiation sites (3, 41, 42). In contrast to the apparent dual effects of YY1, AP1 is a heterodimer nuclear protein composed of the proto-oncogene products c-Jun and c-Fos (1, 2, 15) and is involved in regulation of cell proliferation induced by growth factors (2) or of tumor promotion induced by phorbol ester (8). AP1 also plays an important role in the transcriptional regulation of cytokine genes that contain AP1 activation elements in their promoters (12, 37). It has been documented that in cytokine gene regulation, AP1 mediates positive transactivation through binding to DNA either independently or in association with NF-AT (32, 37). In a previous study characterizing a silencer element (BE) in the IFN-g promoter, we observed that YY1 could bind to this region as part of a protein complex (49). In this report, we provide evidence that YY1 binds to at least two regions of the IFN-g promoter and may act as a repressor of basal IFN-g transcription by two mechanisms: (i) activation of the BE silencer element in cooperation with an AP2-like nuclear protein and (ii) repression of AP1 activity by blockage of its interaction with DNA.

Interferons are a small group of cytokines that include alpha interferon (IFN-a), IFN-b, and IFN-g. Of these three interferons, IFN-g plays the most important role in regulating immune system development and function (53). Physiological production of IFN-g is largely restricted to T lymphocytes and natural killer (NK) cells. Specific extracellular signals, including interleukin-2 (IL-2), IL-12, and activation through the Tcell receptor, induce IFN-g gene expression, and spontaneous, uninduced expression is not generally observed (53). This suggests that IFN-g gene expression is tightly regulated. Furthermore, aberrant expression of IFN-g in the bone marrow of transgenic animals is detrimental to the host (unpublished observation). Thus, mechanisms to suppress IFN-g gene expression may be an important physiological means of transcriptional control. YY1 is a zinc finger transcription factor that belongs to the human GLI-Kru ¨ppel family of nuclear proteins (42). YY1 can either repress or activate transcription, depending upon the promoter context (14, 42). As a negative regulator, YY1 has been reported to repress transcription of several cellular genes, including those for skeletal a-actin (22), b-casein (29, 38), c-Fos (13, 31), and ε-globin (36). YY1 has also been shown to repress viral gene transcription by interacting with the human papillomavirus promoter (4, 28) as well as the Moloney murine leukemia virus (9) and human immunodeficiency virus type 1 (25) long terminal repeats. As a positive regulator, YY1 has been shown to activate c-Myc (39) and ribosomal protein (16) genes. In addition, YY1 has been demonstrated to direct and

MATERIALS AND METHODS Oligonucleotides. Oligonucleotides were synthesized by the phosphoramidite method on a DNA/RNA Synthesizer (model 392; Applied Biosystems, Foster City, Calif.). The synthesized oligonucleotides were deprotected at 508C overnight. Complementary strands were denatured at 808C for 5 min and annealed at room temperature. The double-stranded probe was labeled with [32P]dCTP (Amersham, Arlington Heights, Ill.) by using Klenow fragment (Bethesda Research Laboratories, Gaithersburg, Md.). The oligonucleotides used in this study and their sequences are as follows: a YY1 binding site in the Moloney murine leukemia virus gene (9), 59-TGCCTTGCAAAATGGCGTTACTGCAG-39; an AP1 binding site in the collagenase gene promoter (1), 59-ATGAGTCAGACA CCTCTGGCTTTCTGGAAG-39; an Sp1 binding site in the human immunodeficiency virus long terminal repeat (46), 59-GGGAGGCGTGGCCTGGGCGG GACTGGGGAGTGGCGA-39; an AP2 binding site from simian virus 40 (17), 59-GGTGTGGAAAGTCCCCAGGCTCCCCAGCAC-39; a serum response el-

* Corresponding author. Mailing address: NCI-FCRDC, Bldg. 560, Rm. 31-93, Frederick, MD 21702-1201. Phone: (301) 846-5700. Fax: (301) 846-1673. † Present address: Oncology Center, Johns Hopkins University, Baltimore, MD 21231. 4744

VOL. 16, 1996

INHIBITION OF IFN-g PROMOTER ACTIVITY

ement in the c-Fos promoter (13), 59-GGATGTCCATATTAGGACATCT-39; and an NF-kB binding site in the IL-2 receptor alpha chain promoter (46), 59-GCAGGGGAATCTCCCTC-39. Tissue culture. Jurkat cells (a CD41 human T-lymphoblast cell line) and YT cells (a human NK cell line) were cultured in RPMI 1640 supplemented with 10% fetal calf serum, 2 mM glutamine, and 100 U of penicillin-streptomycin per ml (complete medium). Antibodies and recombinant nuclear proteins. Antibodies against nuclear proteins YY1, c-Jun, c-Fos, Sp1, and AP2 were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, Calif.) and were used in the supershift assays. Recombinant human c-Jun and c-Fos proteins were gifts from Tom Kerppola (Howard Hughes Medical Institute Research Laboratories, University of Michigan Medical Center, Ann Arbor). Recombinant Sp1 and AP2 proteins were purchased from Promega Corporation (Madison, Wis.). Recombinant YY1 protein was prepared from a glutathione S-transferase (GST)–YY1 expression vector (a gift from Tom Shenk, Department of Biology, Princeton University, Princeton, N.J.) by utilizing glutathione-Sepharose and trypsin as detailed by the manufacturer (Pharmacia, Piscataway, N.J.). Nuclear extraction procedure. The nuclear extracts were prepared as follows (51). Cells (5 3 107) were treated with 500 ml of lysis buffer (50 mM KCl, 0.5% Nonidet P-40, 25 mM HEPES [N-2-hydroxyethylpiperazine-N9-2-ethanesulfonic acid] [pH 7.8], 1 mM phenylmethylsulfonyl fluoride, 10 mg of leupeptin per ml, 20 mg of aprotinin per ml, 100 mM dithiothreitol) on ice for 4 min. After 1 min of centrifugation at 14,000 rpm, the supernatant was saved as a cytoplasmic extract. The nuclei were washed once with the same volume of buffer without Nonidet P-40 and then were put into a 300-ml volume of extraction buffer (500 mM KCl and 10% glycerol with the same concentrations of HEPES, phenylmethylsulfonyl fluoride, leupeptin, aprotinin, and dithiothreitol as in the lysis buffer) and pipetted several times. After centrifugation at 14,000 rpm for 5 min, the supernatant was harvested as the nuclear protein extract and stored at 2708C. The protein concentration was determined with the bicinchoninic acid protein assay reagent (Pierce, Rockford, Ill.). Electrophoretic mobility shift assay (EMSA). The DNA-protein binding reaction was conducted in a 24-ml reaction mixture including 1 mg of poly(dI z dC) or 1.7 mg of poly(dG z dC) (Sigma), 3 mg of nuclear protein extract, 3 mg of bovine serum albumin (BSA), 4 3 104 cpm of 32P-labeled oligonucleotide probe, and 12 ml of 23 Y buffer (49) or 23 E buffer (40 mM Tris [pH 7.4], 8% Ficoll 400, 4 mM EDTA, 1 mM dithiothreitol). In some cases double-stranded oligomer, in the amounts indicated in Results, was added as a cold competitor. This mixture was incubated on ice for 10 min without antibody or for 20 min with antibody in the absence of the radiolabeled probe and then for 20 min at room temperature in the presence of the radiolabeled probe and resolved on a 5% acrylamide gel (National Diagnostics, Atlanta, Ga.) that had been prerun at 110 V for 1 h with 0.53 Tris-borate-EDTA buffer. The loaded gel was run at 210 V for 90 min and then dried and placed on Kodak X-OMAT film (Eastman Kodak, Rochester, N.Y.). The film was developed after overnight exposure at 2708C. DNA constructs. Two reporter gene vectors were used in this study: (i) pEQ3, a b-galactosidase expression vector (34) used to examine IFN-g promoter activity, and (ii) pGL2-control vector, a luciferase expression vector containing the simian virus 40 promoter (Promega Corporation). The latter vector was used for monitoring transfection efficiency in transfection experiments. The CMV-YY1 expression vector and its control pCEP vector have been described elsewhere (9). Transfection assays. The Jurkat T cells or YT cells were grown in complete medium as described above, and 5 3 106 cells were transiently transfected with 5 to 10 mg (Jurkat) or 2.5 mg (YT) of the reporter gene vector with DEAEdextran (12). A 0.5-mg quantity of luciferase expression vector was used as an internal control. After transfection, the cells were washed once in phosphatebuffered saline solution and cultured in 10 ml of complete medium at 378C for 24 h. The cells were then stimulated with phorbol myristate acetate (PMA) (10 ng/ml) plus ionomycin (1 mg/ml) for 12 h. The cells were then harvested and disrupted by freezing and thawing three times, and the cell lysate was used for reporter gene analysis. The b-galactosidase assay was carried out according to a published method (49). b-Galactosidase activities were normalized by protein amount and luciferase activity at each point, and a mean value from three individual experiments was analyzed by Student’s t test with a confidence level of P , 0.05 to 0.0001.

