Unnoticed diversity within the disjunct moss ...

Medina & al. • Unnoticed diversity in Orthotrichum tenellum

TAXON 62 (6) • December 2013: 1133–1152

Unnoticed diversity within the disjunct moss Orthotrichum tenellum s.l. validated by morphological and molecular approaches Rafael Medina,1,2 Francisco Lara,1 Bernard Goffinet,2 Ricardo Garilleti3 & Vicente Mazimpaka1 1 Departamento de Biología (Botánica), c/ Darwin 2, Facultad de Ciencias, Universidad Autónoma de Madrid, 28049 Madrid, Spain 2 Ecology and Evolutionary Biology, University of Connecticut, 75 North Eagleville Rd., Storrs, Connecticut 06269-3043, U.S.A. 3 Departamento de Botánica, Facultad de Farmacia, Universidad de Valencia, Av. Vicente Andrés Estellés s/n, 46100 Burjassot, Spain Author for correspondence: Rafael Medina, [email protected] Abstract Transoceanic disjunctions are thought to be common in species of bryophytes. While much effort focuses on identifying the causes of these disjunctions, few studies test the assumption that the disjunct populations are conspecific. The moss Orthotrichum tenellum is considered to be disjunct between western North America and the western Old World. A thorough morphological revision together with molecular analyses using four plastid (atpB-rbcL, rps4, trnG, trnL-F) and two nuclear loci (adk, ort-LFY) reveals that this putative taxon is composed of six well-supported species, each of them diagnosable by morphological and phylogenetic criteria. Furthermore, these species, which were previously treated as a single, morphologically variable taxon, belong to different lineages within the genus and are the result of separated evolutionary histories. Only two of them (O. tenellum s.str., O. norrisii) are sister species that may have resulted from speciation following a transatlantic disjunction. Today, all species are either restricted to the Old World (i.e., O. tenellum s.str., O. comosum sp. nov.) or endemic to North America (i.e., O. coulteri, O. norrisii, O cucullatum sp. nov., O. franciscanum sp. nov.). This work emphasizes the relevance of integrative approaches to solve taxonomic problems and to provide more solid bases for biodiversity assessment. Keywords California; integrative taxonomy; Mediterranean Region; Orthotrichum comosum; Orthotrichum cucullatum; Orthotrichum franciscanum Supplementary Material The Electronic Supplement (Appendix S1: Full species descriptions and ecology of species) and the alignment are available in the Supplementary Data section of the online version of this article (http://ingentaconnect .com/content/iapt.tax).

Received: 18 Feb. 2013; revision received: 6 Sep. 2013; accepted: 25 Sep. 2013. DOI: http://dx.doi.org/10.12705/626.15

INTRODUCTION Species delimitation still represents a significant challenge in the modern life sciences, with consequences on fields such as conservation biology and the understanding of evolutionary processes. In recent times, discussions on this issue are increasingly gaining prominence (Sites & Marshall, 2003; Wiens, 2007). In this context, the approaches of integrative taxonomy (Dayrat, 2005) that seek reciprocal illumination (Steele & Pires, 2011) from different sources of information (e.g., morphological and molecular data) provide several advantages. Integrative taxonomy not only results in more robust and trustworthy species delimitation than partial approaches, it also allows for the recognition of species by a higher number of researchers. The study of organisms that are “morphologically austere”, where a substantial proportion of diversity is often difficult to detect (Bickford & al., 2007), can especially benefit from integrative approaches. Bryophytes belong to this kind of organisms, since their relatively simple organization results in a limited availability of morphological characters. The contribution of the molecular phylogenetic approach to bryophyte taxonomy has yielded a reduction of species number as

a general trend (Vanderpoorten & Shaw, 2010; but see Medina N.G. & al., 2011). In the past, populations from disjunct localities were often treated as distinct species. However, during the 20th century many taxa with ambiguous morphological differentiation would be considered conspecific despite their geographic isolation (Shaw, 2001). Indeed, phylogeographic inferences reveal that oceans frequently do not constitute a barrier to gene flow (Heinrichs & al., 2009) and hence that species can exhibit transoceanic ranges. Other cases showed a complex genetic structure that suggested the existence of several cryptic species (Shaw, 2001; Heinrichs & al., 2009), that is, species that are supposedly indistinguishable by comparative morphology. This has also been reported within a specific geographical area (e.g., Fernandez & al., 2006; Wachowiak & al., 2007). Nevertheless, most of the works that conclude the existence of cryptic bryophyte species lack a critical morphological evaluation of the studied specimens and the cryptic nature of the diversity discovered by molecular data is assumed. Studies by Medina & al. (2012) or Renner & al. (2010) have, however, shown that critical morphological analyses can reveal diagnostic characters for molecular lineages formerly merged within a single taxon.

Version of Record (identical to print version).

1133


We present here a new case study within Orthotrichum Hedw., a remarkably diversified genus among bryophytes, comprising at least 163 species (Goffinet & al., 2007 updated according to Fedosov & Ignatova, 2010; Garilleti & al., 2011; Lara & al., 2007, 2009a, b; Medina R. & al., 2008, 2011, 2012; Plášek & al., 2009). The target of this work is O. tenellum Bruch ex Brid., a species considered morphologically very variable and thought to exhibit a transatlantic disjunction between the western Old World and western North America (Vitt, 1973). Such disjunction between two of the biodiversity hotspots of the World (i.e., the Mediterranean Basin and the Californian Floristic Region; Myers & al., 2000; Mittermeier & al., 2005) is relatively common among bryophytes (Schofield, 1988). During the revision of North American Orthotrichum specimens, an obvious inconsistency between the morphological circumscription of O. tenellum in Europe and America became apparent, and remained even after the description of O. norrisii F. Lara & al. (Medina & al., 2008). Consequently, a thorough morphological revision of O. tenellum s.l. was undertaken and the emerging partitions tested for monophyly using molecular data. Here we present the results of the phylogenetic analysis of this morphological complex, propose new taxonomic circumscriptions as well as their biogeographic implications.

MATERIALS AND METHODS Taxon sampling and morphological studies. — Approximately 550 specimens formerly identified as Orthotrichum tenellum, and several type specimens housed in different herbaria (B, CAS, COLO, FH, MAUAM, MICH, NY, UC, VAL) were studied (see Appendix 1 for a list of selected specimens examined). The first step for species delimitation consisted in a preliminary clustering of the specimens into species candidates according to an extensive morphological study. The morphological characters used for this purpose include most of those previously considered valuable for Orthotrichum taxonomy (Lewinsky, 1993), plus some other diagnostic features established for this work on the basis of the experience of our research group on the genus. Relevant traits of the gametophyte include plant size and habit, several leaf characters such as shape, margins and apical differentiations, gemmae morphology, and calyptrae and vaginulae shape, size and hairiness. The sporophyte provides many diagnostic characters, and sterile specimens are often impossible to identify with confidence. Sporophyte characters include seta length, capsule length and shape, differentiation and structure of exothecial bands, stomata position and degree of immersion of guard cells, configuration and ornamentation of peristome and spore size. DNA extraction and sequencing. — A meticulous selection of specimens of all species candidates was used for the phylogenetic analyses. The identification of these specimens was carefully double-checked before DNA extraction. Other specimens from several Orthotrichum taxa with immersed stomata were included in order to outline the phylogenetic relationships among species and some closely related lineages. 1134

TAXON 62 (6) • December 2013: 1133–1152

Specimens of Orthotrichum species with superficial stomata and other Orthotrichaceae were included as outgroup. Genomic DNA from the specimens was extracted following the CTAB extraction protocol (Doyle & Doyle, 1987) modified for Orthotrichaceae as described in Goffinet & al. (1998). The DNA of some specimens was extracted using a commercial kit (DNeasy Plant Mini Kit; Qiagen, Valencia, California, U.S.A.) following the manufacturer’s instructions. After testing the variability of several genomic regions, six loci were selected; four from the chloroplast genome (atpB-rbcL, rps4, trnG, trnL-F) and, aiming at obtaining an independently inherited phylogenetic signal, two from the nuclear genome (adk, LFY). The chloroplast loci were amplified by simple PCR in a final volume of 25 μL with 0.2 μL Taq DNA polymerase (for loci atpB-rbcL and trnG) or HotMaster Taq DNA polymerase (5 PRIME, Hamburg, Germany; for rps4 and trnL-F), 2.5 μL of the Mg2+ buffer provided by the manufacturer, 1 μL of 10 μM dNTP mix, 1 μL of each primer (10 μM) and 1 μL of the DNA extract. After an initial denaturation step of 5 min at 94°C, 30 cycles were carried out consisting of 30 s denaturation at 95°C, 1 min of annealing (48°C for trnG and 52°C for the other loci) and a 30 s extension at 68°C, followed by a final extension step of 7 min. All primers used for the PCR reactions are listed in Table 1. The nuclear loci (adk, LFY) were amplified using a nested PCR approach, whereby an initial amplification with published primers provided a template for a second amplification using internal, newly designed primers. The external reactions were carried out in the same conditions of reaction volumes and concentrations as those for the chloroplast loci, but with an annealing temperature of 50°C. For the internal PCR, 0.5 μL of the product of the external PCR was used as the template, and the annealing temperature was set to 54°C. Blasting the sequences obtained for the nuclear locus LFY did not yield any hits in GenBank with a significant similarity. Comparison of the publically available LFY sequences and those generated here revealed that the sequences of the primer annealing sites and the adjacent downstream sequences are alignable, but that the main portions of the sequences are not. Thus, it is likely that the LFY sequences obtained here are homologous to another paralogous LFY locus but have undergone dramatic divergence that prevents alignment. To highlight the potential of a paralogous locus, we will refer to our sequences as ort-LFY. Within the sampled Orthotrichaceae, ort-LFY sequences vary extensively in length (i.e., 800–1100 bp) but comprise several common homologous domains that were used to guide the alignment. Regions between these markers were typically highly divergent, and aligned into non-overlapping blocks coded as indels (see below). Preliminary phylogenetic inferences from ort-LFY sequences with and without indel coding yielded results consistent with those from adk and the chloroplast loci, and the ILD test (Farris & al., 1994), did not find any significant incongruence between them. Consequently, the ort-LFY region was considered informative and included in the analyses. PCR products were purified using the Nucleospin Extraction Kit (Machery-Nagel, Düren, Germany). Sequencing reactions were conducted in a final volume of 10 μL with ABI



TAXON 62 (6) • December 2013: 1133–1152

BigDye Terminator and cleaned as described in Buck & al. (2000). The samples were read using an ABI Prism 3100 Genetic Analyser (Applied Biosystems, Foster City, California, U.S.A.) with the same primers used in the PCR reactions. Phylogenetic analyses. — Sequence contigs were assembled using Sequencher v.3.1.1. (Gene Codes Corp., http:// genecodes.com) and Geneious v.5.1.7.0 (Biomatters Ltd., http:// www.geneious.com) and the matrices for each locus were built using PhyDE (Müller & al., 2006). The sequences were first aligned with Clustal W (Larkin & al., 2007) or, for those loci with greater alignment difficulties, with MUSCLE v.3.8 (http:// www.ebi.ac.uk/Tools/msa/muscle/; Edgar, 2004), then manually adjusted and trimmed at the ends. The congruence of the different loci of each genome was checked by the ILD test based on 1000 replications with TBR selected as swapping algorithm. The partial alignments of the different loci for each genome were combined into two matrices (plastid and nuclear). The insertions and deletions were coded and these additional characters added to each matrix according to the simple-coding algorithm (Simmons & Ochoterena, 2000) implemented in SeqState v.1.4 (Muller, 2005). The plastid and nuclear matrices were analysed under maximum likelihood (ML) and Bayesian inference (BI). For these analyses, the chloroplast and nuclear matrices were partitioned into the different loci, plus a final partition for the coded indels. The best substitution model for each partition was estimated using the Akaike information criterion (AIC)

and the Bayesian information criterion (BIC) as implemented in jModelTest v.0.1.1 (Posada, 2008). When both criteria did not agree on the best model, replicates of all analyses were conducted to check whether model choice did result in significantly different results. If two distinct models emerged as the best under each criterion, the one with the lowest number of variables was chosen. For the indel partition in both matrices, the F81 model was implemented in ML and BI analyses, as recommended in Ronquist & al. (2005). For the ML method, the matrices were analysed with the software GARLI v.2.0 (Zwickl, 2006) implementing a partitioned analysis, specifying the substitution model for each partition and using the default settings for the remaining parameters. Nonparametric bootstrapping (Felsenstein, 1985) with 200 pseudoreplicates was used for estimating the statistical support of branches, and the consensus tree was obtained with the program SumTrees v.3.3.1 as implemented in DendroPy v.3.8.0 (Sukumaran & Holder, 2010). Bayesian inference phylogenetic analyses were carried out using MrBayes v.3.2.1 (Ronquist & Huelsenbeck, 2003) running a partitioned analysis and specifying the substitution model for each block. The Markov Chain Monte Carlo (MCMC) simulation was executed for 5,000,000 generations for the chloroplast genome matrix and for 2,000,000 generations for the nuclear genome matrix, both with two runs and four chains, sampling trees and parameters each 1000th generation. Posterior probabilities (PP) were estimated from the 50% majority-rule

Locus

Chloroplast

atpB-rbcL rps4 trnG trnL-F

Primer pair

Sequence 5′→3′

atB

ACATCKARTACKGGACCAATAA

rbcL

AACACCAGCTTTRAATCCAA

rpsA

ATGTCCCGTTATCGAGGACCT

trnaS

TACCGAGGGTTCGAATC

trnG-F

CGGGTACGGGAATCGAAC

trnG-R

GCGGGTATAGTTTAGTGG

trnC

ATTTGAACTGGTGACACGAG

trnF

CGAAATCGGTAGACGCTACG

ext adk Nuclear

int ext ort-LFY int

adk-F

GAAGAAGCCAGAAAACTGGGC

adk-R

GTCACCTTTCCATCTTCAGCAAC

ort-adk-F

GTGGAGAGGGCGAAG

ort-adk-R

ACCTGGGCAAATGTC

LFY1428F

GGAAGAAGAATGGATTGGACTA

LFY2327R

TCTCATCTTTGGCTTGTTTATG

ort-LFY-F

CTSTTTGATTTGTATGAACAGTG

ort-LFY-R

GTAGCYAGCYCCTGTMAGTTTCG

Annealing temperature

Table 1. Primers used in the polymerase chain reaction (PCR), optimal annealing temperature for each locus, bibliographic reference and best substitution model for each locus according to AIC and BIC criteria implemented in jModelTest.

