Transduction of acute myeloid leukemia cells with third ... - Nature

Leukemia (2002) 16, 1645–1654  2002 Nature Publishing Group All rights reserved 0887-6924/02 $25.00 www.nature.com/leu

Transduction of acute myeloid leukemia cells with third generation self-inactivating lentiviral vectors expressing CD80 and GM-CSF: effects on proliferation, differentiation, and stimulation of allogeneic and autologous anti-leukemia immune responses RC Koya1,3, N Kasahara

1,3

, V Pullarkat2, AM Levine2 and R Stripecke1,2,3

1

Institute for Genetic Medicine, Keck School of Medicine, University of Southern California, Los Angeles, CA, USA; 2Division of Hematology, Norris Comprehensive Cancer Center, Keck School of Medicine, University of Southern California, Los Angeles, CA, USA; and 3 Department of Pathology, Keck School of Medicine, University of Southern California, Los Angeles, CA, USA

Acute myeloid leukemia (AML) patients treated with available therapies achieve remission in approximately 60% of cases, but the long-term event-free survival is less than 30%. Use of immunotherapy during remission is a potential approach to increase survival. We propose to develop cell vaccines by genetic modification of AML cells with CD80, an essential T cell costimulator that is lacking in the majority of AML cases, and GM-CSF, to induce proliferation and activation of professional antigenpresenting cells. Here, we evaluated third generation selfinactivating (SIN) lentiviral vectors, which have the potential advantage of improved safety. CD80 and GM-CSF expression by these vectors was higher than that reported with second generation vectors (Stripecke et al, Blood 2000; 96: 1317–1326). In some cases, endogenous GM-CSF expression by transduced AML cells induced phenotypic changes consistent with the maturation of leukemia blasts into antigen-presenting cells. Further, in all cases studied, GM-CSF expression was associated with higher proliferation and cell viability. Allogeneic and autologous mixed lymphocyte reactions performed with transduced irradiated AML cells expressing CD80 and/or GM-CSF demonstrated that expression of either transgene enhanced T cell activation. These pre-clinical data demonstrate the potential feasibility of third generation SIN vectors for use in AML immunotherapy. Leukemia (2002) 16, 1645–1654. doi:10.1038/sj.leu.2402582 Keywords: AML; lentivirus; GM-CSF; CD80; immunotherapy; gene therapy

Introduction Acute myeloid leukemia is the most frequent type of leukemia in adults. Conventional therapies produce hematological remissions in 50–60% of patients, but only 25–30% of adult patients with AML survive for longer than 3 years.1 Efforts to optimize current treatment modalities, including chemotherapy and stem cell transplantation (SCT), have so far failed to significantly improve overall median survival.2 Further, effective therapy of older patients is compromised by the relative toxicity of intensive chemotherapy. Thus, novel adjuvant treatment approaches are clearly needed. It is now well established that the immune system plays an important role in inducing anti-leukemia responses. In the allogeneic SCT setting for chronic myelogenous leukemia (CML), it has been convincingly demonstrated that donor lymphocytes may promote immune rejection of leukemia, with resultant long-term survival of the recipient.3 It is clear, however, that the graft-versus-leukemia effect after allogeneic SCT is weaker for acute myeloid leukemia than for CML.4 The

Correspondence: R Stripecke, Institute for Genetic Medicine, 2250 Alcazar St, CSC-240, Los Angeles, CA 90033, USA; Fax: 323 4422764 Received 12 November 2001; accepted 14 March 2002

reasons for the escape of acute leukemia cells from immune surveillance are not fully understood, but it is possible that intrinsic or acquired properties of leukemia cells per se help them to evade or inhibit immune recognition. Active immunization against leukemia given at the time of complete remission when tumor burden is reduced, is a potential strategy to overcome immunological unresponsiveness, with elimination of minimal residual disease.5–7 AML is a heterogeneous disease and AML-specific or associated antigens have not yet been clinically demonstrated. Therefore, a whole cell vaccine approach could provide tools to generate anti-leukemia immunity in the autologous and allogeneic settings and to further characterize antigenic determinants in AML cells. AML cells per se are poor antigen-presenting cells (APC). For most patients, AML cells express both MHC class I and class II molecules required for antigen presentation.8,9 However, they lack the expression of co-stimulatory ligands or inflammatory cytokines to promote strong immune responses. In fact, expression of the co-stimulatory ligand CD80 has been reported to occur in less than 10% of analyzed AML samples.9 We and others have adopted strategies to overcome the poor APC status of AML blasts by direct gene transfer of immunomodulators and/or hematopoietic regulators into AML cells.6,7,10 Several transplantable murine AML models have demonstrated the feasibility of anti-leukemia immunization using genetically modified leukemia cells expressing CD80 and/or granulocyte–macrophage colony-stimulating factor (GM-CSF).11–16 As AML cell vaccines move towards clinical application, efficient and safe genetic vectors to transduce primary human leukemia cells will be required. We recently developed and characterized the use of HIV-derived lentiviral vectors for delivery and expression of CD80 and GM-CSF into human leukemia cell lines and primary cells. Thus, VSV-G pseudotyped, second generation lentiviral vectors promoted consistent, efficient and stable expression of CD80 and GM-CSF in primary AML and acute lymphocytic leukemia cells (ALL).10 To minimize the potential risk of replication-competent lentivirus with HIV-derived lentiviral vectors, third generation self-inactivating (SIN) vectors have been devised for future clinical applications.17,18 In this report, we evaluated the efficiency of AML blast transduction with third generation SIN lentiviral vectors expressing GM-CSF, CD80 and GM-CSF plus CD80. The biological activity of endogenous GM-CSF production by AML cells was assessed by proliferation and viability assays, morphology and immunophenotype. The immunological effects of GM-CSF and/or CD80 expression by AML cells on T cell stimulation was evaluated in the allogeneic and autologous settings. The data demonstrate the feasibility of using the novel

Third generation self-inactivating lentiviral vectors for AML immunotherapy RC Koya et al

1646

vectors for immunomodulatory gene transfer into AML cells and, importantly, the ability of these gene-modified cells to enhance T cell immune responses.