RESULTS Suppressive activity of YY1 on the IFN-g promoter. YY1 has been shown to suppress a variety of gene promoters (14, 43), and we have reported that YY1 could bind to a silencer element in the human IFN-g promoter (49). To characterize the biological activity of YY1 in the regulation of IFN-g promoter activity, we cotransfected a YY1 expression vector with b-galactosidase expression vectors driven by the IFN-g promoter. In these experiments, the reporter constructs containing positions 2538 to 164 and 2337 to 164 of the IFN-g promoter were downregulated by the YY1 expression vector,

4745

FIG. 1. Activity of YY1 on the IFN-g promoter. b-Galactosidase (b-gal.) reporter vectors containing different lengths of the IFN-g promoter (2538, 2337, and 2108) were cotransfected into Jurkat cells with the YY1 expression vector. The ratio between reporter vector and YY1 expression vector DNA is 2:1. Each bar represents the mean value from three individual transfection assays with the standard deviation. Solid bars, control; cross-hatched bars, with YY1.

while a third construct, containing positions 2108 to 164 of the IFN-g promoter, was unaffected (Fig. 1). These results indicate that YY1 may serve as a repressor of the IFN-g gene promoter. Since the negative response was abrogated by deletion of a promoter sequence from position 2337 to 2108 but was not affected by deletion of a promoter sequence from position 2538 to 2337, these data indicate that the YY1 response element was localized in a region between positions 2337 and 2108. Identification of YY1 binding sites in the IFN-g promoter. To search for YY1 binding sites in this region of the IFN-g promoter, we used a consensus YY1 binding sequence (CCA TT) for computer analysis of the IFN-g promoter. Three YY1 binding sequences were identified in a region between positions 2271 and 2186 (Fig. 2A). Of the three YY1 sites, one is in the BE silencer region previously reported by our group (49), while one is located upstream (BEU) and another is located downstream (BED) of the BE region. For clarity, we have designated the YY1 site in the BED region Y1, the site in the BE region Y2, and the site in the BEU region Y3. We have previously demonstrated that Y2 could act as a YY1 binding site (49). To examine whether BED and BEU also exhibit YY1 binding activity, we synthesized oligonucleotides corresponding to these regions and used them as probes in an EMSA with Jurkat T-cell nuclear extracts. The oligonucleotide containing the Y3 site (BEU) demonstrated only a very weak nuclear protein binding activity (data not shown) and was not further investigated. The oligonucleotide containing the Y1 site (BED) formed two specific DNA-protein complexes (complexes A and C) with a nuclear extract from unstimulated Jurkat cells (Fig. 2B, lanes 1 to 3) and one additional specific complex (complex B) when a nuclear extract prepared from PMA-ionomycin-stimulated Jurkat cells was tested (Fig. 2B, lanes 4 to 6). These results indicated that complexes A and C are constitutive and that complex B could be induced by stimulation with PMA plus ionomycin. Two additional weak complexes between complex C and the free probe were observed but were not analyzed in this study. Characterization of nuclear proteins in the BE and BED DNA-protein complexes. In a previous study, we demonstrated

4746

YE ET AL.

FIG. 2. EMSA pattern of the BED region. (A) Positions and nomenclature of the YY1 binding sites and related regions. YY1 binding sequences are underlined. (B) EMSA of the BED region. A 32P-labeled BED oligonucleotide was used with 23 Y buffer to detect specific nuclear proteins in the Jurkat nuclear extracts. One hundred nanograms of cold oligonucleotide was used as a competitor as indicated at the top of the lanes. P/I, PMA-ionomycin.

that the BE region could form two different complexes, S and E, when two different EMSA reaction buffers were used and that YY1 was involved in the formation of complex E. By further modification of the EMSA protocol, we can now observe both the S and E complexes with a single EMSA reaction buffer (23 E buffer) (Fig. 3A, lane 1). To characterize the DNA-protein complexes, two YY1 binding oligonucleotides, YY1 and SRE, with different binding affinities for YY1, and one AP2 binding oligonucleotide were used as competitors. The results showed that YY1 complex was eliminated by the two cold authentic YY1 binding oligonucleotides (Fig. 3A, lanes 2 and 4) and reduced by the YY1 antibody (Fig. 3A, lane 6). The S complex was eliminated by the cold authentic AP2 binding oligonucleotide (Fig. 3A, lane 3) but was not removed by the anti-AP2 antibody. These two complexes were not affected by the Sp1 binding oligonucleotide (nonspecific competitor) (Fig. 3A, lane 5) or the anti-Sp1 and anti-c-Myc antibodies (nonspecific antibodies) (Fig. 3A, lanes 8 and 9). These results are consistent with our previous observations that the BE region could form two specific complexes: one complex containing YY1 (the E complex, now referred to as the YY1 complex) and the other containing an AP2-like nuclear protein (the S complex, now referred to as the AP2-like complex) (49). To further characterize the AP2-like nuclear factor, a recombinant AP2 protein was used in an EMSA with the radiolabeled BE probe, and a radiolabeled AP2 binding oligonucle-