52°C 52°C

Best model (jModelTest) Bibliographic source

AIC

BIC

Chiang & al., 1998

GTR + G

GTR + G

Nadot & al., 1994 Souza-Chies & al., 1997

GTR + G + I GTR + G + I

48°

Pacak & SzweykowskaKulińska, 2000

GTR + G

HKY + G*

52°C

Taberlet & al., 1991

GTR + G

HKY + G*

50°C

McDaniel & al., 2010 GTR + G

HKY + G*

54°C

Designed for this study

50°C

Shaw & al., 2003 Designed by Sandra Boles (Duke) for this study

GTR + G

HKY + G*

54°C

* When different models were obtained for the same locus, alternative analyses with all possible model combinations were conducted to examine whether model choice led to significantly different results. In those cases, the model with fewer variables was chosen for the final analysis (marked with an asterisk)


1135


consensus trees obtained for the plastid and the nuclear datasets after a burn-in of 25% of the starting trees and plotted using FigTree v.1.3.1 (Rambaut & Drummond, 2010). Species delimitation was additionally tested using the genealogical sorting index (gsiT; Cummings & al., 2008). For a given rooted phylogeny, this method estimates the degree of exclusive ancestry of the groups manually labelled, in this case, according to the morphological delimitation. The gsiT maximum value is 1, acting as a monophyly test in which the null hypothesis to be rejected is that the labelled clusters are random. Coalescent simulations for 1000 generations were used for the resulting collection of bootstrap (BS) pseudoreplicate trees for (ML) and postburn-in trees (BI). The method also provides a P-value for the probability that random mating could result in the same clustering.

RESULTS Morphological approach. — The taxonomic revision of the studied material reveals that Orthotrichum tenellum s.l. comprises six morphotypes, each of them defined by a consistent combination of independent characters (Table 2) that would lead to the recognition of six distinct morphological species. None of these morphospecies exhibits a transatlantic disjunction; the species are either restricted to the Old or the New World. Orthotrichum tenellum s.str. is absent from the American continent, and its distribution is centred in the Mediterranean region. This area also harbours a new morphospecies: O. comosum sp. nov. In the Californian Floristic Region, four different morphospecies are present: O. coulteri Mitt., a former synonym here reinstated (28% of the examined American specimens), O. norrisii F. Lara & al. (27%), and two new species: O. cucullatum sp. nov. (25%) and O. franciscanum sp. nov. (10%). About 10% of the remaining North American specimens examined were misidentified, and correspond to O. columbicum Mitt. and similar species (O. consimile Mitt., O. confusum R. Medina, F. Lara & Garilleti and O. persimile F. Lara & al.). This morphological species delimitation was used as a working hypothesis for the molecular phylogenetic analyses. Phylogenetic reconstruction: plastid loci. — The combined alignment of the four plastid loci plus the indel block consists of 104 specimens by 2432 characters (atpB-rbcL 569 bp; rps4 651 bp; trnG 538 bp; trnL-F 532 bp; indel block 142 binary characters), of which 402 positions (311 nucleotide positions and 91 binary characters) are parsimony-informative. The ILD test did not find significant incongruence among the combination of loci except for atpB-rbcL versus rps4 and trnG. The results of the ML and BI analyses (Fig. 1) resolved all morphospecies as monophyletic groups. The main ingroup clades of the entire analysis were provisionally named A, B, C and D. Orthotrichum tenellum and O. norrisii are resolved as sister taxa, with a posterior probability (PP) value of 1.0 and 0.72. ML bootstrap support values were low (57 and 55), but gsiT values are higher than 0.8 for both species with P = 0.001. This O. tenellum + O. norrisii clade shares a unique common ancestor with another robust clade (PP = 1.0; BS = 0.91) 1136

TAXON 62 (6) • December 2013: 1133–1152

composed of O. bartramii R.S. Williams, O. sharpii H. Rob. and O. comosum, all belonging to clade A. The remaining three morphospecies considered in this work (i.e., O. coulteri, O. cucullatum, O. franciscanum) are resolved as robust clades (PP = 1.0; BS > 95; gsiT = 1 and P = 0.001) within clade B, which also includes other Orthotrichum species endemic to the Californian Floristic Region (Fig. 1): O. persimile, O. euryphyllum Venturi in Röll, and O. underwoodii F. Lara & al.; as well as the Andean O. tristriatum Lewinsky. Clades A and B form a robust monophyletic group which is sister to O. flowersii Vitt. The remaining ingroup specimens are resolved into two basal clades (C and D, collapsed in Fig. 1). Clade C contains O. alpestre Bruch & Schimp., O. patens Bruch ex Brid. and O. stramineum Hornsch. ex Brid. Finally, clade D hosts some representatives of O. subg. Orthotrichum (O. anomalum Hedw., O. cupulatum Hoffm. ex Brid.) and other taxa of O. subg. Pulchella (Schimp.) Vitt (O. consimile, O. columbicum, O. pulchellum Brunt., O. aequatoreum Mitt., O. confusum). Both clades C and D are strongly supported (PP = 1.0; BS = 100). The plastid tree has mostly branches with high statistical support at the species level; some basal nodes with weak BS do not effect species delimitation. Phylogenetic reconstruction: nuclear loci. — The amplification of nuclear loci for the specimens included in the chloroplast matrix was not always successful and sequences of both the adk and ort-LFY loci were obtained only for 73 specimens, which were included in the nuclear matrix. The combined alignment for the adk and ort-LFY loci contains 3181 positions (adk 465 bp; ort-LFY 2594 bp; indel block 122 binary characters), 506 of which are parsimony-informative (415 nucleotide positions and 91 binary characters). The resulting consensus topology of the ML and BI analyses (Fig. 2) also resolves all morphospecies as monophyletic groups with very high support (PP = 1.0; BS > 95; gsiT > 0.980 and P = 0.001). Most relationships among species are well supported by the nuclear data (Fig. 2). The composition of clades A–D is identical to that inferred from chloroplast data (with the exception of Orthotrichum pilosissimum R. Medina & al., that is resolved in clade B instead of clade A). Support from the nuclear data for clades A, B and D (C being only represented here by two accessions of a single species) is stronger than that obtained from the plastid data. Clades A–D represent maximally supported monophyletic groups. The nuclear tree resolves clades A and D as sister lineages (versus A and B in the plastid data), and clade B is sister to clades A, C and D (Fig. 2). These topological differences between plastid and nuclear trees have no effect on species delimitation.

DISCUSSION Morphological variation within Orthotrichum tenellum s.l. can be partitioned into six distinct character combinations. Morphospecies diagnosed by these traits satisfy the monophyly criterion based on inferences from DNA sequence data from both



TAXON 62 (6) • December 2013: 1133–1152

the plastid and nuclear genomes. Furthermore, these entities are shown to have arisen from different ancestors and thus to have distinct evolutionary histories. Hence, we propose to abandon the broad concept of O. tenellum in favour of six taxa. All species are geographically restricted to either the Old or New World, and thus, none exhibits a transatlantic disjunction. The species and their distribution are: O. tenellum s.str. (hereafter simply O. tenellum) and O. comosum, both from the Mediterranean

Region and adjacent areas, and O. coulteri, O. norrisii, O. cucullatum and O. franciscanum, all endemic to California. Morphological delimitation. — The correct identification of these Orthotrichum species can be a thorny issue, and they have been historically confused or overlooked for good reasons. The species included in this study are small to mediumsized mosses with leaves mostly lanceolate to ovate-lanceolate, appressed when dry and with recurved margins; in all cases,

Table 2. Morphological characters diagnostic of the species studied.

O. tenellum

O. coulteri

O. norrisii

O. comosum

O. cucullatum

O. franciscanum

Plant size [cm]

0.3–1.2

0.3–0.8(–1.4)

0.6–1.0(–1.5)

0.3–0.9

0.3–0.8(–1.2)

(0.2–)0.4–0.8

Leaf shape

Ligulate to ovatelanceolate

Long triangular to ovate-lanceolate

Lanceolate to ovate-lanceolate

Linear-lanceolate to ovate-lanceolate

Ligulate to ovate-ligulate

Linear lanceolate to ovate-ligulate

Leaf apex

Rounded to acute; channelled

Acute to subobtuse; blunt

Acute to rounded; folded or channelled

Blunt-acute to acuminate; mucronate

Blunt to rounded; almost plane or cucullate

Acute to acuminate; plane, with hyaline apiculum

Leaf margin

Recurved

Recurved

Recurved

Recurved (revolute)

Recurved

Distinctly revolute at mid-leaf

Vaginula hairiness and length [mm]

Naked; 0.3–0.6

With abundant hairs; (0.5–)0.6–0.8

Hairy; 0.3–0.8

Naked; 0.25–0.4(–0.6)

Hairy; 0.2–0.3(–0.5)

Sparsely hairy; 0.3–0.5

Calyptra shape and hairiness

Fusiform to oblong-conic, sparsely hairy

Narrowly oblongconic to fusiform, densely hairy

Oblong-conic, hairy towards apex

Oblong-conic, with Ovoid to oblongconic, naked or a distinct apical with sparse hairs hairy comma

Oblong-conic to fusiform, sparsely hairy

Seta length [mm]

0.4–0.8(–1.0)

0.8–1.5(–2.2)

(0.5–)0.7–1.0

0.3–0.6

(0.35–)0.5–0.75

0.4–0.8(–1.0)

Mature and empty capsule shape

Subcylindrical, constricted below mouth

Cylindrical, slightly constricted below mouth

Cylindrical, not constricted

Subcylindrical, constricted in upper half

Subcylindrical, constricted in upper half

Subcylindrical, variably constricted in upper half

Exothecial band width

4–6 cells

(2–)3–4 cells

2(–3) cells

4–5 cells

4–6 cells

3–4(–5)

Stomata position on capsule

Lower half, but not on neck

Lower third and neck


Lower half and neck


Lower half and neck

Exostome outer peristome layer ornamentation

Dense papillae

Dense papillae (occasionally with vermicular lines towards apex)

Dense papillae, Basal papillae and often with vermicu- vermicular lines towards apex lar lines towards apex

Basal papillae and vermicular lines towards apex

Papillae and faint transversal lines at base, vermicular lines towards apex

Spore size [µm]

12–17(–21)

12–18(–22)

(12–)15–17(–21)

12–16(–20)

(10–)12–16(–20)

(10–)12–16(–18)


1137


Fig. 1. Majority-rule consensus tree of the Bayesian inference obtained from the analysis of the partitioned matrix for the chloroplast loci atpB-rbcL (GTR + G model), rps4 (GTR + G + I), trnG (HKY + G), trnL-F (HKY + G) and the indel block (F81). Branch support is shown as Bayesian posterior probabilities (upper or left values) and as bootstrap values for the maximum likelihood analysis (lower or right values). The genealogical sorting index (gsiT) of the studied species and its P-value are shown in grey boxes.

1138


TAXON 62 (6) • December 2013: 1133–1152

TAXON 62 (6) • December 2013: 1133–1152


Fig. 2. Majority-rule consensus tree of the Bayesian inference obtained from the analysis of the partitioned matrix for the nuclear loci adk (HKY + G model), ort-LFY (HKY + G) and the indel block (F81). Branch support is shown as Bayesian posterior probabilities (upper or left values) and as bootstrap values for the maximum likelihood analysis (lower or right values). The genealogical sorting index (gsiT) of the studied species and its P-value are shown in grey boxes.


1139


brown gemmae on leaves are common; the capsules are immersed to emergent (except for O. coulteri, which has exserted capsules) and markedly ribbed. They also share cryptoporous stomata in the lower half of the urn, with the guard cells almost to completely covered by surrounding cells, and the peristome composed of eight recurved exostome teeth alternating with eight endostome segments. Despite these similarities, they can be segregated by particular combinations of morphological character states (Table 2), particularly leaf apex differentiation, vaginula and calyptra hairiness, capsule shape, width of exothecial bands and stomata position. Orthotrichum tenellum is characterized by a unique combination of character states: ovate-lanceolate leaves with distinct apices showing incurved margins, often forming a short channel; emergent subcylindrical capsule, constricted below the mouth and markedly ribbed, exothecial bands formed by 4–6 rows of cells; stomata in lower half of urn, not reaching the neck; vaginula naked and calyptra slightly to moderate hairy. Orthotrichum norrisii shares with O. tenellum the channelled leaf apices, the emergent, ribbed capsule, and the stomata in the lower half of the urn but absent in the neck. Unlike O. tenellum, O. norrisii has hairy vaginulae and cylindrical capsules that are not constricted below the mouth when mature and empty. Furthermore, the bands of exothecial cells are distinctively biseriate in O. norrisii (Medina & al., 2008). The outer peristome layer (OPL) of the exostome is densely papillose in both taxa, but in O. norrisii it is also commonly ornamented by vermicular lines towards the apex, whereas the presence of striae, usually isolated and never forming a pattern, is exceptional in O. tenellum. The channelled leaf apex is also shared with other Orthotrichum species, namely O. bartramii, O. scanicum Grönvall, O. pilosissimum and O. columbicum. Several morphological characters prevent confusion of any of these taxa with O. tenellum or O. norrisii. Leaves of O. bartramii are oblong and abruptly cuspidate into a very well formed apical channel, and the rhizoids are typically ascending along the stems. Additionally, the capsules are oblong to oblong-cylindrical, constricted below the mouth and with exothecial bands 4–8 cells wide (Vitt, 1973). Like O. norrisii, O. scanicum has narrow exothecial bands, but its split exostome teeth, 16 endostome segments and a characteristic convex, orange operculum clearly distinguish this species (Medina & al., 2009). Orthotrichum pilosissimum is easily identified by its remarkably long and branched axillary hairs, as well as by its strongly constricted capsules (Medina R. & al., 2011). Finally, O. columbicum is distinct from the former species by its completely exserted capsules, naked calyptrae and vaginulae, and its leaves, which are long triangular and flexuose when dry (Medina & al., 2012). Another species that strongly resembles O. tenellum is O. comosum. The most distinctive trait of this small moss is the oblong-conic calyptra, with a terminal comma of papillose hairs. The leaves are acute to acuminate, often mucronate, but never channelled. The vaginula is naked, the capsule is immersed, markedly constricted and strongly ribbed when empty and dry, the exothecial bands consits of 4–5 rows of cells, and the stomata are located in the lower half of the urn and neck. 1140