Materials and methods

Cell lines The 293T cell line was obtained from ATCC (Rockville, MD, USA), and the 293A line is a more adhesive subclone of 293 cells (Q-Biogene, Carlsbad, CA, USA). The human leukemia cell lines used in this study were Nalm-6 (kindly provided by Dr Dario Campana, St Jude Children’s Research Hospital, Memphis, TN, USA), AML-5 (kindly provided by Dr Dario Campana) and TF-1 (obtained from R&D Systems, Minneapolis, MN, USA).

Cell Culture 293T cells were cultured in Dulbecco’s modified Eagle’s medium with L-glutamine (DMEM; BioWittaker, Walkersville, MD, USA), 10% fetal bovine serum (FBS) and penicillin/streptomycin (50 U/ml). The leukemia cell lines were cultured in RPMI 1640 medium with L-glutamine (BioWittaker), 10% FBS and penicillin/streptomycin (50 U/ml). For the cell line AML-5, human interleukin-6 (IL-6; R&D Systems) was added to the medium to a final concentration of 10 ng/ml. Cells were incubated at 37ºC and 5% CO2. Experiments were performed with cells in exponential growth phase and all transductions were performed in AIM-V serumfree medium (GIBCO/BRL, Grand Island, NY, USA).

Primary cells

Leukemia

Construction of RRL-CD80, RRL-GM-CSF and RRLGM/CD vectors The backbone vector used for insertion of the immunomodulatory genes consisted of a derivative of the pRRL-sin.hCMVGFP-pre construct,17 where the GFP cDNA was deleted by XbaI/SalI deletion and replaced by a polylinker containing a multiple cloning sites (MCS; CTAGAACTAGTGGATCCC CCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCG), resulting in the vector pRRL-sin.hCMV-MCS-pre. The EcoRI site present in the backbone of the original pRRL-sin.hCMVGFP-pre construct was eliminated by a point mutation introduced by PCR resulting into the backbone vector pRRLsin.hCMV-MCS-pre ∆Eco. DNA fragments obtained by EcoRI digestion of pHR-CD80, pHR-GM-CSF, and a partial digestion of the bi-cistronic pHR-GM/CD plasmids10 and encoding the respective immunomodulatory genes were introduced into the EcoRI site present in the multiple cloning site of the vector pRRL-sin.hCMV-MCS.∆Eco to generate RRL-CD80, RRL-GMCSF and RRL-GM/CD. All constructs were reconfirmed by restriction digestion and sequencing analysis.

Production of lentivirus The constructs required for the packaging of second or third generation self-inactivating lentiviral vectors were previously described.18–20The construct pMD.G was used for the production of the VSV-G viral envelope in combination with the packaging construct pCMV∆8.9 (second generation) or pMDLg/pRRE plus RSV-REV (third generation). Lentivirus vectors were produced by transient co-transfection of 293T cells with the backbone vector plasmid derived from the pHR- or RRL series, plus the packaging plasmids and pMD.G as previously described.10,18,20 Viral titer was determined by assessing viral p24 antigen concentration by ELISA (Coulter Immunotech, Miami, FL, USA). The minimum detectable p24 concentration for this assay is 3 pg/ml.

Primary cells were obtained from peripheral blood samples and bone marrow aspirates from adult AML patients at diagnosis and remission. The samples were obtained and studies performed in accordance with protocols approved by the Institutional Review Board of the University of Southern California, after informed consent. Mononuclear cells were separated by density gradient centrifugation, cryopreserved in 10% dimethyl sulfoxide (DMSO) and 90% FBS and stored in the Tissue Procurement Cell Bank of the University of Southern California. These cells were thawed at 37°C for 1 h using a thawing medium containing AIM-V, 30% FBS, 20 U/ml heparin and 0.2 U/ml DNAse (Roche, Indianapolis, IN, USA). After thawing, primary cells were washed twice with AIM-V medium. Primary AML cells were cultured in AIM-V medium containing 10 ng/ml human interleukin-3 (IL-3) and 50 ng/ml human stem cell factor (SCF; R&D Systems).

Leukemia cells were washed twice with AIM-V and for each transduction point 1–2 × 106 cells were mixed with AIM-V and lentiviral vectors at the final concentration of 5 ␮g/ml of p24 equivalent. One milliliter of the cell/viral suspension was seeded per well of six-well plates, protamine sulfate was added at the final concentration of 6 ␮g/ml and the transduction plates were incubated at 37°C, 5% CO2 overnight. Leukemia cells were washed twice with AIM-V medium, and seeded at a density of 106 cells/ml in AIM-V and cytokines. Twentyfour hours later, the supernatant was collected for ELISA and the cells were harvested for FACS analysis or kept in culture for analyses at further time points.

T cell purification

FACS analysis

Mononuclear cell suspensions prepared from peripheral blood were incubated with a cocktail of monoclonal antibodies and a magnetic colloid to enrich human T cells (StemCell Technologies, Vancouver, BC, Canada). T cells were obtained as the flow-through after running the pre-bound cells through a LS magnetic separation column (Miltenyi Biotec, Auburn, CA, USA).

For analysis of GFP expression, cells were washed once with phosphate-buffered saline (PBS) and resuspended in 100 ␮l of 1% paraformaldehyde for fixation. For analysis of surface membrane antigens, cells were washed once with phosphatebuffered saline, incubated with PBS containing mouse IgG (50 ␮g/ml) for 15 min on ice, stained with the corresponding monoclonal antibody for 20 min, washed and resuspended in

Lentiviral-mediated gene transfer


100 ␮l of 1% paraformaldehyde for fixation. The monoclonal antibodies to CD80 and CD86 and respective isotype monoclonal antibodies were conjugated with FITC and the monoclonal antibodies against CD33 and CD1a respective isotype monoclonal antibodies were conjugated with phycoerthrin (Pharmingen, La Jolla, CA, USA). Flow cytometric analysis was accomplished with a FACScalibur cytometer equipped with a 488-nm argon laser. To establish background for fluorescence and to set gates for data acquisition, staining with isotype antibodies was used. Care was taken to analyze cells present in the myeloblast gate based on forward and side scatter characteristics.

Analysis of GM-CSF Expression of GM-CSF was analyzed by ELISA (R&D Systems) according to the manufacturer’s instructions. The minimum detectable concentration of GM-CSF following this assay is typically less than 3 pg/ml.