MOL. CELL. BIOL.

otide was used as a control probe. The results demonstrate that the AP2 protein could form a specific complex with the BE oligonucleotide, as confirmed by a supershift analysis with the AP2 antibody but not with the Sp1 antibody (Fig. 3B, lanes 1 to 3). The same results were observed with the control AP2 probe (Fig. 3B, lanes 4 and 5). Combined with the competition observed with the AP2 oligonucleotide, this result supports the hypothesis that the AP2-like protein does share DNA binding specificity with AP2, but as seen in Fig. 3, there is an obvious difference in the DNA binding affinities of these two proteins. Since BE exhibits a much lower affinity for AP2 (Fig. 3B, lanes 1 and 4) and BE binds only to the AP2-like protein in the cell nuclear extract even under stimulation conditions that can induce AP2 DNA binding activity (49), the results indicate that the AP2-like protein has much higher affinity for the BE region than AP2, although both proteins can bind to the region. To characterize the nuclear factors involved in formation of the BED complexes, we performed an extensive analysis of the complexes by utilizing both oligonucleotide competition and antibody supershift analysis. In these experiments, PMA-ionomycin-stimulated Jurkat cell nuclear extracts were used in order to directly compare complexes A, B, and C (Fig. 3C). Complex A contains Sp1, since the formation of this complex was eliminated by addition of the unlabeled Sp1 binding oligonucleotide (Fig. 3C, lane 2) and since the complex was removed by the anti-Sp1 antibody (Fig. 3C, lane 6) but was not removed by antibodies against AP2, c-Jun, c-Fos, and YY1 (Fig. 3C, lanes 7 to 10). The nuclear factor involved in the formation of complex B appears to be AP1, since this complex was eliminated by the unlabeled AP1 binding oligonucleotide (Fig. 3C, and 3), removed by the anti-c-Jun antibody (Fig. 3C, lane 8), and supershifted by the anti-c-Fos antibody (Fig. 3C, lane 9) but was not affected by Sp1 (lane 6), AP2 (lane 7), and YY1 (lane 10) antibodies. Complex C was found to contain YY1, as indicated by both competition and supershift results (Fig. 3C, lanes 4 and 10). These three complexes were not affected by the NF-kB binding oligonucleotide (Fig. 3C, lane 5). To confirm the Sp1 binding capacity of the BED region, a recombinant Sp1 protein was used in an EMSA with the radiolabeled BED probe. The result demonstrates that the BED region does have Sp1 binding capacity, since the BED probe formed a specific complex with the recombinant Sp1 protein that was supershifted by the Sp1 antibody but not by the AP2 antibody (Fig. 3D). The AP1 and YY1 binding capacities of the BED region were confirmed in a similar way, as described below. Point mutation analysis of the YY1 binding site in the IFN-g promoter. Since the YY1 response elements were located in a region between positions 2337 and 2108 in the IFN-g promoter and since two (Y1 and Y2) of three YY1 binding sequences exhibited strong binding affinity for the nuclear factor YY1, we next analyzed the functional roles of these sites in the IFN-g promoter. To address this question, we generated four mutants of the IFN-g promoter by deletion or point mutation at the YY1 binding sites and examined their promoter activities by transient transfection of Jurkat cells. The results show that deletion of promoter sequences 2337 to 2226 resulted in a decreased promoter activity (Fig. 4A, 2225). Promoter construct 2225 was therefore utilized as the basis for analysis of the effects of mutation of the Y1 and Y2 sites on promoter activity. After deletion of Y2 (2221 Y2D), there was a modest increase in activity. However, upon point mutation of Y1 (2225 Y1D), a threefold increase in promoter activity was observed. Point mutation of both Y1 and Y2 in the promoter 2225 [2225 (Y11Y2)D] resulted in a similar threefold en-

VOL. 16, 1996


4747

FIG. 3. Characterization of nuclear proteins in the BE-protein and BED-protein complexes. (A) A 32P-labeled BE oligonucleotide (Oligo.) was used with 23 E buffer to characterize the YY1 and AP2-like complexes in the Jurkat nuclear extracts. For oligonucleotide competition, 100 ng of unlabeled oligonucleotide was used as indicated. In supershift assays, 200 ng of antibody (a) was used as indicated. (B) Weak binding of the BE oligonucleotide to recombinant AP2 protein. A 32P-labeled BE oligonucleotide was used as a probe with the purified recombinant nuclear factor AP2 in an EMSA (lanes 1 to 3) in which the DNA-protein interaction was carried out under binding conditions of 10 ng of AP2 protein, 0.25 mg of poly(dI z dC), 5% glycerol, 5 mM MgCl2, 60 mM KCl, 1 mM EDTA, 100 mg of BSA per ml, 12 mM HEPES (pH 7.8), and 0.1% Nonidet P-40 in 20 ml of reaction mixture. For supershift analysis, 200 ng of antibody was used in each reaction. A 32P-labeled AP2 binding oligonucleotide was used as a control probe (lanes 4 to 6). (C) A 32P-labeled BED oligonucleotide was used with 23 Y buffer to characterize the DNA-protein complex in the Jurkat nuclear proteins. For oligonucleotide competition, 100 ng of unlabeled oligonucleotide was used as indicated. In supershift assays, 200 ng of antibody was used. (D) Binding of BED oligonucleotide to the purified recombinant Sp1 protein. In this EMSA, the DNA-protein interaction was conducted under the same conditions as for panel B.

hancement of the promoter activity. These results indicate that Y1 and Y2 both could serve as silencers in the IFN-g promoter, but the silencer activity of Y2 may be dependent on the presence of Y1, since wild-type Y2 alone did not exhibit any inhibitory activity (2225 Y1D). YY1 suppresses AP1 activity in the BED region. The suppressive activity of YY1 in transcriptional regulation has been well documented (43), but the mechanisms involved in this activity have not been fully elucidated. Since the YY1 sites are responsible for suppression of the IFN-g promoter activity, we initiated experiments to investigate the mechanisms underlying the suppression. Since AP1 normally plays a positive role in regulating gene expression, we investigated whether YY1 could suppress AP1 activity in the IFN-g promoter. Cotransfection of a c-jun or YY1 expression vector, together or separately, with an IFN-g promoter-controlled reporter vector was

conducted with YT cells, a human NK cell line. This cell line was chosen because it produces low constitutive levels of IFN-g, and EMSA experiments indicate that it has less endogenous YY1 than Jurkat cells (data not shown). Additionally, since the IFN-g promoter has activity in YT cells in the absence of stimulation (Fig. 4B), we believed that cotransfection of the promoter with a c-jun or YY1 expression vector in this cell line would provide convincing data to support antagonism between AP1 and YY1 in the IFN-g promoter. The results showed that expression of YY1 could reduce the promoter activity but that this negative effect could be abrogated by overexpression of c-jun (Fig. 4B). In contrast, overexpression of c-jun could upregulate IFN-g promoter activity, and this positive regulation could be blocked by YY1 overexpression. These data indicate that YY1 could suppress AP1 activity in the IFN-g promoter.