TAXON 62 (6) • December 2013: 1133–1152

Finally, the outer surface of the exostome teeth has apical striae in O. comosum, whereas they are very rare in O. tenellum. Until now, this species has been overlooked and its specimens identified as O. tenellum, but also as O. alpestre. The latter is distinguished by its hairy vaginula, general lack of gemmae, and by the long, branched papillae on the mid-leaf cells. Furthermore, O. alpestre is a boreal species and is restricted to colder, montane habitats in the Mediterranean Region. Orthotrichum franciscanum can be identified by its distinct leaves. They are linear-lanceolate to ovate-ligulate, with distinctly revolute margins towards the middle of the lamina and acuminate, non-channelled apices, often ending in one or few elongated hyaline cells. This species has sparsely hairy or naked vaginulae and sparsely hairy calyptrae, subcylindrical and furrowed capsules with exothecial bands 3–5 cells wide and stomata in the lower half of the urn and neck. Exostome teeth pairs are frequently truncate, a character that may also help in the identification. Orthotrichum cucullatum also has very distinctive leaves which are ligulate to ovate-ligulate with a characteristic obtuserounded apex, often cucullate and hood-like, but not channelled. This species has sparsely hairy vaginulae, while its calyptrae can be naked or have sparse, short hairs. The capsules are subcylindrical, furrowed, with exothecial bands 4–6 cells wide and stomata in the lower part of the urn, but absent from the neck. Finally, O. coulteri has exserted capsules, which are cylindrical and slightly constricted below the mouth when dry and empty. Exothecial bands are usually 4 cells wide and the stomata are present in the lower capsule urn and the neck. The leaves are long triangular to ovate-lanceolate with acute or blunt, non-channelled apices. It typically has densely hairy vaginulae and calyptrae. Due to its exserted capsule and hairy calyptra and vaginula, it looks similar to O. consimile and O. persimile. However, these species differ by their leaves which are slightly flexuose when dry (appressed in O. coulteri) and by other leaf traits such as the hyaline apical cells and plane leaf margins of O. persimile and the unguiculate or channelled apices of O. consimile (Medina & al., 2012). Phylogenetic reconstruction. — Orthotrichum tenellum and O. norrisii diverged from a unique common ancestor. Considering the short branches that define them, in particular O. norrisii, their divergence may be fairly recent. Support for their reciprocal monophyly is strongly based on the nuclear data (according to both, ML and BI analyses), the BI of the plastid data and the gsiT values from both datasets. The ML results from the plastid dataset contained less support for these two taxa, but are yet compatible with the existence of two clades reaching coalescence (Zander, 2008; Shaw, 2009; Vanderpoorten & Shaw, 2010). All remaining morphospecies are resolved as monophyletic with strong PP, BS and gsiT values in phylogenetic reconstructions using both chloroplast and nuclear data. Concerning the general phylogeny of all sampled taxa, some relationships can be inferred from the results of the chloroplast and the nuclear analyses. Both trees point towards the existence of four main clades (A, B, C, D). Their relative topology is not completely resolved: [(A,B)(C,D)] in the



TAXON 62 (6) • December 2013: 1133–1152

chloroplast tree and [((A,D)C)B] in the nuclear tree. Such kind of incongruence between the phylogenetic signals of different genomes is relatively frequent in bryophyte studies (e.g., Draper & al., 2007; Hernández-Maqueda & al., 2008). Its causes may be diverse and do not constitute an objective of this work, since it has no effect on the species delimitation proposed here. The position in the chloroplast tree of the Orthotrichum species with superficial stomata, O. affine and O. acuminatum, within the outgroup, supports the hypothesis that Orthotrichum s.l. is polyphyletic. In contrast to this, Orthotrichum species with immersed stomata form a well-supported clade as already outlined in previous studies (Goffinet & al., 2004; Sawicki & al., 2009, 2012). During the progress of this research, we have found that combining datasets which were found to contain congruent phylogenetic signal and including indel information remarkably improved the backbone topology and support of the phylogenetic reconstruction when compared with analyses based on a single locus. However, since many of the backbone clades still lack optimal statistical support, and our chloroplast and nuclear topologies show some incongruence, thorough taxon sampling and data collection will be needed in order to obtain a solid phylogenetic reconstruction of this group. Despite their arguable overall similarity, the studied species do not constitute a single natural group. Instead, they belong to distinct phylogenetic lineages within the Orthotrichum species with immersed stomata. This situation is analogous to that found in the pseudo-cryptic complex of O. consimile s.l. (Medina & al., 2012). In both cases, species are diagnosed by combinations of the morphological characters. Except for rare instances of polymorphisms of particular traits, these combinations are conserved within these species, but the traits defining the combinations may be homoplasious. The distribution of alternative states of a single character across the phylogeny (e.g., straight and channelled leaf apices or hairy and naked vaginulae) indicates that multiple transitions occurred, although the polarity of the shifts is not clear until ancestral states are reconstructed within a comprehensive phylogenetic framework. Notwithstanding that character transformation can be highly homoplasious and hence obscure phylogenetic relationships, they do contribute to the delimitation of species, especially when relationships within species complexes are resolved using independent data; the phylogenetic informativeness of morphological traits may be best assessed when morphological and molecular inferences are integrated in a comprehensive approach. Nomenclature insights. — Besides the discussed complexity of species delimitation, a historical and nomenclatural problem needs also to be addressed in order to understand the causes of the misunderstanding of this group. Orthotrichum tenellum was first described from German material (Bridel, 1827). Some decades later, a new Californian taxon was described under two different names in the course of one year: O. coulteri (Mitten, 1864) and O. cylindrocarpum Lesq. (Lesquereux, 1865). Priority of these two names is not straightforward, and confusion about dates of publication are frequent in the bibliography. The origin of the confusion may be some comments in the protologue of O. coulteri that literally cite the original description

of O. cylindrocarpum, erroneously suggesting that Mitten’s name was published later. The facts are that O. cylindrocarpum and O. coulteri were presented, but not validly published at that time, in lectures to the American Philosophical Society (19 June 1863) and the Linnean Society (22 January 1864), respectively. In his description of O. coulteri, Mitten partially quotes the description of O. cylindrocarpum, which suggests that he had a full transcription of Lesquereux’s dissertation when preparing the publication of his species. Finally, O. coulteri was validly published in 1864 (J. Proc. Linn. Soc., Bot. vol. 8, issue 29), while the description of O. cylindrocarpum took place in 1865 (Trans. Amer. Philos. Soc. vol. 13, part 1). The consideration proposed here, that O. cylindrocarpum is a synonym of the name that has priority, O. coulteri, is substantiated by the examination of the type specimens kept at three different herbaria (FH !, MICH !, NY !). All O. cylindrocarpum type vouchers are mixed samples, with O. coulteri as the only species present in all of them and matching the descriptions of Mitten (1864) and Lesquereux (1865). The conspecifity of O. coulteri and O. cylindrocarpum was first formally proposed in the Manual of the Mosses of North America (Lesquereux & James, 1884), although O. cylindrocarpum was erroneously considered to be the correct name. The description in this work is accurate, as well as the plate in the supplement of Icones Muscorum (Sullivant, 1874). Orthotrichum tenellum is recorded for the first time in America (at the base of the Rocky Mountains, E. Hall, Wolf & Rothrock legit) in the Manual. We have not found this specimen, but considering the overall results of the present study, this record should be considered at least dubious until properly checked. In the treatment of Orthotrichales in North American Flora (Grout, 1946), a very wide and variable concept of O. tenellum was adopted, and O. coulteri was treated as a variety of O. tenellum. We have examined some of the exsiccata used for Grout’s revision and all correspond to O. coulteri. Although Grout himself pointed out that European bryologists did not think that the species described in the Lesquereux & James’ Manual was O. tenellum, he adopted a broad circumscription of O. tenellum. Finally, Vitt (1973) synonymized O. coulteri and O. cylindrocarpum with O. tenellum. As a consequence of such a wide concept, O. tenellum was considered a very variable species in California (e.g., Vitt, 1973, 2009), and the four species reported from the area in the present work have been synonymized with O. tenellum (case of O. coulteri) or overlooked (O. norrisii, O. cucullatum, O. franciscanum). However, this concept does not fit the European populations (e.g., Casas & al., 2006; Cortini Pedrotti & Lara, 2001; Smith 2004). Biogeography and ecology. — All studied species live in regions with a Mediterranean climate and have their optimum in relatively warm environments, with a dry summer season but with variable oceanic influence. They may also spread into adjacent climatic conditions, growing in more exposed microtopes under submediterranean climates. They are all epiphytic, growing on trunks and branches of a number of different trees and shrubs in variable ecological contexts: they thrive especially in sclerophyllous forests, thickets with sparse trees and on ornamental trees in urban parks, but also in deciduous forests at


1141


low elevations or along riversides. Occasionally, they can also be found on rocks in such environments. In contrast to the concept of a single taxon, O. tenellum s.l., with a disjunct distribution between the Mediterranean and the Californian Floristic Regions, our morphological and phylogenetic inferences led to the concept of six species, with discrete and distinct geographic distribution (Fig. 13). Some endemics of the Californian Floristic Region grow sympatrically, often sharing the same environments and in the same epiphytic communities: O. coulteri, O. cucullatum and O. franciscanum. Orthotrichum comosum is endemic to the Mediterranean and Macaronesian areas. Finally, the relationship between O. tenellum and O. norrisii suggests very recent allopatric speciation from a transatlantically disjunct ancestral species, resulting in the former being endemic to the Old World and the latter to western North America. While the present study rejects the hypothesis of disjunct species within the O. tenellum complex, such kind of distribution is found in other taxa of the genus such as O. columbicum and O. pulchellum (Medina & al., 2012). Key to species. — In order to facilitate the recognition of studied taxa we provide an artificial key comprising the species of this work. 1 Capsules exserted, vaginula with many long hairs, leaf apices blunt or acute (California) ............... O. coulteri 1 Capsules immersed, vaginula naked or with sparse hairs, leaf apices various . . ........................................... 2 2 At least some leaves with channelled apices .............. 3 2 Leaves without channelled apices .......................... 4 3 Exothecial bands 4–6 cell rows wide, capsules constricted below mouth when dry and empty, vaginula naked (western Palaearctic) ................................... O. tenellum 3 Exothecial bands 2(–3) cell rows wide, capsules cylindrical, not or only slightly constricted below mouth when dry and empty, vaginula with several long hairs (California) ...... .........................................................O. norrisii 4 Leaf apices obtuse or rounded and frequently cucullate (California) ..................................... O. cucullatum 4 Leaf apices acute to acuminate, never rounded and cucullate ............................................................... 5 5 Leaf apices frequently ending in one or a few elongated, hyaline cells, exostome teeth often truncate, calyptra with sparse short hairs (California) ........... O. franciscanum 5 Leaf apices not ending in hyaline cells, exostome teeth triangular, not truncate, calyptra with an apical tuft of robust hairs (western Palaearctic) . . ........... O. comosum

SPECIES DESCRIPTION Updated morphological ranges are given for Orthotrichum tenellum and O. coulteri, together with the formal description of the new taxa O. comosum, O. cucullatum, and O. franciscanum. A short description is given here, for full descriptions see Electronic Supplement: Appendix S1; for a description and distribution range of O. norrisii, see Medina & al. (2008). 1142

TAXON 62 (6) • December 2013: 1133–1152

Orthotrichum tenellum Bruch ex Brid., Bryol. Univ. 1: 786. 1827 – Lectotype (designated by Vitt in Bryophyt. Biblioth. 1: 190. 1973): prope Bipontium [Zweibrücken], Bruch s.n. (B !) Figures 3 and 4. Plants 0.3–1.2(–1.6) cm tall; leaves ligulate to ovatelanceolate; leaf apex rounded to subacute, rarely acute, very often with incurved margins forming a distinct channel; leaf margins recurved; vaginula naked; calyptra with sparse (uni) biseriate, appressed, smooth hairs, rarely densely growing forming a terminal comma; seta 0.4–0.8(–1.0) mm; capsule immersed to shortly emergent, subcylindrical, constricted below mouth and strongly ribbed when dry and empty; eight exothecial bands (3–)4–6 cells wide; stomata cryptopore, located in the lower half of the urn; exostome of 8 pairs of teeth recurved when dry; outer peristome layer (OPL) densely papillose in all its length; endostome of 8 segments; spores 12–17(–21) μm, subspherical, papillose. See full description and ecology in the Electronic Supplement: Appendix S1. Orthotrichum comosum F. Lara, R. Medina & Garilleti, sp. nov. – Holotype: SPAIN. Cádiz, Algeciras, Sierra de la Luna, Quercus forest close to Los Llanos del Juncal, 36°06′02″ N 005°32′14″ W, 700 m, epiphyte on Quercus suber, 13 Mar. 1998, J. Guerra, F. Lara & V. Mazimpaka s.n. (BCB; isotypes: MAUAM, MUB). – “Orthotrichum paivanum” Schimp. in Ber. Thätigk. St. Gallischen Naturwiss. Ges. 1872–73: 172. 1874, nom. nud.: Insula Madeira, Mandon s.n. (BM n.v., PC !, S n.v., TR !). Figures 5 and 6. Plantae humiles, usque ad 0.9 cm altae, confertim frondosae. Folia linearia vel ovato-lanceolata, apicibus acutis sive in cellularum viridium mucronem terminantibus, non canaliculatis, lamina pauce papillosa, marginibus recurvatis. Vaginula nuda, sed calyptra ad apicem proprie comosa. Capsula immersa striataque, stomatibus cryptoporis ex dimidio usque ad collum munita. Peristoma duplex. Exostoma octo dentium paribus recurvatis ad apicemque striatis, endostoma octo segmentis. Plants 0.3–0.9 cm tall; leaves linear-lanceolate to ovatelanceolate; leaf apex plane or slightly keeled, blunt-acute to acuminate, often mucronate; leaf margins recurved to revolute; vaginula naked; calyptra with an apical comma of robust, unior biseriate hairs; seta 0.3–0.6 mm; capsule immersed, cylindrical; eight exothecial bands 4–5 cells wide; stomata cryptopore, present in the lower half (third) of the urn and the neck; exostome of 8 pairs of teeth, recurved when dry; OPL with a variably papillose basal reticule and with vermicular lines towards apex; endostome of 8 segments; spores (10–)12–16(–18) μm, subspherical, coarsely papillose. See full description and ecology in the Electronic Supplement: Appendix S1. Etymology. – The specific epithet refers to the distinct hairy apical comma of the calyptra. Orthotrichum coulteri Mitt. in J. Proc. Linn. Soc. Bot. 8: 25. 1864 ≡ Orthotrichum tenellum var. coulteri (Mitt.) Grout