Analysis of proliferation and viability Transduced AML cells were plated in triplicates at the density of 1 × 105 cells per well of a 96-well plate. At day 3 post transduction, cells were pulsed with 1 ␮Ci of 3H-thymidine (Du Pont, Boston, MA, USA) and harvested 18 h later. 3Hthymidine incorporation was measured by liquid scintillation spectrophotometry. Proliferation index was calculated as PI = c.p.m. (AML/RRL-GM-CSF)/c.p.m. (AML/RRL-GFP). In parallel, cell viability was assessed by MTS assay (Promega, Madison, MI, USA), according to the manufacturer’s instructions. At day 4 post transduction, cells in a 96-well plate were incubated with the reaction substrate and the absorbance measured at 490 nm every hour for 4 h. The time point 3 h was chosen as the most representative data in the linear range of the assay. Viability index was calculated as VI = Abs490 (AML/ RRL-GM-CSF)/Abs490 (AML/RRL-GFP).

Mixed lymphocyte reactions (MLR) Irradiated (3200 cGy) primary non-transduced or transduced AML cells were used as stimulators. AML cells were co-cultured at a 1:2 ratio with allogeneic T cells or autologous PBMC, in 96-well round-bottom plates containing 105 AML and 2 × 105 responder cells in 200 ␮l of medium and incubated for 6 days at 37°C in a 5% CO2 incubator. All MLR cultures were carried-out in RPMI-1640 supplemented with 5% heat-inactivated human AB serum (Omega, Tulare, CA, USA). For autologous MLR, 10 U/ml recombinant human interleukin-2 (IL-2; R&D Systems) was added for the last 3 days of culture. All microcultures were performed in triplicate. Cells were pulsed with 1 ␮Ci of 3H-thymidine (Du Pont) for the last 18 h of the culture period, and then harvested on to glass fiber filters. 3H-thymidine incorporation was measured by liquid scintillation spectrophotometry. Stimulation index (SI) was calculated for each individual experiment as: SI = c.p.m.(T cells + AML cells)/c.p.m.(T cells).

Analysis of activated T cells by flow cytometry Cocultures from triplicate MLR wells were pooled and stained according to the FastImmune kit (Becton Dickinson, San Jose,

CA, USA). A mixture of anti-CD3 PercP/␥1 FITC/␥ 1 PE was used for the isotype staining, whereas for specific staining CD3 PerCP/CD4 FITC/CD69 PE and CD3 PerCP/CD8 FITC/CD69 PE mixtures were used. A gate (R1) set on the CD3+ lymphocyte fraction was set for quantitative analysis of CD4+, CD8+, CD4+/CD69+ and CD8+/CD69+ subpopulations.

1647

Results and discussion

Third generation SIN lentiviral vectors efficiently transduce AML cells Third generation SIN vectors are currently being considered for clinical testing in humans. Therefore, this gene transfer system was evaluated for potential use as an AML cell vaccine, genetically modified to express GM-CSF and/or CD80. The SIN transfer vector construct contains HIV cis-acting sequences and an expression cassette for the transgenes. The transgene is the only portion transferred to target cells, and upon integration, does not carry wild-type copies of the HIV LTR to the host DNA. The 5′ LTR is chimeric, with the enhancer/promoter of RSV replacing the U3 region of the HIV LTR to rescue its transcriptional dependence on tat. The 3′ LTR has an almost complete deletion of the U3 region, which includes the TATA box. As the latter also serves as the template to regenerate the U3 region in the 5′ LTR, upon reverse transcription, transcriptional inactivation of both LTRs in the integrated provirus occurs.17 The RRL-sin backbone used in our studies also contains the hCMV internal promoter and a post-transcriptional regulatory element (’pre’) from the woodchuck hepatitis virus in the 3′ untranslated region of the transgenes, to increase RNA stability and therefore protein production.20 Batches of SIN third generation lentiviral vectors were produced by transient co-transfection of 293T cells and were concentrated by ultracentrifugation. The virus titer was quantified by measuring the concentration of gag p24, a protein present in the core of the lentiviral vectors. We determined experimentally in titration assays using 293T cells that 1 ␮g of p24 is roughly equivalent to 107 infection units (data not shown). The p24 concentration was found to be consistent between viral batches, with an average of 20 ␮g/ml, which would be equivalent to titers of 2 × 108 infective particles/ml. We determined by transduction experiments of the Nalm-6 and AML-5 cell lines that 2–10 ␮g/ml of p24 equivalent of the RRL-sin.hCMV.GFP.pre vector consistently produced ⬎90% transduction of 2 × 106 cells (data not shown). Therefore, for all experiments we used 5 ␮g of p24 equivalent of each lentiviral vector in the transduction of 2 × 106 cells in 1 ml of culture. At this concentration, where the multiplicity of infection (MOI) is approximately 25, we did not observe cellular toxicity after transduction. We initially tested the feasibility of primary AML cell transduction with the reporter RRL-sin.hCMV.GFP.pre lentiviral vector. Initial diagnostic samples of bone marrow and peripheral blood were obtained from adult patients, after approval of the USC Institutional Review Board, and obtaining written informed consent. The samples used contained 80% or higher of leukemia blasts as determined by immunophenotype and morphology. The phenotypic features of the leukemia samples used in this study are shown in Table 1. Cryopreserved samples were thawed and maintained in AIM-V medium plus hIL-3 and hSCF overnight, before transduction. After exposure to RRL-sin.hCMV.GFP.pre overnight, leukemia cells were Leukemia


1648

Table 1 Characteristics of AML samples, RRL-sin. GFP.pre transduction efficiency, GM-CSF expression after RRL-GM-CSF transduction and effects on proliferation and maturation of the leukoblasts

Proliferationa Maturationb

AML

FAB

Karyotype

CD phenotype

GFP %

GMCSF

AML-5 line

ND

ND

ND

⬎90

5278

ND

yes

TF-1 line

ND

ND

ND

34

8695

yes

ND

Patient No. 2459

M5

ND

ND

333

ND

ND

Patient No. 3003

M2

Normal 46 XX

CD33,CD34,CD71,CD13,CD45

ND

2730

ND

yes

Patient No. 3057

M2 45,X-Y,t(2;21;8)(p23;q22;q22)