4748

YE ET AL.

FIG. 4. (A) Point mutation analysis of the YY1 binding sites in the IFN-g promoter. Point mutations in the IFN-g promoter YY1 binding site were generated by PCR. The 59 primers utilized were 59-TGCAAGCTTCTAGACCAG AATGGCACAGGTGGGCA-39 for 2225, 59-TGCAAGCTTCTAGAGCATA ATGGGTCTGTCTC-39 for 2211 Y2D, 59-TGCAAGCTTCTAGACCAGAAT GGCACAGGTGGGCATAATCAGTCTGTCTC-39 for 2225 Y1D, and 59-TG CAAGCTTCTAGACCAGAATCACACAGGTGGGCATAATCAGTCTGTC TC-39 for 2225 (Y11Y2)D. A common 39 primer, 59-ATTCTAGAGGATCCC CAAAGGACTTACTGATCT-39, was used in all reactions. The PCR products were digested with XbaI and BamHI and then subcloned into the pEQ3 vector. The restriction enzyme-cut sites and substituted bases are underlined. Promoter activities of the constructs were measured by transfection into Jurkat cells as stated in Materials and Methods. Each bar represents the mean value from three different transfection experiments with the standard deviation. b-gal., b-galactosidase. (B) Cotransfection assay of c-jun and YY1 expression vectors. YT cells (5 3 105/ml) were transfected with 2.5 mg of the p337 IFN-g promoter b-galactosidase reporter vector. Different amounts of YY1 or c-jun expression vector were used in the cotransfection experiments as indicated. The pCEP vector was used to normalize total DNA amounts to 17.5 mg at each point. Each bar represents the mean value of b-galactosidase activity for three independent transfection assays with the standard deviation.

In our analysis of YY1 and AP1 binding sequences in the BED region, we found that the two binding sites were fused (see Fig. 8). Thus, we explored a possible functional interaction between YY1 and AP1 in the BED region. To address this question, we generated three BED mutant oligonucleotides, as shown in Fig. 5A. These oligonucleotides were radiolabeled and used as probes in an EMSA with a PMA-ionomycin-activated Jurkat cell extract to examine their activities in forming the YY1, Sp1, and AP1 complexes. M1 does not form the YY1 complex (Fig. 5B) but forms the Sp1 and AP1 complexes. M2 does not bind YY1 or Sp1 but does bind AP1 (Fig. 5B). M3

MOL. CELL. BIOL.

FIG. 5. Functional analysis of the mutant BED region. (A) DNA sequences of the wild-type and mutant BED oligonucleotides. The binding activity is summarized at the right of each mutant oligonucleotide. (B) EMSA patterns of the mutant BED oligonucleotides in 23 Y buffer. (C) Transfection analysis of mutations in the BED element. Wild-type and mutant BED oligonucleotides were subcloned upstream of the IFN-g core promoter (positions 2108 to 164) in the pEQ3 vector. All of the constructions were confirmed by DNA sequence analysis. Activities of the inserts were examined by transfection of the plasmid constructs into Jurkat cells as described in Materials and Methods. b-gal., b-galactosidase. Each bar represents the mean value from three transfection experiments with the standard deviation.

does not form any of the complexes, including AP1. To examine the effects of these mutations on the function of the BED region, one copy of each of the oligonucleotides was inserted into the IFN-g core promoter (2108) in the pEQ3 b-galactosidase vector. Functional results from transient transfection of Jurkat cells showed that the parental BED region did not

VOL. 16, 1996


4749

FIG. 6. Competition between YY1 and AP1 for DNA binding in the BED region. (A) YY1 inhibits AP1 in a dose-dependent pattern. In this EMSA, equal amounts (0.25 mg) of the recombinant c-Jun and c-Fos proteins were used to form the AP1 heterodimer complex. One microliter of recombinant YY1 (rhYY1) contained 0.2 mg of YY1 purified from the GST-YY1 fusion protein by deletion of the GST peptide. The assay was carried out under the same conditions as stated in the legend to Fig. 3B. A 32P-labeled wild-type BED oligonucleotide was used as a probe (5,000 cpm at each point). (B) Specific DNA-protein interaction between the BED oligonucleotide and recombinant YY1 protein. Under the same EMSA conditions as those described for panel A, 3 ml (0.6 mg) of purified YY1 was used to form the YY1 complex. The YY1 complex formed with 3 mg of the Jurkat nuclear protein served as a control in lane 7; 200 ng of antibody was used for supershift analysis in each lane. (C) The authentic YY1 binding oligonucleotide (UCR) was used with the recombinant YY1 protein in the gel shift assay. YY1 protein (3 ml) was used in a combination with 1 mg of BSA protein in each lane. The YY1 antibody (200 ng) or c-Jun antibody (200 ng) was used to confirm the specificity of the DNA-YY1 complex.

express enhancer activity after PMA-ionomycin stimulation (Fig. 5C), although it has an AP1 binding site (Fig. 3B). However, when YY1 binding was eliminated, the BED mutant exhibited an inducible enhancer activity (Fig. 5C, M1 and M2). This enhancer activity disappeared (Fig. 5C, M3) when the AP1 binding site was abolished by mutation (Fig. 5B, M3). The elimination of Sp1 complex formation from the BED region had no effect on the enhancer activity (compare M1 with M2 in Fig. 5C). These data suggest that the enhancer activity can be attributed to the AP1 complex, whose transacting activity was suppressed by the YY1 complex. YY1 competes with AP1 for DNA binding in the BED region. It has been reported that YY1 competes with serum response factor for DNA binding in both the c-Fos (13) and a-actin (22) promoter. Recently, it was also reported that YY1 can compete with NF-kB in the rat serum amyloid A1 gene promoter (24). We hypothesized that YY1 might inhibit AP1 activity in the BED region through competition with AP1 for DNA binding. To test this hypothesis, we analyzed AP1 DNA binding in a modified EMSA in which the YY1 binding is attenuated by addition of EDTA. In this experiment, we observed competition between the formation of the AP1 complex and that of the YY1 complex (data not shown). To confirm this relationship, recombinant c-Jun, c-Fos, and YY1 proteins were utilized in an EMSA with the BED probe, in which equal amounts of c-Jun and c-Fos proteins were used to generate an AP1 complex. As shown in Fig. 6A, the BED oligonucleotide formed an AP1 complex with the c-Jun and c-Fos recombinant proteins, and the specificity of the complex was confirmed by a super-