TAXON 62 (6) • December 2013: 1133–1152

in Britton, N. Amer. Fl. 15A: 19. 1946 – Lectotype (designated by Vitt in Bryophyt. Biblioth. 1: 190. 1973): California, Coulter 839–840 (FH !) = Orthotrichum cylindrocarpum Lesq. in Trans. Amer. Philos. Soc. 13: 6. 1865 ≡ Orthotrichum tenellum var. cylindrocarpum (Lesq.) L.F. Koch in Leafl. W. Bot. 6: 23. 1950 – Lectotype (designated by Vitt in Bryophyt. Biblioth. 1: 190. 1973): California, Oakland, Bolander s.n. (MICH !; isolectotypes: CANM n.v., FH !, NY !) Figures 7 and 8. Plants 0.3–0.8(–1.4) cm tall; leaves long triangular to narrowly lanceolate, rarely ovate-lanceolate; leaf apex acute to subobtuse or blunt, not channelled; leaf margins recurved; vaginula with abundant hairs, uni-biseriate, with thick-walled cells; calyptra with abundant, conspicuous uni-biseriate hairs;

seta 0.8–1.5(–2.2) mm; capsule exserted, cylindrical; eight exothecial bands (2–)3–4 cells wide; stomata cryptopore, restricted to the lower third of the urn and the neck; exostome of 8 triangular pairs of teeth, recurved when dry; OPL uniformly papillose-reticulate; endostome of 8 narrowly triangular to linear segments; spores 12–18(–22) μm, subspherical, papillose. See full description and ecology in the Electronic Supplement: Appendix S1. Orthotrichum cucullatum F. Lara, R. Medina & Garilleti, sp. nov. – Holotype: U.S.A. California. Alameda Co., Berkeley, Tilden Regional Park, Botanical Garden, on trunk of Aesculus californica, 18 Oct. 2008, F. Lara s.n. (CAS; isotype: MAUAM). Figures 9 and 10 Fig. 3. Orthotrichum tenellum. A, habit; B, calyptra with sparse short hairs; C–E, different stages of capsule development; F, naked vaginula, seta and lower half of the capsule; G, leaf shape variation; H & I, leaf apices with incurved margins, forming a distinct channel. — A–F, Lara & al. s.n., 4 Aug. 1999 (MAUAM-2174); G & H, Medina & Medina s.n., 14 Jun. 2006 (MAUAM-4196); I, Albertos & al. s.n., 12 Feb. 1998 (MAUAM-1462).


1143


Plantae ad 0.8 cm altae. Folia ligulata vel ovato-ligulata, marginibus recurvatis, apicibus obtusis rotundatisve, persaepe proprie cucullatis, non canaliculatis. Vaginula pilosa, sed calyptra nuda vel parce pilifera, ovoidea rostrataque. Capsula immersa striataque, stomatibus cryptoporis in dimidio inferiore, collo excluso. Peristoma duplex. Exostoma octo dentium paribus recurvatis, endostoma octo segmentis. Plants 0.3–0.8(–1.2) cm tall; leaves ligulate to ovateligulate; leaf apex rounded to obtuse, almost plane to cucullate, sometimes denticulate; leaf margins recurved; vaginula with scarce uni-biseriate hairs, exceptionally naked; calyptra naked or with inconspicuous stout hairs, not concentrated at tip; seta (0.35–)0.5–0.75 mm long; capsule immersed; eight exothecial bands 4(–6) cells wide; stomata cryptopore, present at lower half of capsule but not on neck; exostome of 8 pairs of teeth, sometimes truncate and splitting, reflexed; OPL ornamented with a dense, papillose reticulum with vermicular lines towards apex; endostome of 8 segments; spores 12–16(–20) μm, subspherical, papillose. See full description and ecology in the Electronic Supplement: Appendix S1. Etymology. – The specific epithet refers to the cucullate leaf apices of the new species.

TAXON 62 (6) • December 2013: 1133–1152

Orthotrichum franciscanum F. Lara, R. Medina & Garilleti, sp. nov. – Holotype: U.S.A. California. San Francisco Co., Holly Park, off Holly Drive, 37°44′15″ N 122°25′10″ W, 300 ft; on trunk of Eucalyptus, near the hill top, 1 Apr. 2000, J.R. Shevock 19132 (UC No. 1741964 !; isotypes: CAS No. 1017063 !, MAUAM !). Figures 11 and 12. Plantae humiles, ad 0.8 cm altae. Folia linearia, lanceolata vel ovato-lanceolata, apicibus planis, acutis acuminatisve, persaepe in elongatas cellulas hyalinas terminantia; marginibus recurvatis, sed ad laminae dimidium revolutis. Vaginula calyptraque variabiliter piliferae. Capsula immersa (emergens), 8-striata, cryptoporis stomatibus in dimidio inferiore usque ad collum. Peristoma duplex. Exostoma octo dentium paribus recurvatis, saepe ad apices fenestratis, endostoma octo segmentis. Plants (0.2–)0.4–0.8 cm tall; leaves from linear-lanceolate to ovate-lanceolate or ovate-ligulate; leaf apex plane, acute, frequently acuminate and ending in a fragile, linear apiculum of 1–3(–5) hyaline cells; leaf margins revolute at mid-leaf; vaginula with sparse uni-biseriate hairs; calyptra with sparse uni-biseriate, papillose and thick-walled hairs; seta 0.4–0.8(–1.0) mm long; capsule immersed to emergent, subcylindrical; eight exothecial bands, 3–4(–5) cells wide; stomata cryptopore, restricted to the

Fig. 4. Orthotrichum tenellum. A, capsule; B, basal exostome OPL (outer peristome layer) showing the basal reticulum and dense papillae; C, apical exostome OPL with papillose ornamentation; D, exostome PPL (primary peristome layer) with low papillae and striae towards teeth apices; E, detail of peristome showing smooth endostome PPL; F, endostome IPL (inner peristome layer) and basal membrane ornamented with low papillae and striae. — Lara & al. s.n., 4 Aug. 1999 (MAUAM-2174).

1144


TAXON 62 (6) • December 2013: 1133–1152


Fig. 5. Orthotrichum comosum. A, habit; B, calyptra with distinct apical comma of hairs; C & D, different stages of capsule development; E, leaf variation; F & G, leaf apices, acute or mucronate; H, naked vaginula, seta and lower capsule. — A–C, E, F & H, (holotype) Guerra & al. s.n., 13 Mar 1998 (MAUAM-4361); D & G, Garilleti & al. s.n., 22 Nov. 2000 (MAUAM-2896).

Fig. 6. Orthotrichum comosum. A, peristome and upper capsule; B, basal exostome OPL, densely reticulate-papillose; C, exostome pair of teeth internal view (PPL), with low papillae and striae towards apex; D, view of an endostome segment with almost smooth surfaces; E, apical exostome OPL, with papillae and lines. — For abbreviations, see Fig. 4. A, Garilleti & al. s.n., 22 Nov. 2000 (MAUAM-2896); B–E, (holotype) Guerra & al. s.n., 13 Mar. 1998 (MAUAM-4361).


1145


TAXON 62 (6) • December 2013: 1133–1152

Fig. 7. Orthotrichum coulteri. A, habit; B, blunt leaf apex; C, leaf variation; D, densely hairy calyptra; E & F, different stages of capsule development; G, vaginula, bearing abundant long hairs, and seta. — A–C, E, Lara & al. s.n., 20 Sep. 2008 (MAUAM-4369); D, F & G, Lara & Garilleti s.n., 18 Sep. 2008 (MAUAM-4366).

Fig. 8. Orthotrichum coulteri. A, peristome; B, basal exostome OPL, with densely reticulate-papillose ornamentation; C, papillose surface, with scattered lines, of apical exostome OPL; D, seta and capsule; E, smooth surface of exostome PPL; F, endostome segment showing smooth PPL; G, slightly rough internal side of endostome (IPL). — For abbreviations, see Fig. 4. — A–G, Lara & al. s.n., 20 Sep. 2008 (MAUAM-4369).

1146


TAXON 62 (6) • December 2013: 1133–1152


Fig. 9. Orthotrichum cucullatum. A, habit; B, calyptra with sparse short hairs; C–E, different stages of capsule development; F, leaves with distinct cucullate apices; G, leaf variation; H, rounded leaf apex; I, hairy vaginula, seta and lower capsule. — A, E–I, (holotype) Lara s.n., 18 Oct. 2008 (CAS); B–D, Kellman 929 (CAS-1017506).

Fig. 10. Orthotrichum cucullatum. A, peristome; B, smooth surface of basal exostome PPL; C, densely papillose exostome OPL; D, detail of endostome segment, showing striae at basal IPL; E, apical exostome PPL with striate ornamentation. — For abbreviations, see Fig. 4. A, B, D & E, (holotype) Lara s.n., 18 Oct. 2008 (CAS); C, Kellman 719 (CAS-718768).


1147


Fig. 11. Orthotrichum franciscanum. A, habit; B, calyptra with sparse short hairs; C & D, different stages of capsule development; E, leaf variation, note revolute margins at mid-leaf; F, leaf apex with terminal, hyaline, elongate cell; G, distinct exostome teeth truncated at apex; H, almost naked vaginula and seta; arrow points hair on vaginula. — A & C, (holotype) Shevock 19132 (UC-1741964); B, D–H, Shevock 20202 (UC-1741780).

Fig. 12. Orthotrichum franciscanum. A, capsule; B, peristome; C, external surface of exostome pair of teeth (OPL) showing basal reticulum, papillae and striae; D, detail of endostome segment with very slightly ornamented IPL; E, exostome PPL surface of truncated exostome tooth. — For abbreviations, see Fig. 4. A, B & D, Hopkins s.n., 23 Sep. 2007 (UC); C, (holotype) Shevock 19132 (UC-1741964); E, Shevock 20202 (UC-1741780).

1148


TAXON 62 (6) • December 2013: 1133–1152


TAXON 62 (6) • December 2013: 1133–1152

Fig. 13. Geographical distribution of a selection of specimens of Orthotrichum coulteri, O. cucullatum, O. franciscanum (California) and O. comosum (western Mediterranean Region and Canary Islands).

lower third (half) of the urn and neck; exostome of 8 pairs of teeth, recurved when dry, often truncate or fenestrate; OPL reticulate to papillose; endostome of 8 segments, frequently appendiculate; spores (10–)12–16(–20) μm, subspherical, papillose. See full description and ecology in the Electronic Supplement: Appendix S1. Etymology. – The specific epithet refers to the frequency of this taxon in the San Francisco Bay area of California.

ACKNOWLEDGMENTS James R. Shevock, Daniel H. Norris, Brent Mishler and the UC and CAS staffs are deeply acknowledged for the facilities given to Francisco Lara and Ricardo Garilleti. We also wish to thank Benjamin Carter, Isabel Draper, Ken Kellman, Nagore G. Medina and David Toren for the opportunity to study their Orthotrichum material. The curators and staff of B, COLO, FH, MICH and NY are sincerely acknowledged for their help and patience. We are also in debt to Nagore G. Medina for her help with GIS mapping. The Spanish Ministry of Science and Innovation gave financial support to the study through grants CGL2007-61389, CGL201015693 and CGL2011-28857/BOS. The National Science Foundation funded this research through grants EF-0531557 and DEB-0919284.

LITERATURE CITED Bickford, D., Lohman, D.J., Sodhi, N.S., Ng, P.K.L., Meier, R., Winker, K., Ingram, K.K. & Das, I. 2007. Cryptic species as a window on diversity and conservation. Trends Ecol. Evol. 22: 148–155. http://dx.doi.org/10.1016/j.tree.2006.11.004 Bridel, S.E. 1827. Bryologia universa, vol. 1(2). Leipzig: J.A. Barth. Buck, W.R., Goffinet, B. & Shaw, A.J. 2000. Testing morphological concepts of orders of pleurocarpous mosses (Bryophyta) using phylogenetic reconstructions based on trnL-trnF and rps4 sequences. Molec. Phylogen. Evol. 16: 180–198. http://dx.doi.org/10.1006/mpev.2000.0805 Casas, C., Brugués, M., Cros, R.M. & Sérgio, C. 2006. Handbook of mosses of the Iberian Peninsula and the Balearic Islands: Illustrated keys to genera and species. Barcelona: Institut d’Estudis Catalans. Chiang, T.Y., Schaal, B.A. & Peng, C.I. 1998. Universal primers for amplification and sequencing a noncoding spacer between the atpB and rbcL genes of chloroplast DNA. Bot. Bull. Acad. Sin. 39: 245–250. Cortini Pedrotti, C. & Lara, F. 2001. Orthotrichales. Pp. 719–761 in Cortini Pedrotti, C. (ed.), Flora dei muschi d’Italia, vol. 1, Sphagn opsida, Andreaeopsida, Bryopsida (I parte). Rome: Antonio Delfino Editore. Cummings, M.P., Neel, M.C., Shaw, K.L. & Otto, S. 2008. A genealogical approach to quantifying lineage divergence. Evolution 62: 2411–2422. http://dx.doi.org/10.1111/j.1558-5646.2008.00442.x