CD33,CD45,CD13,CD71,HLA-DR

23,29

ND

ND

ND

Patient No. 3058

M4

Normal 46XX

CD33,CD13,CD34,CD4,CD15,CD117, HLA-DR

24

256

yes

ND

Patient No. 3086

M5

Normal 46 XY

CD33,CD13,CD45,CD14,CD71, HLA-DR

45,57,64 241

yes

ND

Patient No. 3089

M4

Normal 46 XY

CD33,CD13,CD45,CD34,CD7,CD71, HLA-DR

29,62,68 109

yes

yes

Patient No. 3098

M1

Normal 46 XY

CD33,CD45,CD71,CD11b,CD13,HLADR

Patient No. 3458

M4

Normal 46 XY

CD33,CD45,CD34,CD11b,CD10,HLADR

CD33,CD13,CD45,CD34,HLA-DR

65

181

yes

yes

24

193

yes

ND

FAB, French–American–British leukemia classification; ND, not determined; GFP %; percentage of GFP+ cells followed by flow cytometry, calculated by subtracting the frequency of transduced cells expressing GFP from the mock-transduced controls; GM-CSF, ng/ml for 106 cells/ml in 24 h. (a) Proliferation is indicated as positive if proliferation index ⬎1 (Table 2). (b) Maturation, followed by microscopic observation of cultured RRL-GM-CSF transduced AML cells.

washed, and the expression of GFP was analyzed by flow cytometry 48 h post transduction. The percentage of GFP+ transduced cells in the different samples varied from 23 to 72%, comparable to previous results using the second generation lentiviral vectors10 (Figure 1, Table 1). Transduction of blood or bone marrow leukemia specimens from the same patient resulted in similar percentages of GFP+ cells and of GFP expression levels (Figure 1).

SIN vectors encoding CD80 and GM-CSF show improved expression in cell lines We then compared the self-inactivating RRL-GM/CD bicistronic vector co-expressing CD80 and GM-CSF with the pHRGM/CD vector that we previously used in transduction assays. The pHR- vector series retain the wt HIV LTRs, which can result in transcriptional interference with the internal hCMV promoter. In fact, the pHR-GM/CD vector was previously shown to produce detectable CD80 expression, but poor expression of the upstream GM-CSF gene, which was suggested to be due to low levels and/or instability of the mRNA transcribed from the hCMV promoter.10 The novel RRL- vector series has two features designed to improve transgenic expression. First, due to its self-inactivating function, hCMV is the only functional promoter after viral integration, and therefore, promoter interference should no longer play an inhibitory role in the mRNA expression. Second, the presence of the pre element in the 3′ untranslated region should provide stabilization of the transcript and therefore higher mRNA levels.20 Leukemia

Figure 1 Primary AML cells obtained from blood or bone marrow were transduced with the RRL-sin.hCMV.GFP.pre vector packaged in the vesicular stomatitis virus G envelope. Forty-eight hours after transduction, GFP expression was followed by flow cytometry. The percentage of GFP+ cells was calculated by subtracting the frequency of the transduced cells (bold lines) from the background, mock controls (broken lines).


To achieve comparable conditions during the packaging process to produce RRL- and pHR- vectors, viral supernatants were produced in triplicate by transient co-transfection with the second-generation pCMV.∆8.9 packaging plasmid, the pMD.G envelope expression vector and equal molar amounts of the RRL-GM/CD or pHR-GM/CD transfer vectors. Comparable levels of p24 were measured among the different viral preparations (2 ␮g/ml), indicating that the level of virion production was consistent between the two vector preparations. One milliliter was used to transduce 293A fibroblasts and the Nalm-6 acute leukemia cell line. Under these transduction conditions we expected to yield one transduction event per Nalm-6 cell according to titration experiments using GFP as reporter. Forty-eight hours after transduction, CD80 and GMCSF expression were measured by flow cytometry and ELISA, respectively. Both vectors produced ⬎90% transduction, as measured by the percentage of CD80+ cells by flow cytometry (data not shown). Therefore, the two vector types did not differ significantly in their transduction efficiencies. The CD80 expression level (measured as mean fluorescence units, MFU, by FACS) was 50% higher in 293A and Nalm6 cells transduced with the RRL-GM/CD vector (Figure 2). A significant increase in GM-CSF production was observed for 293A (⬎9-fold) and Nalm-6 (⬎3-fold) cells transduced with the SIN vector (Figure 2). Relative increases in the transgene expression levels were also observed after transduction of 293A cells with the monocistronic vectors encoding CD80 (MFU for CD80 was 136 and 181 for pHR- and RRL- backbones, respectively) and GM-CSF (GM-CSF production was 57 and 399 ng/ml for pHR- and RRL- backbones, respectively) (data not shown). Therefore, the safer SIN vectors surpassed the second generation lentiviral vectors in terms of CD80 and GM-CSF expression levels.

Figure 2 CD80 and GM-CSF expression in 293A and Nalm-6 cells 48 h after triplicate transduction with second generation (pHRGM/CD) or self-inactivating (RRL-GM/CD) lentiviral vectors. MFU (mean fluorescence units) corresponds to the relative fluorescence values of cells in the CD80+ gate. GM-CSF expression was measured as nanograms per 106 cells in 1 ml per 24 h.

Efficient expression of CD80 and GM-CSF in primary leukemia cells

1649

The transduction of primary AML blasts with the third generation SIN vectors was evaluated in two distinct primary leukemia samples transduced with either RRL-GMCSF alone, with RRL-CD80 alone, with a combination of RRL-CD80 plus RRLGMCSF, or with the bicistronic vector RRL-GM/CD. Transduction efficiency assessed by percentage of CD80+ cells was slightly higher for RRL-CD80 alone or in combination with RRL-GM-CSF than for RRL-GM/CD. CD80 and GM-CSF expression were, respectively, ⬎2-fold and ⬎10-fold higher for the monocistronic vectors than for the bicistronic RRLGM/CD vector (Figure 3). These results demonstrate that efficient CD80 and GM-CSF co-expression could be achieved in primary leukemia cells either by co-transduction with two monocistronic SIN vectors or by transduction with the bicistronic SIN vector alone.