shift with c-Jun or c-Fos antibody (lanes 2 and 3) but not YY1 antibody (lane 4). Interestingly, this AP1 complex was decreased in the presence of the recombinant YY1 protein, and this inhibition was dose dependent with respect to the amount of the YY1 protein used in the assay (lanes 5 to 7). This suppression of the AP1-DNA complex by the YY1 protein strongly supports the model that YY1 suppresses AP1 activity by excluding AP1 binding to DNA in the BED region. In support of this model, when the competition experiment with the results shown in Fig. 3C, lane 4, was performed with limiting concentrations of unlabeled YY1 binding oligonucleotide, an increase in the AP-1 complex (complex B) was observed (data not shown). Interestingly, two complexes with different mobilities were formed when the purified recombinant YY1 was used in the EMSA. To determine the relationship of these complexes to the YY1 complex, a supershift assay was carried out with YY1, c-Jun, c-Fos, Sp1, and AP2 antibodies. As shown in Fig. 6B, both of the two complexes were removed by the YY1 antibody (lane 4) but not by the control antibodies (lanes 3 and 5 to 7), suggesting that YY1 does not form a heterodimer complex with either Jun or Fos. In addition, the faster-migrating complex formed by the recombinant YY1 protein exhibited a mobility identical to that of the cellular YY1 complex (Fig. 6B, lane 8). These results indicate that both faster and slower complexes are formed by recombinant YY1 protein. The slower complex might be the result of complex formation by a recombinant GST-YY1 fusion protein in which the GST polypeptide has not been removed. The failure of YY1 by itself to bind to the DNA is due to the low concentration of the YY1

4750

YE ET AL.

FIG. 7. Requirement of YY1 for the BE silencer activity. (A) DNA sequences of wild-type (WT) BE and BE mutants that are related to the YY1 binding site. (B) EMSA patterns and functional activities of the BE wild-type and M5 mutant oligonucleotides. 32P-labeled BE and M5 oligonucleotides were used with a nuclear extract (in 23 E buffer) from the unstimulated Jurkat cells. YY1 and AP2-like complexes are indicated. (C) Activities of the inserts were examined by transfection of the plasmid constructs into Jurkat cells as described in Materials and Methods. b-gal., b-galactosidase. Each bar represents the mean value from three transfection experiments with the standard deviation.

protein in the binding assay. The recombinant YY1 did bind to UCR (an authentic YY1 binding site), with a pattern identical to that observed with the BED region when BSA was present in the binding assay (Fig. 6C), but did not bind to this site when BSA was absent (data not shown). In addition, the same binding pattern and competition were observed when the YY1 binding site in the granulocyte-macrophage colony-stimulating factor promoter was utilized as the radiolabeled oligonucleotide (data not shown). YY1 is required for the BE silencer activity. In a previous study, we observed that in the BE silencer region, the AP2-like complex is required for activity of the silencer, but a functional role for the YY1 complex in the IFN-g promoter was not identified. Since the YY1 binding site in the BE region (Y2) plays a role in mediating suppression of the IFN-g promoter activity (Fig. 4A, 2211 Y2D), we wished to investigate the role of YY1 in modulating the BE silencer activity. We generated a BE mutant (M5) by replacement of GG with CA in the YY1 binding site (Fig. 7A), which eliminates YY1 binding capacity, as shown by EMSA (Fig. 7B). The effect of this mutation on the core IFN-g promoter (2108) was measured by transienttransfection analysis with Jurkat cells. In control groups, reporter vectors that contain one copy of the wild-type BE or BE mutant M3, which does not form both the AP2-like and YY1 complexes, were analyzed in the same promoter. Our results show that the BE region can act as a silencer (Fig. 7C, BE) and that deletion of both AP2-like and YY1 complex binding was associated with loss of the silencer activity (Fig. 7C, M3), consistent with our previous observations (49). Of interest is the observation that loss of the YY1 complex also resulted in loss of the silencer activity (Fig. 7C, M5). These data suggest that the YY1 complex is also required for activity of the BE silencer region.

MOL. CELL. BIOL.

The AP2-like and YY1 complexes can form a third complex. Functional studies indicated that formation of both the AP2like and YY1 complexes is required for the BE silencer activity. These data suggest that the two complexes should both be present for silencer activity and that a combination of the two complexes should result in a third DNA-protein complex detectable by EMSA. In an effort to detect the third complex, we used poly(dG z dC), instead of poly(dI z dC), as a nonspecific competitor and obtained a new EMSA pattern with the BE probe in which three major complexes were formed with an unstimulated Jurkat nuclear extract (Fig. 8A, lane 1). All three complexes exhibited specific DNA binding activity, but with different affinities. Complex 1 was eliminated by the BE mutant oligonucleotide M2 (Fig. 8A, lane 3), which does not form the AP2-like complex but retains the capacity to form the YY1 complex. This result suggested that complex 1 contains YY1, and this hypothesis was confirmed by competition with a YY1 binding oligonucleotide (Fig. 8A, lane 4). The formation of complex 1 also was eliminated both by the mutant BE oligonucleotide M5 (Fig. 8A, lane 5), which does not form the YY1 complex but retains a capacity to form the AP2-like complex, and by the AP2 binding oligonucleotide (Fig. 8A, lane 6). These results indicated that complex 1 also contains the AP2like complex. More interesting is that in competition with both the M5 and AP2 oligonucleotides, another band was observed (Fig. 8A, lanes 5 and 6). This band had the same mobility as the YY1 complex (data not shown) and was removed by the antiYY1 antibody (Fig. 8A, lane 7) but not by the anti-AP2 antibody (Fig. 8A, lane 8), suggesting that the complex contained YY1, identical to the YY1 complex. Taken together, these results suggest that complex 1 contains both the AP2-like and YY1 complexes previously observed in the EMSA system with poly(dI z dC) as the nonspecific competitor. Consistent with this conclusion is the fact that both radiolabeled M2 and M5 oligonucleotides failed to form complex 1 with the Jurkat nuclear extract in the same EMSA system (Fig. 8B). The EMSA results shown in Fig. 8 indicate that complex 2 may be related to YY1 and that complex 3 may be related to the AP2-like protein. Surprisingly, neither complex 1 nor complex 2 could be supershifted with the anti-YY1 antibody, although they exhibited YY1 binding specificity. This may be due to blockage of the YY1 epitope (recognized by this antibody) by the AP2like protein or an unidentified protein. Further studies using different YY1 antibodies are required to test this hypothesis. DISCUSSION IFN-g, whose gene expression is restricted mainly to T cells and large granular lymphocytes, is a potent mediator of immune system development and function. Transcriptional regulation of IFN-g is controlled by at least two mechanisms, DNA methylation and transcriptional control elements. DNA methylation has been correlated with IFN-g production in murine Th1 and Th2 CD41 T-cell subsets (52), and previous reports from our laboratory and others have documented the importance of the promoter and the intron in the regulation of IFN-g gene expression. The significance of cis-acting elements in the control of gene transcription has been widely demonstrated. It has been reported that in the cytokine genes, transcriptional initiation is affected by both silencer and enhancer elements (5, 10, 11, 19, 23, 27, 30, 33, 48). In the IFN-g gene, multiple enhancer elements (5–7, 45) and silencer elements (5, 49) in both the promoter and the first intron have been reported. Deletion analysis of the promoter region revealed that removal of a silencer fragment located at positions 2251 to 2215 resulted