1149


Dayrat, B. 2005. Towards integrative taxonomy. Biol. J. Linn. Soc. 85: 407–416. http://dx.doi.org/10.1111/j.1095-8312.2005.00503.x Doyle, J.J. & Doyle, J.L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. Bot. Soc. Amer. 19: 11–15. Draper, I., Hedenäs, L. & Grimm, G.W. 2007. Molecular and morphological incongruence in European species of Isothecium (Bryophyta). Molec. Phylogen. Evol. 42: 700–716. http://dx.doi.org/10.1016/j.ympev.2006.09.021 Edgar, R.C. 2004. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucl. Acids Res. 32: 1792–1797. http://dx.doi.org/10.1093/nar/gkh340 Farris, J.S., Källersjö, M., Kluge, A.G. & Bult, C. 1994. Testing significance of incongruence. Cladistics 10: 315–319. http://dx.doi.org/10.1111/j.1096-0031.1994.tb00181.x Fedosov, V.E. & Ignatova, E.A. 2010. Orthotrichum dagestanicum sp. nov. (Orthotrichaceae, Musci) – a new species from Dagestan (Eastern Caucasus). Arctoa 19: 69–74. Felsenstein, J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39: 783–791. http://dx.doi.org/10.2307/2408678 Fernandez, C.C., Shevock, J.R., Glazer, A.N. & Thompson, J.N. 2006. Cryptic species within the cosmopolitan desiccation-tolerant moss Grimmia laevigata. Proc. Natl. Acad. Sci. U.S.A. 103: 277– 284. http://dx.doi.org/10.1073/pnas.0510267103 Garilleti, R., Shevock, J.R., Norris, D.H. & Lara, F. 2011. Orthotrichum mazimpakanum sp. nov. and O. anodon (Orthotrichaceae), two similar species from California. Bryologist 114: 346–355. http://dx.doi.org/10.1639/0007-2745-114.2.346 Goffinet, B., Bayer, R.J. & Vitt, D.H. 1998. Circumscription and phylogeny of the Orthotrichales (Bryopsida) inferred from rbcL sequence analyses. Amer. J. Bot. 85: 1324–1337. http://dx.doi.org/10.2307/2446642 Goffinet, B., Shaw, A.J., Cox, C., Wickett, N. & Boles, S. 2004. Phylogenetic inferences in the Orthotrichoideae (Orthotrichaceae, Bryophyta) based on variation in four loci from all genomes. Monogr. Syst. Bot. Missouri Bot. Gard. 98: 270–289. Goffinet, B., Buck, W.R. & Wall, M.A. 2007. Orthotrichum freyanum (Orthotrichaceae), a new epiphytic moss from Chile. Nova Hedwigia 131: 1–11. Grout, A.J. 1946. North American Flora, vol. 15A(1), Orthotrichaceae. New York: New York Botanical Garden. Heinrichs, J., Hentschel, J., Feldberg, K., Bombosch, A. & Schneider, H. 2009. Phylogenetic biogeography and taxonomy of disjunctly distributed bryophytes. J. Syst. Evol. 47: 497–508. http://dx.doi.org/10.1111/j.1759-6831.2009.00028.x Hernández-Maqueda, R., Quandt, D. & Muñoz, J. 2008. Testing reticulation and adaptive convergence in the Grimmiaceae (Bryophyta). Taxon 57: 500–510. Lara, F., Garilleti, R. & Mazimpaka, V. 2007. A peculiar new Orthotrichum species (Orthotrichaceae, Bryopsida) from central Argentina. Bot. J. Linn. Soc. 155: 477–482. http://dx.doi.org/10.1111/j.1095-8339.2007.00720.x Lara, F., Garilleti, R. & Mazimpaka, V. 2009a. Orthotrichum karoo (Orthotrichaceae), a new species with hyaline-awned leaves from southwestern Africa. Bryologist 112: 194–201. http://dx.doi.org/10.1639/0007-2745-112.1.194 Lara, F., Garilleti, R., Medina, R. & Mazimpaka, V. 2009b. A new key to the genus Orthotrichum Hedw. in Europe and the Mediterranean Region. Cryptog. Bryol. 30: 129–142. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J. & Higgins, D.G. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948. http://dx.doi.org/10.1093/bioinformatics/btm404 Lesquereux, L. 1865. On Californian Mosses. Trans. Amer. Philos. Soc. 13: 1–24. http://dx.doi.org/10.2307/1005344 1150

TAXON 62 (6) • December 2013: 1133–1152

Lesquereux, L. & James, T.P. 1884. Manual of the mosses of North America. Boston: SE Cassino and Company. Lewinsky, J. 1993. A synopsis of the genus Orthotrichum Hedw. (Musci, Orthotrichaceae). Bryobrothera 2: 1–59. McDaniel, S.F., Stackelberg, M. von, Richardt, S., Quatrano, R.S., Reski, R. & Rensing, S.A. 2010. The speciation history of the Physcomitrium–Physcomitrella species complex. Evolution 64: 217–231. http://dx.doi.org/10.1111/j.1558-5646.2009.00797.x Medina, N.G., Draper, I. & Lara, F. 2011. Biogeography of mosses and allies: does size matter? Pp. 209–233 in: Fontaneto, D. (ed.), Biogeography of microscopic organisms: Is everything small everywhere. Cambridge: Cambridge University Press. http://dx.doi.org/10.1017/CBO9780511974878.012 Medina, R., Lara, F., Mazimpaka, V. & Garilleti, R. 2008. Ortho trichum norrisii (Orthotrichaceae), a new epiphytic Californian moss. Bryologist 111: 670–675. http://dx.doi.org/10.1639/0007-2745-111.4.670 Medina, R., Garilleti, R., Mazimpaka, V. & Lara, F. 2009. A new look at Orthotrichum scanicum Grönvall (Orthotrichaceae, Bryophyta). J. Bryol. 31: 86–92. http://dx.doi.org/10.1179/174328209X404934 Medina, R., Lara, F., Mazimpaka, V., Shevock, J.R. & Garilleti, R. 2011. Orthotrichum pilosissimum (Orthotrichaceae), a new moss from arid areas of Nevada with unique axillary hairs. Bryologist 114: 316–324. http://dx.doi.org/10.1639/0007-2745.114.2.316 Medina, R., Lara, F., Goffinet, B., Garilleti, R. & Mazimpaka, V. 2012. Integrative taxonomy successfully resolves the pseudocryptic complex of the disjunct epiphytic moss Orthotrichum consimile s.l. (Orthotrichaceae). Taxon 61: 1180–1198. Mitten, W. 1864. The «Bryologia» of the survey of the 49th parallel of latitude. J. Proc. Linn. Soc., Bot. 8: 12–55. Mittermeier, R.A., Gil, P.R., Hoffman, M., Pilgrim, J. & Brooks, T. 2005. Hotspots revisited: Earth’s biologically richest and most endangered terrestrial ecoregions. Mexico City: Cemex/ Agrupación Sierra Madre. Müller, J., Müller, K.F., Neinhuis, C. & Quandt, D. 2006. PhyDE: Phylogenetic data editor. Distributed by the authors. http://www.phyde.de Müller, K. 2005. SeqState: Primer design and sequence statistics for phylogenetic DNA datasets. Appl. Bioinf. 4: 65–69. http://dx.doi.org/10.2165/00822942-200504010-00008 Myers, N., Mittermeier, R.A., Mittermeier, C.G., da Fonseca, G.A.B. & Kent, J. 2000. Biodiversity hotspots for conservation priorities. Nature 403: 853–858. http://dx.doi.org/10.1038/35002501 Nadot, S., Bajon, R. & Lejeune, B. 1994. The chloroplast gene rps4 as a tool for the study of Poaceae phylogeny. Pl. Syst. Evol. 191: 27–38. http://dx.doi.org/10.1007/BF00985340 Pacak, A. & Szweykowska-Kulińska, Z. 2000. Molecular data concerning the allopolyploid character and the origin of chloroplast and mithochondrial genomes in the liverwort species Pellia borealis. J. Pl. Biotechnol. 2: 101–108. Plášek, V., Sawicki, J., Trávníčková, V. & Pasečná, M. 2009. Ortho trichum moravicum (Orthotrichaceae), a new moss species from the Czech Republic. Bryologist 112: 329–336. http://dx.doi.org/10.1639/0007-2745-112.2.329 Posada, D. 2008. jModelTest: Phylogenetic model averaging. Molec. Biol. Evol. 25: 1253–1256. http://dx.doi.org/10.1093/molbev/msn083 Rambaut, A. & Drummond, A. 2010. FigTree, version 1.3.1. Institute of Evolutionary Biology, University of Edinburgh. http://tree.bio. ed.ac.uk/software/figtree/. Renner, M.A., Brown, E.A. & Wardle, G.M. 2010. The Lejeunea tumida species group (Lejeuneaceae: Jungermanniopsida) in New Zealand. Austral. Syst. Bot. 23: 443–462. http://dx.doi.org/10.1071/SB10037 Ronquist, F. & Huelsenbeck, J.P. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574. http://dx.doi.org/10.1093/bioinformatics/btg180



TAXON 62 (6) • December 2013: 1133–1152

Ronquist, F., Huelsenbeck, J.P. & Van der Mark, P. 2005. MrBayes 3.1 Manual Draft 5/26/2005. http://mrbayes.csit.fsu.edu/mb3.1_ manual.pdf. Sawicki, J., Plášek, V. & Szczecińska, M. 2009. Preliminary studies on the phylogeny of Orthotrichum (Bryophyta) inferred from nuclear ITS sequences. Ann. Bot. Fenn. 46: 507–515. http://dx.doi.org/10.5735/085.046.0603 Sawicki, J., Plášek, V. & Szczecińska, M. 2012. Molecular data do not support the current division of Orthotrichum (Bryophyta) species with immersed stomata. J. Syst. Evol. 50: 12–24. http://dx.doi.org/10.1111/j.1759-6831.2011.00168.x Schofield, W.B. 1988. Bryophyte disjunctions in the Northern Hemisphere: Europe and North America. Bot. J. Linn. Soc. 98: 211–224. http://dx.doi.org/10.1111/j.1095-8339.1988.tb02425.x Shaw, A.J. 2001. Biogeographic patterns and cryptic speciation in bryophytes. J. Biogeogr. 28: 253–261. http://dx.doi.org/10.1046/j.1365-2699.2001.00530.x Shaw, A.J. 2009. Bryophyte species and speciation. Pp. 445–485 in: Goffinet, B. & Shaw, A.J. (eds.), Bryophyte biology, 2nd ed. Cambridge: Cambridge University Press. Shaw, A.J., Cox, C.J. & Boles, S.B. 2003. Polarity of peatmoss (Sphagnum) evolution: Who says bryophytes have no roots? Amer. J. Bot. 90: 1777–1787. http://dx.doi.org/10.3732/ajb.90.12.1777 Simmons, M.P. & Ochoterena, H. 2000. Gaps as characters in sequence-based phylogenetic analyses. Syst. Biol. 49: 369–381. http://dx.doi.org/10.1093/sysbio/49.2.369 Sites, J.W., Jr. & Marshall, J.C. 2003. Delimiting species: A Renaissance issue in systematic biology. Trends Ecol. Evol. 18: 462–470. http://dx.doi.org/10.1016/S0169-5347(03)00184-8 Smith, A.J.E. 2004. The moss flora of Britain and Ireland. Cambridge: Cambridge University Press. http://dx.doi.org/10.1017/CBO9780511541858 Souza-Chies, T.T., Bittar, G., Nadot, S., Carter, L., Besin, E. & Lejeune, B. 1997. Phylogenetic analysis of Iridaceae with

parsimony and distance methods using the plastid gene rps4. Pl. Syst. Evol. 204: 109–123. http://dx.doi.org/10.1007/BF00982535 Steele, P.R. & Pires, J.C. 2011. Biodiversity assessment: State-of-theart techniques in phylogenomics and species identification. Amer. J. Bot. 98: 415–425. http://dx.doi.org/10.3732/ajb.1000296 Sukumaran, J. & Holder, M.T. 2010. DendroPy: A Python library for phylogenetic computing. Bioinformatics 26: 1569–1571. http://dx.doi.org/10.1093/bioinformatics/btq228 Sullivant, W. 1874. Icones Muscorum, Supplement. Cambridge: Sever. Taberlet, P., Gielly, L., Pautou, G. & Bouvet, J. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Pl. Molec. Biol. 17: 1105–1109. http://dx.doi.org/10.1007/BF00037152 Vanderpoorten, A. & Shaw, A.J. 2010. The application of molecular data to the phylogenetic delimitation of species in bryophytes: A note of caution. Phytotaxa 9: 229–237. Vitt, D.H. 1973. A revision of the genus Orthotrichum in North America, north of Mexico. Lehre: Cramer. Vitt, D.H. 2009. Orthotrichum. In: Bryophyte flora of North America, provisional publication. St. Louis: Missouri Botanical Garden. http://www.mobot.org/plantscience/BFNA/bfnamenu.htm Wachowiak, W., Bączkiewicz, A., Chudzińska, E. & Buczkowska, K. 2007. Cryptic speciation in liverworts – a case study in the Aneura pinguis complex. Bot. J. Linn. Soc. 155: 273–282. http://dx.doi.org/10.1111/j.1095-8339.2007.00692.x Wiens, J.J. 2007. Species delimitation: New approaches for discovering diversity. Syst. Biol. 56: 875–878. http://dx.doi.org/10.1080/10635150701748506 Zander, R.H. 2008. Evolutionary inferences from non-monophyly on molecular trees. Taxon 57: 1182–1188. Zwickl, D.J. 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. Ph.D. Dissertation, The University of Texas at Austin, U.S.A.