Transduction of primary AML cells is stable and continuous expression of GM-CSF leads to phenotypic changes in the cell population The long-term effects of CD80 and GM-CSF expression in transduced primary AML cells were characterized in cultures with prolonged viability, without addition of exogenous cytokines. In Figure 4 we show the results from primary leukemia cells that could be maintained in culture for 17 days after the transduction with RRL-GM-CSF, RRL-CD80, RRL-GMCSF plus RRL-CD80 or with RRL-GM/CD. As assessed by flow cytometry analysis of the non-transduced sample (mock), most of the cells marked in the myeloblast region (R1) expressed the myeloid CD33 marker, consistent with the AML phenotype. Persistent expression of CD80 by cells within the myeloblast population was observed for AML/RRL-CD80, but not for AML/RRL-GM/CD cells, suggesting that overall expression from the latter vector was unstable and/or CD80 expression was specifically down-regulated during prolonged culture. Cells transduced with RRL-GMCSF or RRL-GM/CD vectors showed a profound change in phenotype, as observed by a population of larger cells (R2), which expressed the CD33 antigen and CD80. This population of large cells (even larger than the population within the myeloblast gate, (R1)) also expressed low levels of CD86 and CD1a, which are surface antigens typically expressed by dendritic cells. For these analyses, matched isotype control antibodies were used to set up the positive and negative quadrants (data not shown). Therefore, GM-CSF production produced autocrine or paracrine effects on the cultured cells, promoting their differentiation into more mature antigen presenting cells. These results were confirmed by microscopic observation of the cells (Figure 5). Non-transduced or RRL-CD80 transduced cells remained small and round, whereas RRL-GM-CSF or RRLCD80 plus RRL-GM-CSF transduced cells were conspicuously larger, with the presence of protusions typical for dendritic cell morphology (Figure 5). This induced maturation after transduction with lentiviral vectors expressing GM-CSF was observed in 3/8 primary samples studied (Table 1). These results may be explained by the biological activities of GM-CSF, as it is known to enhance a wide range of functions in hematopoietic precursor cells and in more mature cells of the myelomonocytic lineage. Culture of AML cells with recombinant GM-CSF, IL-3 and IL-6 has been associated with cell expansion, and with some degree of differentiation Leukemia


1650

Figure 3 Transduction of cryopreserved primary AML cells samples with third generation self-inactivating lentiviral vectors. The upper and lower panels represent two distinct samples, non-transduced (Mock) or transduced with the different vectors, and correspond to dot-plot analysis of the double staining for the CD33 myeloid lineage marker (phosphatidyllethanolamine-conjugated anti-CD33) and transgene expression (fluorescein isothiocyanate-conjugated anti-CD80). Isotype non-specific control antibodies were used to set up the background levels. MFU (mean fluorescence units) corresponds to the relative fluorescence values of cells in the CD80+ gate. GM-CSF expression was measured as picograms per 106 cells in 1 ml per 24 h.

and variable up-regulation of CD80.21 In particular, since GMCSF and interleukin-4 (IL-4) are key in obtaining monocytederived DC cultures in vitro,22 the strategy to drive AML cells into DC differentiation (’AML-DC’) in the presence of recombinant GM-CSF and IL-4 has been studied with variable but overall successful results.23–26 It has been shown previously that autocrine stimulation after retroviral vector gene transfer of GM-CSF into multipotent murine stem cell lines (FDCP mix) induced their synchronous maturation, driving differentiation into granulocytes and macrophages.27 To our knowledge, however, this is the first demonstration of a maturation effect in primary human AML cells after GM-CSF gene transfer. This strategy can be explored as an additional tool to optimize AML-DC production for immunotherapy.

age 200 ng/ml (Table 2). After transduction, the leukemia cells were extensively washed and seeded in microtiter plates in the absence of recombinant cytokines. The proliferation and viability were measured in parallel by 3H-thymidine incorporation or by MTS assays on day 4 after transduction. The control TF-1 cell line showed approximately 200-fold increase in the proliferation and viability indexes. In all primary samples studied, expression of GM-CSF stimulated both proliferation and viability, with 2- to 20-fold increase in the proliferation and viability indexes (Table 2). The stimulation did not correlate with the transduction efficiencies or with the levels of GM-CSF expression, indicating that intrinsic properties of the leukemia cells may account for this biological effect. Increased allo-stimulatory activity of AML cells expressing CD80 and/or GM-CSF

Expression of GM-CSF stimulates proliferation and increases the metabolic rate of AML cells In order to further characterize the biological effects of endogenous GM-CSF expression by AML cells, cell proliferation and viability assays were performed. Five different primary AML samples were transduced with RRL-GFP (to assess transduction efficiency and to serve as a base-line control for transduction effects) or with RRL-GM-CSF vectors. A factordependent human erythroleukemic cell line, TF-1,28 commonly used in bioassays to determine the GM-CSF bioactivity, was used in parallel. The percentage of RRL-GFP transduced cells followed by GFP expression 2 days after transduction, ranged from 24 to 65% (Table 2). GM-CSF expression in RRLGM-CSF-transduced TF-1 cells reached ⬎8000 ng/ml per 106 cells/ml in 24 h whereas primary AML cells produced in averLeukemia

We performed functional experiments to evaluate the allogeneic T cell response to transduced AML cells. We compared the T cell stimulatory activity of AML primary cells that were either non-transduced (mock), transduced to express the control transgene GFP (AML/RRL-GFP), or transduced to express GM-CSF (AML/RRL-GM-CSF), CD80 (AML/RRL-CD80) or a combination of both (AML/RRL-GM/CD). Two days after transduction, expression of GM-CSF and of CD80 were confirmed by ELISA and FACS, respectively (Figure 6a). The transduced AML cells were irradiated (3200 cGy) and co-incubated with purified T cells in a mixed lymphocyte culture (MLR). As a control for T cell stimulation, PHA was added to a subset of T cells. Six days later, the cultures were labeled with 3H-thymidine for 16 h and harvested. The incorporated radioactivity was measured, and PHA-treated T cells showed ⬎40 000