VOL. 16, 1996


4751

FIG. 8. Formation of a DNA-protein complex that contains both the AP2-like and YY1 complexes. (A) A 32P-labeled BE oligonucleotide was used with 1.7 mg of poly(dG z dC) to analyze DNA-protein complexes with the Jurkat nuclear extract in 23 E buffer. One hundred nanograms of competitor oligonucleotide was used to determine the binding specificities and compositions of the complexes. Two microliters of the indicated antibodies (Ab) was used to determine the protein compositions of the complexes. (B) Under the same EMSA conditions as those described for panel A, the radiolabeled wild-type and mutant oligonucleotides BE (lane 1), M2 (lanes 2 to 6), and M5 (lanes 7 to 11) were used as probes to demonstrate changes in the gel shift pattern when the AP2-like or YY1 complex binding sites were mutated.

in increased promoter activity (5). Further studies demonstrated that this silencer activity is promoter specific and dependent upon the formation of a DNA–AP2-like protein complex (49). In addition, this silencer element was found to bind the ubiquitous nuclear factor YY1. The activity of YY1 as a transcriptional repressor in various genes has been reported, but its role in cytokine gene regulation remains to be investigated. In a previous study, we demonstrated that YY1 could interact with an enhancer element in the human granulocytemacrophage colony-stimulating factor gene promoter (51), and overexpression of YY1 suppressed the enhancer activity. Furthermore, elimination of YY1 binding by point mutation led to a strong elevation in the enhancer activity (unpublished data). These data suggest that YY1 may indeed play an important role in the control of cytokine gene expression. In this study, we have collected several lines of evidence supporting our hypothesis that YY1 can act as a repressor of IFN-g promoter activity. We have determined that there are three YY1 binding sequences (Fig. 9) in the IFN-g promoter

FIG. 9. Summary of the relationship of the YY1 binding sites with other nuclear protein binding sites in the BE and BED regions of the IFN-g promoter.

region and have demonstrated that YY1 can bind strongly to two of these sites when analyzed by EMSA. The functional role of these sites was supported by the facts that (i) overexpression of YY1 led to inhibition of the promoter activity, (ii) mutation of these sites, which destroyed YY1 binding activity, resulted in loss of the constitutive suppression, and (iii) YY1 can suppress AP1 activity in the IFN-g promoter. On the basis of these observations, we conclude that interaction of YY1 with binding sites in the IFN-g promoter is at least one possible mechanism responsible for the suppression of the basal activity of the IFN-g promoter. YY1 repressor activity has been widely observed, and several models have been proposed to explain the mechanisms by which YY1 exerts its suppressive effect. In several genes, competition for binding sequences with an activator protein is thought to be the main mechanism of the YY1 activity. Examples of this model include competition with the nuclear factor serum response factor in the muscle a-actin (22) and c-fos (31) gene promoters and competition with NF-kB in the rat serum amyloid A1 gene promoter (24). In the c-fos gene, there is also a YY1 binding site that is downstream of a CREB binding site (31). It was proposed that at this binding site, YY1 acts as a DNA-bending protein that induces a conformational change in the promoter region and thereby prevents interaction between CREB and the transcription initiation complexes. Recently, a repression domain of the YY1 protein has been mapped to its C-terminal region where it overlaps with the DNA-binding domain (21), but it is not clear whether the repression domain is involved in the proposed DNA binding. In contrast to these models, YY1 has been shown to dimerize with some positive transcriptional regulators, including Sp1 (20, 40), c-Myc (44), E1A (21), and B23 (18). A common feature in protein-protein interactions with c-Myc, E1A, and B23 proteins is the relief of repressor activity of YY1, but interaction with Sp1 can increase

4752

YE ET AL.

YY1 activity of transcriptional initiation in the adeno-associated virus P5 promoter (40, 41). Our data support a hypothesis in which YY1 exerts its repressor activity in the IFN-g promoter through two possible mechanisms (Fig. 9). In the BE silencer region, binding of YY1 (Fig. 7) and the AP2-like protein appears to be required for the silencer activity, because elimination of either of the binding activities was associated with loss of the silencer function. In this model, YY1 and the AP2-like protein can bind to DNA separately, but their simultaneous binding is required for the silencer activity. Since YY1 has been shown to interact directly with TFIIb or RNA polymerase II (47), this may serve as a new model for YY1 repressor activity, in which YY1 cooperates with another repressor protein to inhibit the basal transcription machinery. The second model is that YY1 may suppress AP1 activity through competition for DNA binding. Like NF-kB, AP1 is a very important positive transcription activator involved in cytokine gene regulation (12, 37, 54). A positive role for AP1 has been reported for many cytokine gene promoters, such as those of IL-2 (35, 54), IL-3 (12), and granulocyte-macrophage colony-stimulating factor (26). We observed that induction or suppression of AP1 was correlated with production or inhibition, respectively, of IFN-g in NK cells (50), and we have identified two functional AP1 sites in the IFN-g core promoter that are responsible for negative regulation of IFN-g promoter activity by dominant negative c-Jun and glucocorticoids (7). These results strongly support the role of AP1 as an important activator in the transcriptional regulation of the IFN-g gene. In this study, we identified an additional AP1 site in the BED region of the IFN-g promoter (Fig. 9). Enhancer activity of one copy of the BED element was not detectable in the IFN-g core promoter until the adjacent YY1 binding site was destroyed by mutation. Cotransfection of a c-jun expression vector with the 2225 (Y11Y2)D vector, which has no YY1 binding activity, led to a specific induction of the promoter activity, and this induction is stronger than that observed with the core promoter (data not shown). This suggests that this new AP1 site can contribute to the promoter activity when relieved from repression by YY1. In this respect, suppression of AP1 by YY1 could be an important mechanism for negative regulation of IFN-g gene transcription. Since Y1 and Y2 exhibited a synergy in the suppression of the IFN-g promoter (Fig. 4), it is possible that in addition to these two mechanisms, multiple YY1 complexes may act cooperatively in the promoter region to generate a combined suppression of IFN-g basal transcription. Taken together, the above-described models could be used to explain why transcription of the IFN-g gene is under strict control in resting and activated T cells or NK cells. In the resting cells, which have preexisting repressor proteins, such as YY1, and lack activator proteins, such as AP1, IFN-g gene transcription is silenced because of a dominant negative influence from the repressor proteins. In the activated cells, when positive nuclear factors become dominant in the nucleus, YY1 may be displaced by AP1 in the BED region, possibly because of a direct competition for the DNA binding site. When the influence of the activator proteins overcomes that of the repressor proteins, gene transcription will be initiated. When the nuclear levels of activator proteins decrease, constitutive suppression by the negative regulators, such as YY1, will take place and become dominant through displacement of the activator proteins or activation of silencer elements. In turn, the gene transcription will be suppressed. Consistent with this model is that low levels of YY1 binding activity have been observed in two human NK cell lines that exhibit a constitutive IFN-g gene transcription and superinducible IFN-g gene transcription (our unpublished observations). Further studies uti-