Appendix 1. Selection of specimens. Specimens shown in Figs. 1 and 2 are preceded by a bracketed number with the GenBank accessions for the sequences: [#: atpB-rbcL, rps4, trnG, trnL-F / adk, ort-LFY]

Orthotrichum tenellum CYPRUS. Nicosia: Palaichori und Agros Mandelhain, N 34.82826° E 33.11166°, 19 Feb 2009 Frahm 2009744 (MAUAM-4344); GREECE. Epirus: Kalpaki, 30 Jul 1999 F. Lara, V. Mazimpaka & M.J. Cano s.n. (MAUAM-2180); Crete: Lasithi, Oropediou Lasithiou, 35°09′47″ N 25°26′42″ E, 14 Aug 2005 R. Medina s.n. (MAUAM-2391); Macedonia: Rendina, 4 Aug 1999 Lara, Mazimpaka & Cano s.n. (MAUAM-2174); ITALY. Sicily: [1: JQ836702, JQ836804, JQ836908, JQ836993 / JQ837093, JQ837169] Montesalici, 37°43′45″ N 14°38′59″ E, 25 Jul 1998, F. Lara & al. s.n., (MAUAM-4345); [2: JQ836703, JQ836805, JQ836909, JQ836994 / JQ837094, JQ837170] Madonie, Piano Zucchi, 37°54′19″ N 14°00′02″ E, 27 Jul 1998 F. Lara & al. s.n. (MAUAM-4346); PORTUGAL. Tras-os Montes e Alto Douro: [3: JQ836704, JQ836806, JQ836910, JQ836995 / JQ837095, JQ837171] Bragança, Gimonde, 23 Nov 2000, C. Garcia & al. s.n. (MAUAM-4347); [4: –, JQ836807, JQ836911, JQ836996 / JQ837096, JQ837172] Porrais, 22 Nov 2000, C. Garcia & al. s.n. (MAUAM-4348),; SPAIN. Albacete: Sierra del Calar del Mundo, Riópar, 38°29′17″ N 2°20′53″ W, 1 Nov 1993, F. Lara, R. Garilleti & B. Albertos s.n. (MAUAM-4349); Ávila: Tormellas, UTM: 30TTK8666, 9 Nov 2003, R. Medina s.n. (MAUAM-4350); Navalperal de Tormes, UTM: 30TUK0168, 10 Nov 2003, V. Mazimpaka & al. s.n. (MAUAM-2514); Ciudad Real: Viso del Marqués, 38°26′36″ N 03°36′18″ W, 14 Jun 2006, N.G. Medina & R. Medina s.n. (MAUAM-4196); Granada: Sierra Nevada, Bubión, 9 Feb 1996, F. Lara & al. s.n. (MAUAM-4351); Huelva: Aracena, UTM: 29SQB1391, 12 Feb 1998, B. Albertos & al. s.n. (MAUAM-1462); Jaén: Santiago Pontones, UTM: 30SWH43, 23 Jan 1998, F. Lara s.n. (MAUAM-4352); Madrid: [7: JQ836747, JQ836851, JQ836955, JQ837040 / JQ837139, JQ837215] Cadalso de los Vidrios, 14 May 2006, B. Estébanez & N.G. Medina s.n. (MAUAM); Canary Islands: Sta Cruz de Tenerife: El Hierro, road Valverde-Frontera, UTM: 28RBR0673, 29 Sep 2002, F. Lara & E. San Miguel s.n. (MAUAM-2161); [5: JQ836708, JQ836812, JQ836916, JQ837001 / JQ837100, JQ837176] La Palma, Barlovento, 4 Nov 1997, F. Lara s.n. (MAUAM-1905); TUNISIA. Béja: road Sejenane-Nefza, 37°02′40″ N 9°06′29″ E, III.2005, F. Lara & E. San Miguel s.n. (MAUAM-2454); Jendouba: [6: JQ836709, JQ836813, JQ836917, JQ837002 / JQ837101, JQ837177] near Fenana, 36°42′05″ N 8°40′36″ E, 22 Mar 2005, F. Lara & E. San Miguel s.n. (MAUAM-2461). — Orthotrichum comosum. ITALY. Sicily: Monte Salici, 37°43′45″ N 14°38′59″ E, 25 Jul 1998, Lara & al. s.n. (MAUAM-4353); MOROCCO. Tanger-Tétouan: Sidi Hassain, 10 km from Larache, 35°16′11″ N 06°04′16″ W, 19 Mar 1997, Garilleti & Lara s.n. (MAUAM-4354); Ascent to Jbel Tassaot 35°15′16″ N 5°09′23″ W 10 Jun 2004, I. Draper & R. Medina s.n. (MAUAM-4355); Taza: Ascent to Jbel Tazzeka from Bab Bou Idir, 34°03′14″ N 4°10′19″ W, 21 Jun 1997, B. Albertos & al. s.n. (MAUAM-4356); Rabat-Sale-Zemmour-Zaer: near El-Harcha, 33°28′15″ N 6°06′49″ W, 22 Jun 2000, I. Draper, F. Lara & V. Mazimpaka s.n. (MAUAM-4357); PORTUGAL: Tras-os-Montes e Alto Douro: [3: JQ836759, JQ836863, JQ836966, JQ837052 / JQ837161, JQ837237] Morais, 22 Nov 2000, Garilleti & al. s.n. (MAUAM-2896); SPAIN. Almería: [1: JQ836745, JQ836849, JQ836953, JQ837038 / JQ837137, JQ837213] Sierra Alhamilla, 37°00′04″ N 02°18′29″ W, 22 Jul 2006, N.G. Medina s.n. (MAUAM-4358); [4: JQ836748, JQ836852, JQ836956, JQ837041 / JQ837140, JQ837216] Sierra Alhamilla, 10 Nov 2005, R. Medina s.n. (MAUAM-4359); Ávila: Tolbaños, 40°44′19″ N 4°33′06″ W, 1071 m, 21 Mar 2010, N.G. Medina L51P2QI7 (MAUAM); Cáceres: Conquista de la Sierra, 39°21′35″ N 05°42′41″ W, 26 Mar 2010, N.G. Medina L26P23QI (MAUAM-4360); Cádiz: [5: JQ836756, JQ836860, JQ836964, JQ837049 / JQ837153, JQ837229] (holotype) Algeciras, sierra de la Luna, Llanos del Juncal, 36°06′02″ N 05°32′14″ W, 13 Mar 1998, Guerra, Lara & Mazimpaka s.n. (MAUAM-4361); Algeciras, Sierra de la Luna, 36°06′24″ N 05°32′23″ W, 13 Mar 1998, Guerra, Lara & Mazimpaka s.n. (MAUAM-4362); Huelva: Sierra de Aracena, Fuenteheridos, 10 Feb 1998, Lara & al. s.n. (MAUAM-4363); Lugo: Lamamarín, Chantada, 27 Oct 1995, Albertos & al. s.n. (MAUAM); Madrid: Loeches, 40°23′01″ N 3°26′49″ W, 24 Oct 2003,


1151


TAXON 62 (6) • December 2013: 1133–1152

Appendix 1. Continued.

Albertos, Cortés & R.Medina s.n. (MAUAM-4364); [2: JQ836746, JQ836850, JQ836954, JQ837039 / JQ837138, JQ837214] Cadalso de los Vidrios, 25 Mar 2006, B. Estébanez & N.G. Medina s.n. (MAUAM); Toledo: Los Navalmorales, 39°40′35″ N 4°37′30″ W, 8 Mar 2010, N.G. Medina L41P14QI (MAUAM); Navalcán, 40°03′16″ N 5°07′44″ W, 10 Mar 2010, N.G. Medina L43P1QI6 (MAUAM); Canary Islands: Santa Cruz de Tenerife: [6: JQ836758, JQ836862, –, JQ837051 / JQ837162, JQ837238] La Gomera, Chipude, La Fortaleza, 28°06′01″ N 17°16′35″ W, 5 Feb 2005, Lara s.n. (MAUAM-2856). — Orthotrichum coulteri. U.S.A. California: Alameda Co., Berkeley, Oct 1892, Howe s.n. (NY); [2: JQ836710, JQ836814, JQ836918, JQ837003 / JQ837102, JQ837178] [3: JQ836713, JQ836817, JQ836921, JQ837006 / JQ837105, JQ837181] [4: JQ836711, JQ836815, JQ836919, JQ837004 / JQ837103, JQ837179] [5: JQ836712, JQ836816, JQ836920, JQ837005 / JQ837104, JQ837180] Berkeley Campus, 18 Sep 2008, Lara & Garilleti s.n. (MAUAM-4365, 4366, 4367 & 4368); Wildcat Canyon, 20 Sep 2008, Lara, Garilleti & Norris s.n. (MAUAM-4369); Contra Costa Co., [6: JQ836714, JQ836818, JQ836922, JQ837007 / JQ837106, JQ837182] Gorge trail toward lake Anza, Tilden Regional Park, 29 Nov 2006, Norris 109508 (UC-1917203); Monte Diablo State Park, 37°53′00″ N 121°58′00″ W, 980 ft., 4 Jan 2004, Shevock 24500, Thayer & Bartosh (MAUAM-4370); Lake Co., Boggs Mountain, T11N R8W sec11, 3 Apr 2010, Toren 9733 (MAUAM-4371); West base of Cobb Mountain, T11N R8W sec10, 3 Apr 2010, Toren 9732 (MAUAM-4372); Los Angeles Co. Channel Islands, Santa Catalina Island, 33°23.281′ N 118°23.974′ W, 4 May 2010, B. Carter 5757b (UC); Marin Co., Olompali State Park, 38°09.4′ N 122°34.5″ W, 21 Apr 2007, Norris 109891 & Hillyard (UC); Monterey Co., Hastings Natural History Reservation, 3 Mar 1951, Anonymous (UC-1932399); Andrew Molera State Park, 36°16′56″ N 121°50′02″ W, 30 m, 4 Jul 2003, Kellman 3063 (MAUAM-4374); San Francisco Co., Panhandle, 14 Feb 2000, Shevock 18930 (UC-1741966); Upper Market area, 37°44′50.9″ N 122°26′22.9″ W, 24 Jan 2010, Toren 9726b (MAUAM-4375); Forest Hill District, 37°45′40.5″ N 122°26′24.3″ W, 27 Feb 2010, Toren 9727 (MAUAM-4376); San Luis Obispo Co., Montana de Oro State Park, 35°16′ N 120°16′ W, 25 Dec 1982, Norris 68193 (MAUAM-4377); San Mateo Co., Wunderlich County Park; 122°16′ W, 37°24′ N, 600–800 ft, 4 Mar 1990, Whittemore 3471 (MICH); Santa Barbara Co. Channel Islands, Santa Cruz Island, 34°00.160′ N 119°42.621′ W, 18 May 2010, Carter 4610 (UC); Santa Clara Co., entrance to Henry W. Coe State Park, 37°06′ N 121°28′ W, 20 Apr 1999, Whittemore 6768 & Briggs (CAS-1016718); North shore of Lake Grant, 37°21′ N 121°43′ W, 8 Apr 1997, Whittemore 6066 (CAS-993134); Santa Cruz Co., [7: JQ836735, JQ836839, JQ836943, JQ837028 / JQ837126, JQ837202] 37°12′02″ N 122°02′38″ W, Kellman 2602 (CAS-1043175); Sonoma Co., gate to C. Adams Ranch, 12 Feb 1951, Koch 3557 (UC-67435); Sonoma Co. [1: JQ836705, JQ836808, JQ836912, JQ836997 / JQ837097, JQ837173] above Lake Sonoma at Skaggs Springs Road, 38°42′ N 123°01′ W, 6 Feb 1990, Norris 86911 (UC). — Orthotrichum cucullatum. U.S.A. California: Alameda Co., [1: JQ836723, JQ836827, JQ836931, JQ837016 / JQ837113, JQ837189] Berkeley, Bay View Place, 9 Oct 2008, F. Lara s.n. (MAUAM-4379); [7: JQ836725, JQ836829, JQ836933, JQ837018 / JQ837115, JQ837191] Berkeley, Fairlawn Dr, 22 Sep 2008, F. Lara s.n. (MAUAM-4380); [5: JQ836726, JQ836830, JQ836934, JQ837019 / JQ837116, JQ837192] Berkeley, Cedar St., 30 Sep 2008, Lara & Garilleti s.n. (MAUAM-4381); [2: JQ836727, JQ836831, JQ836935, JQ837020 / JQ837117, JQ837193] [3: JQ836724, JQ836828, JQ836932, JQ837017 / JQ837114, JQ837190] Wildcat Canyon, 37°56′01″ N 122°17′44″ W, 20 Sep 2008, F. Lara, R. Garilleti & D.H. Norris s.n. (MAUAM-4382); Contra Costa Co., [6: JQ836728, JQ836832, JQ836936, JQ837021 / JQ837118, JQ837194] trail on south shore of Briones Resevoir, 1 Nov 2003, Norris 106515 &Hillyard (UC-1768584); Fresno Co., about 1 mile east of Monterey County line, 36°09′ N 120°38′ W, 5 Apr 1995, Norris 85107 (UC); Los Angeles Co., Arroyo Seco, near Sycamore Grove Park, 15 May 1926, Moxley 1139 (NY); Channel Islands, Santa Catalina Island, 33°23.281′ N 118°23.974′ W, 4 May 2010, Carter 5757a (UC); Madera Co., 4 miles south of O’Neal’s, 37°05′ N 119°42′ W, 2 Jan 1994, Norris 81851 (UC-1918187); Merced Co., Merced, Bear Creek Drive, 31 Dec 1925, Howell s.n. (COLO-196626); Monterey Co., 28 Mar 1903, Heller 6470 (NY); Garrapata State Park, 36°26′49″ N 121°55′20″ W, 14 Jun 2003, Kellman 2957 (CAS-1045418); Orange Co., [10: JQ836751, JQ836855, JQ836959, JQ837044 / JQ837142, JQ837218] Cleveland National Forest, 33°44′51″ N 117°35′00″ W, 14 Nov 2008, Lara, Garilleti & Shevock s.n. (MAUAM-4383); Placer Co., [8: JQ836736, JQ836840, JQ836944, JQ837029 / JQ837128, JQ837204] along Philip Rd., NW of Roseville, 1 Mar 2002, Norris 103798 (UC-1760035); San Francisco Co., Presidio of San Francisco, 37°47′55″ N 122°27′35″ W, 20 May 2000, Shevock 19368 (CAS-1016500); Jefferson Square, 37°46′53″ N 122°23′35″ W, 5 Feb 2000, Shevock 18902 (CAS-1016301); San Mateo Co., [4: JQ836737, JQ836841, JQ836945, JQ837030 / JQ837129, JQ837205] Año Nuevo State Reserve, 25 Oct 2008, Lara & Garilleti s.n. (MAUAM-4384); Santa Barbara Co., [9: JQ836750, JQ836854, JQ836958, JQ837043 / JQ837141, JQ837217] Los Padres Nt. Forest, 35°04′23″ N 120°03′29″ W, 17 Nov 2008, F. Lara, R. Garilleti & J. Shevock s.n. (MAUAM-4385); along Sierra Madre Road, 35°06′ N 120°04.5′ W, 28 Dec 1979, Norris 55301 (UC); Channel Islands, Santa Cruz Island, 33°59.932′ N 119°45.443′ W, 20 Feb 2011, B. Carter 5316 (UC); Santa Cruz Co., Corralitos, Merk Pond, 36°58′15″ N 121°48′35″ W, 5 Jul 1999, Kellman 719 (CAS-718768); near Aromas, 36°54′07″ N 121°36′18″ W, 2 Apr 2000, Kellman 929 (CAS-1017506). — Orthotrichum franciscanum. U.S.A. California: Alameda Co., [1: JQ836718, JQ836822, JQ836926, JQ837011 / –, –] Berkeley, Fairlawn Dr, 22 Sep 2008, F. Lara s.n. (MAUAM-4388); [2: JQ836719, JQ836823, JQ836927, JQ837012 / JQ837109, JQ837185] Berkeley, Cedar st. to Scenic st., 30 Sep 2008, Lara & Garilleti s.n. (MAUAM-4390); Contra Costa Co., Lime Ridge County Reserve, 8 Apr 2001, Norris 101336 (UC-101336); [4: JQ836721, JQ836825, JQ836929, JQ837014 / JQ837111, JQ837187] Wildcat Canyon Regional Park, 37°56′01″ N 122°17′44″ W, 20 Sep 2008, Lara, Garilleti & Norris s.n. (MAUAM-4389); Los Angeles Co., Santa Catalina Island, canyon east of Black Jack Campgroung, 33°22′00″ N 118°24′00″ W, 25 Mar 1975, Shevock 4073 & Thorne (UC-1741891); San Jose Hills, near Pomona, 15 Feb 1919, Munz 2407 (Herbarium of Pomona College); Monterey Co., [6: JQ836732, JQ836836, JQ836940, JQ837025 / JQ837123, JQ837199] Monterey, 23 Sep 2007, Hopkins s.n. (UC); Napa Co., St. Helena, Crane Park, 5 Mar 1973, Norris 48234 (UC); San Diego Co., [7: JQ836733, JQ836837, JQ836941, JQ837026 / –, –] Santa Margarita Ecological Reserve, 33°25′48″ N 117°11′27″ W, Kellman 1389 (CAS-718654); San Francisco Co., [3: JQ836720, JQ836824, JQ836928, JQ837013 / JQ837110, JQ837186] Lafayette Park, 16 Apr 2000, Shevock 19242 (UC-1739290); [5: JQ836722, JQ836826, JQ836930, JQ837015 / JQ837112, JQ837188] along 3rd st., 22 Oct 2000, Shevock 20202 (UC-1741780); Santa Clara Co., Stanford University Campus, 13 Jun 1962, Hermann 17461 (MICH). Materials used for DNA extraction not included in Medina & al., 2012. Orthotrichum alpestre. SWITZERLAND. St. Gallen: [2: JQ836761, JQ836865, –, JQ837054 / JQ837151, JQ837227] Vilters, Alphütte Untersäss, 13 Jun 1992, Schäfer-Verwimp 15465 (MAUAM-1685); TURKEY. Gümüşhane: [3: JQ836790, JQ836894, –, JQ837083 / –, –] Road from Maçka to Torul, 40°39′15″ N 39°22′00″ E, 15 Jul 2005, F. Lara, R. Medina & Mazimpaka s.n. (MAUAM-4391); Orthotrichum euryphyllum. U.S.A. California: [1: JQ836780, JQ836884, –, JQ837073 / –, –] Lassen Co., 21 mi North of Litchfield, 17 May 1972, F. Hermann J24764 (DUKE); [2: JQ836781, JQ836885, -, JQ837074] Shasta Co., along Cassel-Fall River road, 3 Feb 1995, D.H. Norris 84701 (UC); Orthotrichum norrisii. U.S.A. California: Alameda Co., [1: JQ836715, JQ836819, JQ836923, JQ837008 / –, –] Wildcat Canyon, 20 Sep 2008, F. Lara, R. Garilleti & D.H. Norris s.n. (MAUAM-4392); [3: JQ836716, JQ836820, JQ836924, JQ837009 / JQ837107, JQ837183] Berkeley campus, 17 Sep 2008, F. Lara, R. Garilleti & D.H. Norris s.n. (MAUAM-4395); San Francisco Co., [4: JQ836717, JQ836821, JQ836925, JQ837010 / JQ837108, JQ837184] San Francisco, Panhandle Park, 14 Feb 2000, J.R. Shevock 18930 (UC-1741966); Orange Co., [5: JQ836752, JQ836856, JQ836960, JQ837045 / JQ837143, JQ837219] Cleveland National Forest, 33°44′51″ N 117°35′00″ W, 14 Nov 2008, F. Lara, R. Garilleti & J. Shevock s.n. (MAUAM-4394); Riverside Co., [2: JQ836740, JQ836844, JQ836948, JQ837033 / JQ837131, JQ837207] San Jacinto Mts, Bay Tree Spring, 33°49′10″ N 116°47′21″ W, 16 Nov 2008, F. Lara, R. Garilleti & J. Shevock s.n. (MAUAM-4393); Orthotrichum tristriatum. CHILE. Goffinet 5414 (CONN). Additional GenBank accessions for nuclear loci [#: adk, ort-LFY] of specimens published in Medina & al. 2012 (appendix) Nyholmiella obtusifolia [1: JQ837087, JQ837163] [2: JQ837088, JQ837164]; Orthotrichum anomalum [3: JQ837089, JQ837165]; Orthotrichum bartramii [1: JQ837124, JQ837200] [2: JQ837148, JQ837224] [3: JQ837149, JQ837225]; Orthotrichum casasianum [JQ837099, JQ837175]; Orthotrichum columbicum [1: JQ837145, JQ837221] [2: JQ837121, JQ837197] [3: JQ837125, JQ837201] [4: JQ837154, JQ837230] [5: JQ837156, JQ837232] [6: JQ837155, JQ837231] [7: JQ837158, JQ837234]; Orthotrichum confusum [1: JQ837136, JQ837212] [2: JQ837160, JQ837236]; Orthotrichum consimile [1: JQ837157, JQ837233] [2: JQ837146, JQ837222] [3: JQ837127, JQ837203] [4: JQ837144, JQ837220]; Orthotrichum persimile [1: JQ837119, JQ837195] [2: JQ837147, JQ837223] [3: JQ837120, JQ837196]; Orthotrichum pilosissimum [1: JQ837132, JQ837208] [2: JQ837133, JQ837209] [3: JQ837134, JQ837210] [4: JQ837135, JQ837211]; Orthtrichum pumilum [JQ837092, JQ837168]; Orthotrichum scanicum [1: JQ837090, JQ837166] [2: JQ837091, JQ837167]; Orthotrichum schimperi [2: JQ837098, JQ837174]; Orthotrichum sharpii [JQ837159, JQ837235]; Orthotrichum underwoodii. [JQ837122, JQ837198].