1651

Figure 4 Immunophenotypic analysis of transduced primary AML cells maintained in culture for 17 days in the absence of recombinant cytokines. Upper panels: flow cytometric forward vs side scatter dot-plot showing R1 (leukoblast gate) and R2 (matured cells gate). Middle panels: dot-plot analysis of the double staining for the CD33 myeloid lineage marker (phosphatidyllethanolamine-conjugated anti-CD33) and transgene/endogenous co-stimulatory molecule expression (fluorescein isothiocyanate-conjugated anti-CD80). Lower panels: dot-plot analysis of the double staining for the CD1a dendritic cell marker (phosphatidyllethanolamine-conjugated anti-CD1a) and co-stimulatory molecule CD86 expression (fluorescein isothiocyanate-conjugated anti-CD86). Isotype non-specific control antibodies were used to set up the background levels.

c.p.m., in contrast to non-treated T cells (⬍100 c.p.m., data not shown). Allo-reactivity, measured as SI, was observed for all co-cultures (Figure 6a). AML/RRL-GM-CSF, AML/RRLCD80 and AML/RRL-GM/CD stimulated T cells significantly (P = 0.05) when compared to AML/Mock, whereas non-significant values were obtained for the co-culture with AML/RRL-GFP (Figure 6a). In parallel, T cells that were kept for 6 days in MLR were also characterized for the percentage of CD4+ and CD8+ activated subpopulations. As shown in Figure 6b, the percentage of CD4+ cells within the CD3+ gate remained uniform for all co-cultures, whereas the numbers of CD8+ cells increased when T cells were co-incubated with AML cells expressing GM-CSF. This was correlated with

higher numbers of cells expressing CD69, a marker for lymphocyte activation (Figure 6b). Activation of CD4+ cells was also enhanced by co-culture with AML/RRL-GM-CSF cells. Interestingly, we did not observe a noticeable increase of CD69+ cells in the co-cultures containing AML/RRL-CD80 cells, despite the fact that they provided the highest T cell proliferation. One possible reason is that the stimulation provided by AML cells expressing GM-CSF may have a more persistent profile, due to the combined professional APC functions (co-stimulated expression of MHC and co-stimulatory molecules).

Leukemia


1652

Figure 5 Morphology of non-transduced (Mock) and transduced AML cells. The results depicted are phase-contrast micographs of 17day cultured cells in the absence of recombinant cytokines.

Increased auto-stimulatory activity of AML cells expressing CD80 and/or GM-CSF In another set of experiments, we performed co-cultures of primary AML cells as stimulators and autologous bone marrow mononuclear cells as responders, essentially as described previously for the allogeneic system. Expression of GM-CSF and CD80 two days after transduction was detected in the transduced cells (Figure 7a). Co-culture of mononuclear cells with non-transduced AML cells produced only low levels of stimulation (⬍100 c.p.m.), whereas the PHA stimulated controls showed ⬎12 000 c.p.m. (data not shown). Co-culture with AML/RRL-GFP, AML/RRL-GM-CSF and AML/RRL-CD80 showed modest SI values, surpassed only by AML/RRLGM/CD (the increase is not significant at P = 0.05). This experiment was repeated, and similar findings obtained, showing that AML/RRL-GM/CD and AML/RRL-GM-CSF were the best inducers of proliferation (data not shown). Since the proliferation of autologous reactive T cells can be increased by various rounds of T cells stimulation,10 this approach can be used in the future to obtain anti-AML-specific T cell clones. Table 2

FAB

To demonstrate that the effect on the proliferation of PBMC was correlated with T cell activation, flow cytometry analysis of CD4+ and CD8+ cells was performed. The percentages of CD4+ and CD8+ cells within the CD3+ gate was not affected by expression of CD80 or GM-CSF by stimulatory AML cells, but a noticeable increase in the percentage of CD4+/CD69+ cells was appreciated. These results indicated that the autologous stimulation provided by transduced AML cells induced

Transduction of primary leukemia cells to express GFP or GM-CSF followed by proliferation and viability assays

% GFP

3 H-thymidine incorporation (c.p.m.)

GM-CSF (pg/ml) GFP

GM-CSF

MTS metabolic activity (Abs490) PI

GFP

GM-CSF

VI

TF-1

34.49

8695.28

251.5

41503.0

165.0

0.06

11.97

209.91

3086 M2

45.33

241.20

962.0

1805.0

1.9

0.28

0.50

1.78

3089 M2

29.86

108.45

248

6123.5

24.7

0.08

1.12

13.65

3098 M1

65.08

181.22

32.5

656.5

20.2

0.04

0.57

15.13

3058 M4

24.20

256.49

1417.5

10567.5

7.5

0.14

0.99

7.20

3458 M4

23.93

193.37

4313.0

13315.0

3.1

0.23

1.14

4.89

PI, proliferation index; VI, viability index (see Materials and methods). Leukemia

Figure 6 Allogeneic mixed lymphocyte reaction (MLR) with primary AML non-transduced (Mock), transduced with control RRLsin.hCMV.GFP.pre or with experimental vectors RRL-GM-CSF, RRLCD80 or RRL-GM/CD and incubated with purified allogeneic T cells. (a) stimulation index followed by 3H -thymidine incorporation; * indicates significant differences between transduction and Mock. (b) Upper panels: frequency of CD4+ and CD8+ cells after MLR culture; lower panels: frequency of activated CD4+/CD69+ and CD8+/CD69+ cells after MLR culture.


clinical application. The initial vaccination procedure will therefore involve administration of irradiated leukemia cells 48 h after transduction, as simulated by the functional assays presented here. In conclusion, the cumulative data obtained from various acute leukemia murine models strongly support the strategy of CD80 and/or GM-CSF gene transfer to generate acute leukemia cell vaccines.11,12,15,16,32–34 Our current results have demonstrated the feasibility of translating this approach to a clinical setting utilizing potentially safer third generation SIN lentiviral vectors.

1653

Acknowledgements

Figure 7 Autologous mixed lymphocyte reaction (MLR) with primary AML non-transduced (Mock), transduced with control RRLsin.hCMV.GFP.pre or with experimental vectors RRL-GM-CSF, RRLCD80 or RRL-GM/CD and incubated with autologous PBMC. (a) stimulation index followed by 3H -thymidine incorporation. (b) Upper panels: frequency of CD4+ and CD8+ cells after MLR culture; lower panels: frequency of activated CD4+/CD69+ and CD8+/CD69+ cells after MLR culture.