MOL. CELL. BIOL.

lizing in vivo footprinting and analysis of IFN-g transcription in T or NK cell lines that lack YY1 activity will be required to prove this hypothesis. ACKNOWLEDGMENTS We thank Dan Longo, Paritosh Ghosh, and Antonio Sica for constructive comments, Tom Kerppola for recombinant Fos and Jun proteins, Tom Shenk for the bacterial YY1 expression vector, Kevin Becker and Keiko Ozato for the mammalian YY1 expression vector, and Susan Charbonneau and Joyce Vincent for editorial assistance. REFERENCES 1. Angel, P., I. Baumann, B. Stein, H. Delius, H. J. Rahmsdorf, and P. Herrlich. 1987. 12-O-Tetradecanoyl-phorbol-13-acetate induction of the human collagenase gene is mediated by an inducible enhancer element located in the 59-flanking region. Mol. Cell. Biol. 7:2256–2266. 2. Angel, P., and M. Karin. 1991. The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochem. Biophys. Acta 1072:129– 157. 3. Basu, A., K. Park, M. L. Atchison, R. S. Carter, and N. G. Avadhani. 1993. Identification of a transcriptional initiator element in the cytochrome c oxidase subunit Vb promoter which binds to transcription factors NF-E1 (YY1, d) and Sp1. J. Biol. Chem. 268:4188–4196. 4. Bauknecht, T., P. Angel, H-D. Royer, and H. Z. Hausen. 1992. Identification of a negative regulatory domain in the human papillomavirus type 18 promoter: interaction with the transcriptional repressor YY1. EMBO J. 11: 4607–4617. 5. Chrivia, J. C., T. Wedrychowicz, H. A. Young, and K. J. Hardy. 1990. A model of human cytokine regulation based on transfection of g interferon gene fragments directly into isolated peripheral blood T lymphocytes. J. Exp. Med. 172:661–664. 6. Ciccarone, V. C., J. Chrivia, K. J. Hardy, and H. A. Young. 1990. Identification of enhancer-like elements in human IFN-g genomic DNA. J. Immunol. 144:735–730. 7. Cippitelli, M., A. Sica, V. Viggiano, J. Ye, P. Ghosh, M. J. Birrer, and H. A. Young. 1995. Negative transcriptional regulation of the interferon-g promoter by glucocorticoid and dominant negative mutants of c-Jun. J. Biol. Chem. 270:12548–12556. 8. Dong, Z., M. J. Birrer, R. G. Watts, L. M. Matrisian, and N. H. Colburn. 1994. Blocking of tumor promoter-induced AP-1 activity inhibits induced transformation in JB6 mouse epidermal cells. Proc. Natl. Acad. Sci. USA 91:609–613. 9. Flanagan, J. R., K. G. Becker, D. L. Ennist, S. L. Gleason, P. H. Driggers, B. Z. Levi, E. Appella, and K. Ozato. 1992. Cloning of a negative transcription factor that binds to the upstream conserved region of Moloney murine leukemia virus. Mol. Cell. Biol. 12:38–44. 10. Fong, C.-L. W., A. H. Siddiqui, and D. F. Mark. 1994. Identification and characterization of a novel repressor site in the human tumor necrosis factor a gene. Nucleic Acids Res. 22:1108–1114. 11. Goodbourn, S., H. Burstein, and T. Maniatis. 1986. The human b-interferon gene enhancer is under negative control. Cell 45:601–610. 12. Gottschalk, L. R., D. M. Giannola, and S. G. Emerson. 1993. Molecular regulation of the human IL-3 gene: inducible T cell-restricted expression requires intact AP-1 and Elf-1 nuclear protein binding sites. J. Exp. Med. 178:1681–1692. 13. Gualberto, A., D. Lepage, G. Pons, S. L. Mader, K. Park, M. L. Atchison, and K. Walsh. 1992. Functional antagonism between YY1 and the serum response factor. Mol. Cell. Biol. 12:4209–4214. 14. Hahn, S. 1992. The yin and the yang of mammalian transcription. Curr. Biol. 2:152–154. 15. Halazonetis, T. D., K. Georgopoulos, M. E. Greenberg, and P. Leder. 1988. c-Jun dimerizes with itself and with c-Fos, forming complexes of different DNA binding affinities. Cell 55:917–924. 16. Hariharan, N., D. E. Kelley, and R. P. Perry. 1991. d, a transcription factor that binds to downstream elements in several polymerase II promoters, is a functionally versatile zinc finger protein. Proc. Natl. Acad. Sci. USA 88: 9799–9803. 17. Imagawa, M., R. Chiu, and M. Karin. 1987. Transcription factor AP-2 mediates induction by two different signal-transduction pathways: protein kinase C and cAMP. Cell 51:251–260. 18. Inouye, C. J., and E. Seto. 1994. Relief of YY1-induced transcriptional repression by protein-protein interaction with the nuclear phosphoprotein B23. J. Biol. Chem. 269:6506–6510. 19. Kuhl, D., J. D. L. Fuente, M. Chaturvedi, S. Parimoo, J. Ryals, F. Meyer, and C. Weissmann. 1987. Reversible silencing of enhancer by sequences derived from the human IFN-a promoter. Cell 50:1057–1069. 20. Lee, J.-S., K. M. Galvin, and Y. Shi. 1993. Evidence for physical interaction between the zinc-finger transcription factors YY1 and Sp1. Proc. Natl. Acad. Sci. USA 90:6145–6149.