1152


Vol. 62 (6) • December 2013

International Journal of Taxonomy, Phylogeny and Evolution

Electronic Supplement to

Unnoticed diversity within the disjunct moss Orthotrichum tenellum s.l. validated by morphological and molecular approaches Rafael Medina, Francisco Lara, Bernard Goffinet, Ricardo Garilleti & Vicente Mazimpaka Taxon : –

TAXON 62 (6) • December 2013

Electr. Suppl. to: Medina & al. • Unnoticed diversity in Orthotrichum tenellum

APPENDIX S1. FULL DESCRIPTION AND ECOLOGY Orthotrichum tenellum Bruch ex Brid., Bryol. Univ. 1: 786. 1827 – Lectotype (designated by Vitt in Bryophyt. Biblioth. 1: 190. 1973): prope Bipontium [Zweibrücken], Bruch s.n. (B !) Figures 3 and 4. Plants 0.3–1.2(–1.6) cm tall in dense tufts, light green to blackish. Rhizoids reddish-brown, smooth or somewhat rough, at the stem’s lower parts. Stems branched, subpentagonal in section with 1–3-layered sclerodermis of thick-walled cells. Axillary hairs 50–100(–125) μm, filiform or subclaviform, 3–5 cells long, the 1–2 basalmost brown and shorter. Leaves ligulate to ovate-ligulate, sometimes ovate-lanceolate, (1.7–)2.0–2.8 (–3.2) × (0.3–)0.5–1.0 mm, appressed when dry, erect-patent when moist; leaf apex rounded to subacute, rarely acute, very often with incurved margins forming a distinct channel; leaf margins entire, recurved along most of the leaf length; leaf lamina unistratose, somewhat keeled; costa 40–70 μm wide at base, 30–45 μm at mid-leaf, with two rows of ventral cells, ending below leaf apex. Basal leaf cells rectangular to elongate, (20–)35–60(–75) × (8–)15–22 μm thin or thick-walled; marginal basal cells 9–15 × 6–12 μm rectangular to subquadrate; midleaf cells isodiametric to elongate, 9–16(–20) × 8–15 μm smooth or with 2–3 low papillae. Gemmae fusiform or claviform, green to brownish, frequent and often abundant on leaves, 4–7 cells long, 150–200(–350) μm. Cladautoicous; perigonia terminal on branches, perigonial leaves ovate to elliptical with short costa and rhomboidal cells; perichaetial leaves terminal on branches, perichaetial leaves not differentiated. Vaginula 0.3–0.6 mm long, cylindrical to frustrum-shaped, naked. Calyptra fusiform when young, fusiform to oblong-conic when mature, longitudinally plicate, with sparse (uni- or) biseriate, appressed, smooth hairs up to 0.8(–1.1) mm long, rarely densely growing forming a terminal comma. Seta 0.4–0.8(–1.0) mm, not twisted. Capsule immersed to shortly emergent, 1.2–2.5 mm in length, fusiform when full of spores, subcylindrical, constricted below mouth and strongly ribbed when dry and empty; capsule neck defluent. Lid subconic or somewhat convex, rarely plane, with short rostrum and a reddish or orange thin basal ring. Exothecial cells elongated, 20–45 × 8–20 μm, hyaline; 8 exothecial bands differentiated along most of the urn length, (3–)4–6 cells wide, band cells (12–)30–50 × 12–25(–30) μm, rectangular, thick-walled and brown. Stomata cryptopore partially to completely covered by surrounding cells, located in the lower half of the urn, very rarely reaching the neck. Peristome double. Exostome of 8 pairs of teeth 150–200(–250) μm long, triangular, whitish to pale brown, very rarely splitting, recurved when dry; external side of teeth (outer peristome layer, OPL) densely papillose in all its length, very rarely with isolated striae towards apex; internal side of teeth (exostome primary peristome layer, PPL) smooth, sometimes with low papillae and striae towards apex. Endostome of 8 segments, 140–190(–220) μm long, linear or somewhat stout; external side of segments (endostome PPL) smooth; internal side of segments (inner peristome layer, IPL)

more or less papillose or striate, very rarely smooth; connective membrane low and often fragmented, ornamented like the endostome. Spores 12–17(–21) μm, subspherical, papillose. Orthotrichum tenellum spans all the Mediterranean Basin from the Iberian Peninsula and the Maghreb to southern Turkey and Cyprus through southern Europe. It is one of the most characteristic species of the European epiphytic bryoflora (Lara & al., 2001; Draper & al., 2008) and is also present in Macaronesia (Azores, Madeira, Canary Islands). Orthotrichum tenellum can also be found in relatively dry and warm niches along central and northern Europe, from the British Isles to Ukraine, and reaching eastwards central Asia (Ignatov & al., 2006). Orthotrichum comosum F. Lara, R. Medina & Garilleti – Holotype: SPAIN. Cádiz, Algeciras, Sierra de la Luna, Quercus forest close to Los Llanos del Juncal, 36°06′02″ N 005°32′14″ W, 700 m, epiphyte on Quercus suber, 13 Mar. 1998, J. Guerra, F. Lara & V. Mazimpaka s.n. (BCB; isotypes: MAUAM, MUB). – “Orthotrichum paivanum” Schimp. in Ber. Thätigk. St. Gallischen Naturwiss. Ges. 1872–73: 172. 1874, nom. nud.: Insula Madeira, Mandon s.n. (BM n.v., PC !, S n.v., TR !). Figures. 5 and 6. Plants 0.3–0.9 cm tall, in dense and small tufts, dark green. Rhizoids reddish-brown, smooth or slightly rugose, on stem basal parts. Stems branched, densely foliose, rounded to subpentagonal in section, sclerodermis of 2–3 thick-walled cell layers. Axillary hairs 50–125(–200) μm long, subclaviform to filiform, 3–5 cells, the basalmost shorter and brown. Leaves linear-lanceolate to ovate-lanceolate, with the base sometimes widened, 1.75–3.0 × 0.5–0.8 mm, appressed when dry, erectpatent when moist; leaf apex plane or slightly keeled, bluntacute to acuminate, often mucronate; leaf margins recurved to revolute from base to upper third or almost to apex; lamina unistratose, frequently with bistratose ridges scattered towards the upper part, keeled in section; costa 65–80(–100) μm wide at base, 47–60 μm at mid-leaf, with two guide cells, ending below apex. Basal leaf cells subrectangular or elongate to somewhat elliptical, (25–)35–85 × 10–19 μm, with walls thin or thickened, sometimes nodulose; marginal basal cells subquadrate to rectangular, 17–33 × 13–21 μm; middle and upper cells isodiametric or elongated, sometimes irregular, (7)11–21 × 9–15 μm, smooth or with (1–)2(–3) low unbranched papillae. Gemmae vermiform or claviform, very rarely branched, frequent on leaves, 4–20 cells long, 75–300(–500) × 22–30 μm. Gonioautoicous or cladautoicous; perigonia lateral or terminal, frequently adjacent to perichaetia, perigonial leaves oblong-elliptical, apiculate with rhomboidal or polygonal cells; perichaetia terminal, perichaetial leaves not differentiated, occasionally elliptical-ligulate with plane margins. Vaginula 0.25–0.4(–0.6) mm, cylindrical or frustum-shaped, naked. Calyptra fusiform when immature, turning oblong-conic and longitudinally plicate when mature, typically with an apical comma of robust, uni-biseriate hairs up to 600 μm long, papillose and thick-walled. Seta 0.3–0.6 mm, not twisted. S1