T helper responses. This result has favorable implications for immunotherapy, as CD4+ cells appear to sustain long-lasting immunity, in contrast with the short duration of immunity elicited by CD8+ cells. The effects of transduced AML cells on CD4+ and CD8+ autologous stimulation will be next examined in further detail by in vitro assays, in order to characterize the antigenic determinants. Importantly, the effects of irradiation on the expression of CD80 and GM-CSF by transduced cells, and the concomitant immune effects also demand examination. Thus, in agreement with other groups, we found that upregulation of CD80 expression on AML cells by gene transfer29 and exposure of AML to GM-CSF23,24 can both lead to T cell stimulatory responses, which can be combined by lentiviral gene transfer of both genes. The demonstration by Dranoff and colleagues of anti-tumor responses produced by tumor cell vaccines expressing GMCSF in mouse and man has been a strong motivation for the field.30,31 The mechanism proposed for this effect was the microenvironment produced by GM-CSF secretion, causing a potent paracrine stimulation of professional APCs in the vaccination site. For primary human AML cells, we were able to show that the GM-CSF expression produced autocrine/paracrine effects in the leukemia cells per se, directing them towards the APC phenotype. The finding that GM-CSF expression by transduced AML cells can trigger their differentiation into AML-APC after extended culture has important implications for immunotherapy purposes, and remains to be further characterized before considering its

We thank Alexandra Vieira for technical assistance, Dr Mark Hechinger for the flow cytometry analyses, Dr Luigi Naldini for providing us with the third generation SIN lentiviral system and Dr Sue Ellen Martin, Moli Chen and Byron Espina for assisting in establishment of the Leukemia Cell Bank. RS was supported by a Special Fellow Award from the Leukemia and Lymphoma Society (3002-00), by a Howard Temin Award from the National Cancer Institute (K01-CA87864-01), by a short-term habilitation fellowship from the Deutsche Forschungsgemeinschaft, by a pilot grant from the American Cancer Society (IRG 58-007-42) and a research grant from Concern Foundation. VP was supported by a pilot grant from the American Cancer Society (IRG-58-007-42).

References 1 Mayer RJ, Davis RB, Schiffer CA, Berg DT, Powell BL, Schulman P, Omura GA, Moore JO, McIntyre OR, Frei E 3rd. Intensive postremission chemotherapy in adults with acute myeloid leukemia. Cancer and Leukemia Group B. N Engl J Med 1994; 331: 896– 903. 2 Cassileth PA, Harrington DP, Appelbaum FR, Lazarus HM, Rowe JM, Paietta E, Willman C, Hurd DD, Bennett JM, Blume KG, Head DR, Wiernik PH. Chemotherapy compared with autologous or allogeneic bone marrow transplantation in the management of acute myeloid leukemia in first remission. N Engl J Med 1998; 339: 1649–1656. 3 Kolb HJ, Schattenberg A, Goldman JM, Hertenstein B, Jacobsen N, Arcese W, Ljungman P, Ferrant A, Verdonck L, Niederwieser D. Graft-versus-leukemia effect of donor lymphocyte transfusions in marrow grafted patients. European Group for Blood and Marrow Transplantation Working Party Chronic Leukemia. Blood 1995; 86: 2041–2050. 4 Collins RH, Jr, Shpilberg O, Drobyski WR, Porter DL, Giralt S, Champlin R, Goodman SA, Wolff SN, Hu W, Verfaillie C, List A, Dalton W, Ognoskie N, Chetrit A, Antin JH, Nemunaitis J. Donor leukocyte infusions in 140 patients with relapsed malignancy after allogeneic bone marrow transplantation. J Clin Oncol 1997; 15: 433–444. 5 Arceci RJ. The potential for antitumor vaccination in acute myelogenous leukemia. J Mol Med 1998; 76: 80–93. 6 Brenner MK, Pinkel D. Cure of leukemia. Semin Hematol 1999; 36: 73–83. 7 Dunussi-Joannopoulos K. Malignancy: gene therapy vaccines in acute myeloid leukemia: a need for clinical evaluation. Hematol 2000; 5: 103–115. 8 Bruserud O. Acute myelogenous leukemia blasts as accessory cells during T lymphocyte activation: possible implications for future therapeutic strategies. Leukemia 1999; 13: 1175–1187. 9 Hirano N, Takahashi T, Ohtake S, Hirashima K, Emi N, Saito K, Hirano M, Shinohara K, Takeuchi M, Taketazu F, Tsunoda S, Ogura M, Omine M, Saito T, Yazaki Y, Ueda R, Hirai H. Expression of costimulatory molecules in human leukemias. Leukemia 1996; 10: 1168–1176. Leukemia