VOL. 16, 1996 21. Lee, J.-S, R. H. See, K. M. Galvin, J. Wang, and Y. Shi. 1995. Functional interactions between YY1 and adenovirus E1A. Nucleic Acids Res. 23:925– 931. 22. Lee, T.-C., Y. Shi and J. Schwartz. 1992. Displacement of BrdUrd-induced YY1 by serum response factor activates skeletal a-actin transcription in embryonic myoblasts. Proc. Natl. Acad. Sci. USA 89:9814–9818. 23. Li-Weber, M., A. Eder, H. Krafft-Czepa, and P. H. Krammer. 1992. T cell-specific negative regulation of transcription of the human cytokine IL-4. J. Immunol. 148:1913–1918. 24. Lu, S.-Y., M. Rodriguez, and W. S.-L. Liao. 1994. YY1 represses rat serum amyloid A1 gene transcription and is antagonized by NF-kB during acutephase response. Mol. Cell. Biol. 14:6253–6263. 25. Margolis, D. M., M. Somasundaran, and M. R. Green. 1994. Human transcription factor YY1 represses human immunodeficiency virus type 1 transcription and virion production. J. Virol. 68:905–910. 26. Masuda, E. S., H. Tokumisu, A. Tsuboi, J. Shlomal, P. Hung, K.-I. Arai, and N. Arai. 1993. The granulocyte-macrophage colony-stimulating factor promoter cis-acting element CLE0 mediates induction signals in T cells and is recognized by factors related to AP1 and NFAT. Mol. Cell. Biol. 13:7399– 7407. 27. Mathey-Prevot, B., N. C. Andrews, H. S. Murphy, S. G. Kreissman, and D. G. Nathan. 1990. Positive and negative elements regulate human interleukin 3 expression. Proc. Natl. Acad. Sci. USA 87:5046–5050. 28. May, M., X.-P. Dong, E. Beyer-Finkler, F. Stubenrauch, P. G. Fuchs, and H. Pfister. 1994. The E6/E7 promoter of extrachromosomal HPV16 DNA in cervical cancer escapes from cellular repression by mutation of target sequences for YY1. EMBO J. 13:1460–1466. 29. Meier, V., and B. Groner. 1994. The nuclear factor YY1 participates in repression of the b-casein gene promoter in mammary epithelial cells and is counteracted by mammary gland factor during lactogenic hormone induction. Mol. Cell. Biol. 14:128–137. 30. Nabel, G. J., C. Gorka, and D. Baltimore. 1988. T-cell-specific expression of interleukin 2: evidence for a negative regulatory site. Proc. Natl. Acad. Sci. USA 85:2934–2938. 31. Natesan, S., and M. Z. Gilman. 1993. DNA bending and orientation-dependent function of YY1 in the c-fos promoter. Genes Dev. 7:2497–2509. 32. Nolan, G. P. 1994. NF-AT-AP-1 and rel-bZIP: hybrid vigor and binding under the influence. Cell 77:795–798. 33. Nourbakhsh, M., K. Hoffmann, and H. Hauser. 1993. Interferon-b promoters contain a DNA element that acts as a position-independent silencer on the NF-kB site. EMBO J. 12:451–459. 34. Penix, L., W. M. Weaver, Y. Pang, H. A. Young, and C. B. Wilson. 1993. Two essential regulatory elements in the human interferon g promoter confer activation-specific expression in T cells. J. Exp. Med. 178:1483–1496. 35. Petrak, D., S. A. Memon, M. J. Birrer, J. D. Ashwell, and C. M. Zacharchuk. 1994. Dominant negative mutant of c-Jun inhibits NF-AT transcriptional activity and prevents IL-2 gene transcription. J. Immunol. 153:2046–2051. 36. Raich, N., C. H. Clegg, J. Grofti, P.-H. Romeo, and G. Stamatoyannopoulos. 1995. GATA1 and YY1 are developmental repressors of the human ε-globin gene. EMBO J. 14:801–809. 37. Rao, A. 1994. NF-ATp: a transcription factor required for the co-ordinate induction of several cytokine genes. Immunol. Today 15:274–281.


4753

38. Raught, B., B. Khursheed, A. Kazansky, and J. Rosen. 1994. YY1 represses b-casein gene expression by preventing the formation of a lactation-associated complex. Mol. Cell. Biol. 14:1752–1763. 39. Riggs, K. J., S. Saleque, K.-K. Wong, K. T. Merrell, J.-S. Lee, Y. Shi, and K. Calame. 1993. Yin-Yang 1 activates the c-myc promoter. Mol. Cell. Biol. 13:7487–7495. 40. Seto, E., B. Lewis, and T. Shenk. 1993. Interaction between transcription factors Sp1 and YY1. Nature (London) 365:462–464. 41. Seto, E., Y. Shi, and T. Shenk. 1991. YY1 is an initiator sequence-binding protein that directs and activates transcription in vitro. Nature (London) 354:241–245. 42. Shi, Y., E. Seto, L.-S. Chang, and T. Shenk. 1991. Transcriptional repression by YY1, a human GLI-Kruppel-related protein, and relief of repression by adenovirus E1A protein. Cell 67:377–388. 43. Shrivastava, A., and K. Calame. 1994. An analysis of genes regulated by the multifunctional transcription regulator Yin Yang-1. Nucleic Acids Res. 22: 5151–5155. 44. Shrivastava, A., S. Saleque, G. V. Kalpana, S. Artandi, S. P. Goff, and K. Calame. 1993. Inhibition of transcription regulator Yin-Yang-1 by association with c-myc. Science 262:1889–1892. 45. Sica, A., T.-H. Tan, N. Rice, M. Kretzschmar, P. Ghosh, and H. A. Young. 1992. The c-rel protooncogene product c-Rel but not NF-kB binds to the intronic region of the human interferon-g gene at a site related to an interferon-stimulable response element. Proc. Natl. Acad. Sci. USA 89: 1740–1744. 46. Tan, T.-H., G. P. Huang, A. Sica, P. Ghosh, H. A. Young, D. L. Longo, and N. R. Rice. 1992. kB site-dependent activation of the interleukin-2 receptor a-chain gene promoter by human c-Rel. Mol. Cell. Biol. 12:4067–4075. 47. Usheva, A., and T. Shenk. 1994. TATA-binding protein-independence initiation: YY1, TFIIB, and RNA polymerase II direct basal transcription on supercoiled template DNA. Cell 76:1115–1121. 48. Williams, T. M., D. Moolten, J. Burlein, J. Romano, R. Bhaerman, A. Godillot, M. Mellon, F. J. Rauscher III, and J. A. Kant. 1991. Identification of a zinc finger protein that inhibits IL-2 gene expression. Science 254:1791– 1794. 49. Ye, J., P. Ghosh, M. Cippitelli, J. Subleski, K. J. Hardy, J. R. Ortaldo, and H. A. Young. 1994. Characterization of a silencer regulatory element in the human interferon-g promoter. J. Biol. Chem. 269:25728–25734. 50. Ye, J., J. R. Ortaldo, K. Conlon, R. Winkler-Pickett, and H. A. Young. 1995. Cellular and molecular mechanisms of IFN-g production induced by IL-2 and IL-12 in a human NK cell line. J. Leukocyte Biol. 58:225–233. 51. Ye, J., H. A. Young, J. R. Ortaldo, and P. Ghosh. 1994. Identification of a DNA binding site for the nuclear factor YY1 in the human GM-CSF core promoter. Nucleic Acids Res. 22:5672–5678. 52. Young, H. A., P. Ghosh, J. Ye, J. Lederer, A. Lichtman, J. R. Gerard, L. Penix, C. B. Wilson, A. J. Melvin, M. E. McGurn, D. B. Leis, and D. D. Taub. 1994. Differentiation of the T helper phenotypes by analysis of the methylation state of the IFN-g gene. J. Immunol. 153:3603–3610. 53. Young, H. A., and K. J. Hardy. 1989. Interferon-g: producer cells, activation stimuli, and molecular genetic regulation. Pharmacol. Ther. 45:137–151. 54. Zhang, L., and G. J. Nabel. 1994. Positive and negative regulation of IL-2 gene expression: role of multiple regulatory sites. Cytokine 6:221–228.