Capsule immersed, 1.3–1.8(–2.0) mm long, fusiform to subcylindrical when full of spores, turning cylindrical, strongly ribbed and contracted below the mouth when empty and dry; capsule neck long defluent. Lid plane or slightly convex, with a short rostrum and a light orange basal ring. Exothecial cells elongated, subrectangular or polygonal, (15–)25–55(–70) × 11–24(–28) μm, hyaline; 8 exothecial bands reaching the lower third of the urn, 4–5 cells wide, band cells (18–)35– 55(–67) × 14–33(–41) μm, thick-walled and brownish. Stomata cryptopore, partially to completely covered by surrounding cells, present in the lower half (third) of the urn and the neck. Peristome double. Exostome of 8 pairs of teeth, 180–250 μm long, very rarely splitting when old, triangular, whitish to brownish, recurved when dry; OPL with a variably papillose basal reticule, sometimes with smooth areas, papillose and with vermicular lines towards apex; exostome PPL smooth at base, smooth or with faint papillae and longitudinal striae towards apex. Endostome of 8 segments (occasionally shorter intermediary segments present) 125–230 μm long, with broad bases and usually thickened transversal walls; endostome PPL smooth; IPL rugulose, sometimes papillose, rarely with striae at bases; connective membrane continuous, low, ornamented like segment bases. Spores (10–)12–16(–18) μm, subspherical, coarsely papillose. Up to date, O. comosum is known only from the western Mediterranean Basin and the Canary Islands (Fig. 13); it is relatively frequent in the southern and western portions of the Iberian Peninsula and northern Morocco. It has been also recorded in La Gomera, Canary Islands (as O. alpestre) by González Mancebo & al. (2007) and in northern Sicily. Its ecological range is similar to that of O. tenellum, but it is less frequent and generally prefers dryer niches. Orthotrichum coulteri Mitt. in J. Proc. Linn. Soc. Bot. 8: 25. 1864 ≡ Orthotrichum tenellum var. coulteri (Mitt.) Grout in Britton, N. Amer. Fl. 15A: 19. 1946 – Lectotype (designated by Vitt in Bryophyt. Biblioth. 1: 190. 1973): California, Coulter 839–840 (FH !) = Orthotrichum cylindrocarpum Lesq. in Trans. Amer. Philos. Soc. 13: 6. 1865 ≡ Orthotrichum tenellum var. cylindrocarpum (Lesq.) L.F. Koch in Leafl. W. Bot. 6: 23. 1950 – Lectotype (designated by Vitt in Bryophyt. Biblioth. 1: 190. 1973): California, Oakland, Bolander s.n. (MICH !; isolectotypes: CANM n.v., FH !, NY !) Figures 7 and 8. Plants 0.3–0.8(–1.4) cm tall, forming loose tufts, light to dark green. Rhizoids brown-reddish, smooth or slightly rough, on stems lower parts and very frequently on branches, sometimes bearing gemmae. Stems densely branched, subpentagonal in section with a 1–2(–3) layered sclerodermis of thick-walled cells. Axillary hairs 100–150(–225) μm, filiform, comprised of 3–4(–7) cells, the basalmost brown and shorter. Leaves long triangular to narrowly lanceolate, rarely ovatelanceolate, (1.2–)1.5–2.7(–3.2) × 0.2–0.5(–0.7) mm, appressed when dry, erect-patent when moist; leaf apex acute to subobtuse or blunt, not channelled; leaf margins entire, recurved from base to near apex; leaf lamina unistratose, rarely with scattered

bistratose ridges towards the upper part, keeled in section; costa 75–90 μm wide at base, 45–60 μm at mid lamina, with two rows of ventral cells, ending below apex. Basal leaf cells rectangular to polygonal, (12–)20–50(–62) × (5–)7.5–15 μm, hyaline, generally thick-walled; marginal basal cells subquadrate, (5–)10–17 × 10–20 μm; mid and upper leaf cells isodiametric to elongate, 7.5–15(–18) × (5–)10–12 μm, with (1–)2–3(–4) low papillae, rarely smooth. Gemmae fusiform to claviform, occasionally long and branched, formed by 3–9 cells, frequent and sometimes very abundant on leaves, rare on rhizoids, 45– 125(–250) × 20–30 μm. Cladautoicous; perigonia terminal on branches; perigonial leaves ovate with short costa and rhomboidal cells; perichaetia terminal on branches, perichaetial leaves not differentiated. Vaginula (0.5–)0.6–0.8 mm long, cylindrical to frustum-shaped, with abundant uni-biseriate hairs, (0.2–)0.4–0.9(–1.5) mm long, with thick-walled cells, often papillose. Calyptra conic when young, narrowly oblong-conic or fusiform when mature, yellowish and longitudinally ribbed, with abundant, conspicuous uni-biseriate hairs, papillose and thick-walled. Seta 0.8–1.5(–2.2) mm, yellowish, twisted counterclockwise. Capsule exserted, rarely only almost exserted, (1.3–)1.5– 1.75(–2.1) mm in length, fusiform when full of spores, turning cylindrical, longitudinally ribbed and somewhat constricted below mouth when empty and dry; capsule neck defluent. Lid plane to subconic, rostrate, with a darker reddish basal ring. Exothecial cells subrectangular to elongate, 15–45(–60) × (10–) 12–15 μm, hyaline; 8 exothecial bands differentiated along most of the urn, (2–)3–4 cells wide, band cells (12–)20–40(–52) × (12–)20–27 μm, subquadrate to rectangular, brown and thickwalled. Stomata cryptopore, almost to completely covered by surrounding cells, restricted to the lower third of the urn and the neck. Peristome double. Exostome of 8 triangular pairs of teeth, 170–210 μm long, not splitting when old, pale yellowish, recurved when dry; OPL uniformly papillose-reticulate, rarely forming vermicular lines towards apex; exostome PPL smooth, or rarely with very subtle striae. Endostome of 8 narrowly triangular to linear segments, alternating with exostome teeth, 125–150(–175) μm, endostome PPL smooth or with subtle basal striate and apical papillae; IPL smooth; connective membrane low, occasionally discontinuous, ornamented like the endostome. Spores 12– 18(–22) μm, subspherical, papillose. Orthotrichum coulteri seems to be restricted to California, although it is likely also occurring in adjacent states, especially the Mexican Baja California. It is present through the Coastal Ranges and the Pacific coast with Mediterranean climate, between Point Arena and Gulf of Santa Catalina, including the Channel Islands. In these coastal areas it is found coexisting and mixed in epiphytic communities of sclerophyllous forests and thickets occurring up to 600 m asl. Orthotrichum cucullatum F. Lara, R. Medina & Garilleti – Holotype: U.S.A. California. Alameda Co., Berkeley, Tilden Regional Park, Botanical Garden, on trunk of Aesculus californica, 18 Oct. 2008, F. Lara s.n. (CAS; isotype: MAUAM). Figures 9 and 10. S2



Plants 0.3–0.8(–1.2) cm tall, in compact tufts, light to bright green. Rhizoids reddish-brown, on lower parts of the stems, smooth or slightly rough. Stems branched below, subpentagonal in section with a 1–3-layered sclerodermis of thick-walled cells. Axillary hairs (75–)100–175(–200) μm long, filiform to subclaviform, comprised of (3–)4–7 cells, the 1–2 basalmost shorter and brown. Leaves ligulate to ovate-ligulate, (1.2–)1.5–2.5(–2.75) × (0.3–)0.4–0.6(–0.75) mm, appressed, straight or occasionally weakly flexuose when dry, erectpatent when moist; leaf apex rounded to obtuse, almost plane to cucullate, sometimes denticulate; leaf margins entire, recurved through most of the lamina; lamina unistratose, variably keeled in section; costa 55–75 μm wide at base, 40–50 μm at midleaf, with two rows of ventral guide cells, ending below apex. Basal leaf cells rectangular to elongate, (25–)35–60(–80) × 12–18(–24) μm, hyaline, mostly thin-walled; marginal basal cells subquadrate, 10–14 × 12–16 μm; mid and upper leaf cells isodiametric to elliptical, (7–)10–14(–20) × 7–12 μm, with 2–3 papillae. Gemmae fusiform to claviform, 3–5 cells long, 50–80 μm, usually present on leaves, but scarce. Cladautoicous; perigonia terminal on branches; perigonial leaves ovate to ovate-lanceolate with short costa and rhomboidal cells; perichaetia terminal on branches, perichaetial leaves not differentiated. Vaginula 0.2–0.3(–0.5) mm long, cylindrical or frustum-shaped, with scarce uni-biseriate hairs (150–)200– 500(–600) μm, exceptionally naked. Calyptra ovoid-conic when young, turning ovoid and rostrate to oblong-conic when mature, longitudinally plicate, naked or with inconspicuous stout hairs up to 300 μm long, not concentrated at tip. Seta (0.35–)0.5–0.75 mm long, twisted counterclockwise. Capsule immersed, (1.25–)1.5–1.75 mm long, cylindrical to fusiform and slightly constricted under mouth when full of spores, becoming subcylindrical, ribbed, constricted below mouth when empty and dry; capsule neck defluent. Lid subconic with thick rostrum and crimson basal ring. Exothecial cells shortly rectangular to elongate, (20–)30–50 × (10–)12–16 μm, hyaline; 8 exothecial bands differentiated through most of the urn length, 4(–6) cells wide, band cells 25–55 × (12–)16–30 μm, thick-walled and brownish. Stomata cryptopore, almost to completely covered by surrounding cells, present at lower half of capsule but not on neck. Peristome double. Exostome of 8 pairs of teeth, 160–210 μm long, long triangular, yellowish to orange, sometimes truncate and splitting into pairs when old, reflexed when mature and dry; OPL ornamented with a dense reticulum more or less papillose, sometimes forming vermicular lines towards apex, but often eroded; exostome PPL smooth at base, often striate towards apex. Endostome of 8 segments alternating with teeth, 110–180 μm long, linear, somewhat widened at base, exceptionally with rudiments of intermediary segments; endostome PPL smooth; IPL smooth or weakly ornamented with basal lines; connective membrane low, continuous or fragmented; smooth or ornamented with horizontal lines. Spores 12–16(–20) μm, subspherical, papillose. Orthotrichum cucullatum is also an epiphytic species with strong affinity for the Mediterranean climate, widespread along the Californian seashore, coastal ranges and Channel Islands, and also recorded from the inland (Great Valley and western

slopes of Sierra Nevada) through an altitude range of 0–600 m (Fig. 13). As in the case of O. coulteri, this species is likely to be present also in Baja California. Orthotrichum franciscanum F. Lara, R. Medina & Garilleti – Holotype: U.S.A. California, San Francisco Co., Holly Park, off Holly Drive, 37°44′15″ N 122°25′10″ W, 300 ft; on trunk of Eucalyptus, near the hill top, 1 Apr. 2000, J.R. Shevock 19132 (UC No. 1741964 !; isotypes: CAS No. 1017063 !, MAUAM !). Figures 11 and 12. Plants (0.2–)0.4–0.8 cm tall, in small, loose tufts, olive green to blackish green. Rhizoids reddish-brown, smooth or rough, mostly restricted to stem lower parts. Stems densely branched, subpentagonal in section, with sclerodermis of 1–2(–3) thick-walled cell layers. Axillary hairs 75–200 μm long, filiform to subclaviform, comprised of 3–5 cells, the 1–2 basalmost shorter and brown. Leaves very variable in shape, from linear-lanceolate to ovate-lanceolate or ovate-ligulate, 1.2–2.5(–2.8) × 0.3–0.7(–0.9) mm, appressed when dry, erectpatent when moist; leaf apex plane, acute, frequently acuminate and ending in a fragile, linear apiculum of 1–3(–5) hyaline cells, (20–)27–55(–70) × 10–15 μm, elongated to bullet-shaped; leaf margins entire, typically revolute at mid-leaf and only slightly recurved towards the base and apex; lamina unistratose, keeled in section; costa (55–)70–90(–110) μm wide at base, (35–)45–60 μm at the mid-leaf, with 2 rows of ventral cells, ending below apex. Basal leaf cells elongate to polygonal, (14–)20–48(–80) × (8–)10–22(–32) μm, thin or thick-walled, locally sinuous; marginal basal cells rectangular to subquadrate, (10–)15–37(–65) × (8–)12–15(–18) μm, thick-walled; mid and upper leaf cells isodiametric to elliptical, sometimes subhexagonal or irregular, (8–)10–15(– 22) × (8–)10–18(–20) μm, smooth or with 2–4 not prominent papillae; Gemmae fusiform to cylindrical, 3–7 cells long, 60–110(–160) μm long, occasional on leaves. Cladautoicous; perigonia on branches, perigonial leaves ovate to ovate-lanceolate, with rhomboidal cells and short costa; perichaetia terminal on branches, perichaetial leaves not differentiated. Vaginula 0.3–0.5 μm long, cylindrical to frustum-shaped, with sparse uni-biseriate hairs, (200–)400– 700(–900) μm, frequently thick-walled and papillose. Calyptra fusiform when young, turning oblong-conic when mature, yellowish with brown or blackish tip, longitudinally plicate, with sparse uni-biseriate, papillose and thick-walled hairs. Seta 0.4–0.8(–1.0) mm long, somewhat twisted counterclockwise. Capsule immersed to emergent, 1.0–1.7 mm long, ovoid-elliptical when full of spores, turning subcylindrical, strongly ribbed and variably constricted in the upper half when empty and dry; neck long defluent. Lid plane or almost plane, with a thin and short rostrum and a red-brownish basal ring. Exothecial cells rectangular or elongate, 22–50(–70) × (8–)12–17 (–27) μm, hyaline; 8 exothecial bands differentiated through most of the urn length, 3–4(–5) cells wide; band cells (16–) 20–50 × (10–)15–28(–32) μm, rectangular, thick-walled and brownish. Stomata cryptopore, almost to completely covered by surrounding cells, restricted to the lower third (half) of S3



the urn and neck. Peristome double. Exostome of 8 pairs of teeth, (130–)150–200(–240) μm long, triangular, whitish, non-splitting, recurved when dry, often truncate or fenestrate towards the apex; OPL reticulate to papillose, sometimes forming faint transversal lines at the base, and longitudinal striae towards apex; exostome PPL smooth or almost so. Endostome of 8 segments, (120–)140–170(200) μm long, linear with a wide base, frequently appendiculate; endostome PPL smooth; IPL smooth or faintly papillose; connective membrane low and often fragmented, ornamented like the endostome. Spores (10–)12–16(–20) μm, subspherical, papillose. Orthotrichum franciscanum exhibits a strong oceanic affinity, growing usually in lowlands but occasionally reaching 400 m of altitude, rarely venturing more than 20 km inland. It is only know from California, and is especially frequent in the San Francisco Bay area, even in urban parks and tree-lined streets, and it also colonizes granite boulders at the Farallon Islands. This species also reaches the southern coastal mountains of California and it is present in the Channel Islands (Fig. 13).

LITERATURE CITED Draper, I., Mazimpaka, V. & Lara, F. 2008. New records to the epiphytic bryophyte flora of Tunisia. Cryptog. Bryol. 29: 83–91. González Mancebo, J.M., Albertos, B., Barrón, A., Cezón, K., Cros, R.M., Draper, I., Estébanez, B., Garilleti, R., Hallingbäck, T., Hernández-Maqueda, R., Lara, F., Losada-Lima, A., Mateo, R.G., Mazimpaka, V., Muñoz, J., Medina, R., Medina, N.G., Patiño, J., Puche, F., Rams, S., Ros, R.M. & Ruiz, E. 2007. Bryophytes collected by the Spanish Bryological Society during a field trip at La Gomera (Canary Islands). Bol. Soc. Esp. Briol. 30/31: 43–52. Ignatov, M.S., Afonina, O.M. & Ignatova, E.A. 2006. Check-list of mosses of East Europe and North Asia. Arctoa 15: 1–130. Lara, F., Garilleti, R., Mazimpaka, V., Sérgio, C. & Garcia, C. 2001. Some new or remarkable Orthotrichum records from Portugal. Cryptog. Bryol. 22: 279–285.

S4