1654

Leukemia

10 Stripecke R, Cardoso AA, Pepper KA, Skelton DC, Yu XJ, Mascarenhas L, Weinberg KI, Nadler LM, Kohn DB. Lentiviral vectors for efficient delivery of CD80 and granulocyte–macrophage colonystimulating factor in human acute lymphoblastic leukemia and acute myeloid leukemia cells to induce antileukemic immune responses. Blood 2000; 96: 1317–1326. 11 Dunussi-Joannopoulos K, Weinstein HJ, Nickerson PW, Strom TB, Burakoff SJ, Croop JM, Arceci RJ. Irradiated B7-1 transduced primary acute myelogenous leukemia (AML) cells can be used as therapeutic vaccines in murine AML. Blood 1996; 87: 2938–2946. 12 Dunussi-Joannopoulos K DG, Weinstein HJ, Ferrara JL, Bierer BE, Croop JM. Gene immunotherapy in murine acute myeloid leukemia: granulocyte–macrophage colony-stimulating factor tumor cell vaccines elicit more potent antitumor immunity compared with B7 family and other cytokine vaccines. Blood 1998; 91: 222–230. 13 Matulonis UA, Dosiou C, Lamont C, Freeman GJ, Mauch P, Nadler LM, Griffin JD. Role of B7-1 in mediating an immune response to myeloid leukemia cells. Blood 1995; 85: 2507–2515. 14 Nakazaki Y, Tani K, Lin ZT, Sumimoto H, Hibino H, Tanabe T, Wu MS, Izawa K, Hase H, Takahashi S, Tojo A, Azuma M, Hamada H, Mori S, Asano S. Vaccine effect of granulocyte– macrophage colony-stimulating factor or CD80 gene-transduced murine hematopoietic tumor cells and their cooperative enhancement of antitumor immunity. Gene Ther 1998; 5: 1355–1362. 15 Hirano N, Takahashi T, Azuma M, Okumura K, Yazaki Y, Yagita H, Hirai H. Protective and therapeutic immunity against leukemia induced by irradiated B7-1 (CD80)-transduced leukemic cells. Hum Gene Ther 1997; 8: 1375–1384. 16 Vereecque R, Buffenoir G, Preudhomme C, Hetuin D, Bauters F, Fenaux P, Quesnel B. Gene transfer of GM-CSF, CD80 and CD154 cDNA enhances survival in a murine model of acute leukemia with persistence of a minimal residual disease. Gene Ther 2000; 7: 1312–1316. 17 Zufferey R, Dull T, Mandel RJ, Bukovsky A, Quiroz D, Naldini L, Trono D. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol 1998; 72: 9873–9880. 18 Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, Naldini L. A third-generation lentivirus vector with a conditional packaging system. J Virol 1998; 72: 8463–8471. 19 Zufferey R, Nagy D, Mandel RJ, Naldini L, Trono D. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol 1997; 15: 871–875. 20 Zufferey R, Donello JE, Trono D, Hope TJ. Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors. J Virol 1999; 73: 2886–2892. 21 Hicks C, Keoshkerian E, Gaudry L, Lindeman R. CD80 (B7-1) expression on human acute myeloid leukaemic cells cultured with GM-CSF, IL-3 and IL-6. Cancer Immunol Immunother 2001; 50: 173–180. 22 Sallusto F, Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med 1994; 179: 1109–1118. 23 Choudhury BA, Liang JC, Thomas EK, Flores-Romo L, Xie QS, Agusala K, Sutaria S, Sinha I, Champlin RE, Claxton DF. Dendritic cells derived in vitro from acute myelogenous leukemia cells stimulate

24

25

26

27

28

29

30

31

32

33

34

autologous, antileukemic T-cell responses. Blood 1999; 93: 780–786. Oehler L, Berer A, Kollars M, Keil F, Konig M, Waclavicek M, Haas O, Knapp W, Lechner K, Geissler K. Culture requirements for induction of dendritic cell differentiation in acute myeloid leukemia. Ann Hematol 2000; 79: 355–362. Kohler T, Plettig R, Wetzstein W, Schmitz M, Ritter M, Mohr B, Schaekel U, Ehninger G, Bornhauser M. Cytokine-driven differentiation of blasts from patients with acute myelogenous and lymphoblastic leukemia into dendritic cells. Stem Cells 2000; 18: 139–147. Brouwer RE, van der Hoorn M, Kluin-Nelemans HC, van Zelderen-Bhola S, Willemze R, Falkenburg JH. The generation of dendritic-like cells with increased allostimulatory function from acute myeloid leukemia cells of various FAB subclasses. Hum Immunol 2000; 61: 565–574. Just U, Stocking C, Spooncer E, Dexter TM, Ostertag W. Expression of the GM-CSF gene after retroviral transfer in hematopoietic stem cell lines induces synchronous granulocyte– macrophage differentiation. Cell 1991; 64: 1163–1173. Kitamura T, Tange T, Terasawa T, Chiba S, Kuwaki T, Miyagawa K, Piao YF, Miyazono K, Urabe A, Takaku F. Establishment and characterization of a unique human cell line that proliferates dependently on GM-CSF, IL-3, or erythropoietin. J Cell Physiol 1989; 140: 323–334. Mutis T, Schrama E, Melief CJ, Goulmy E. CD80-transfected acute myeloid leukemia cells induce primary allogeneic T-cell responses directed at patient specific minor histocompatibility antigens and leukemia-associated antigens. Blood 1998; 92: 1677–1684. Dranoff G, Jaffee E, Lazenby A, Golumbek P, Levitsky H, Brose K, Jackson V, Hamada H, Pardoll D, Mulligan RC. Vaccination with irradiated tumor cells engineered to secrete murine granulocyte– macrophage colony-stimulating factor stimulates potent, specific, and long-lasting anti-tumor immunity. Proc Natl Acad Sci USA 1993; 90: 3539–3543. Soiffer R, Lynch T, Mihm M, Jung K, Rhuda C, Schmollinger JC, Hodi FS, Liebster L, Lam P, Mentzer S, Singer S, Tanabe KK, Cosimi AB, Duda R, Sober A, Bhan A, Daley J, Neuberg D, Parry G, Rokovich J, Richards L, Drayer J, Berns A, Clift S, Dranoff G. Vaccination with irradiated autologous melanoma cells engineered to secrete human granulocyte–macrophage colonystimulating factor generates potent antitumor immunity in patients with metastatic melanoma. Proc Natl Acad Sci USA 1998; 95: 13141–13146. Stripecke R, Skelton DC, Gruber T, Afar D, Pattengale PK, Witte ON, Kohn DB. Immune response to Philadelphia chromosomepositive acute lymphoblastic leukemia induced by expression of CD80, interleukin 2, and granulocyte–macrophage colonystimulating factor. Hum Gene Ther 1998; 9: 2049–2062. Stripecke R, Skelton DC, Pattengale PK, Shimada H, Kohn DB. Combination of CD80 and granulocyte–macrophage colony-stimulating factor coexpression by a leukemia cell vaccine: preclinical studies in a murine model recapitulating Philadelphia chromosome-positive acute lymphoblastic leukemia. Hum Gene Ther 1999; 10: 2109–2122. Matulonis U, Dosiou C, Freeman G, Lamont C, Mauch P, Nadler LM, Griffin JD. B7-1 is superior to B7-2 costimulation in the induction and maintenance of T cell-mediated antileukemia immunity. Further evidence that B7-1 and B7-2 are functionally distinct. J Immunol 1996; 156: 1126–1131.