Vallisneria spiralis and Egeria densa (Hydrocharitaceae) in arctic and ...

Vallisneria spiralis and Egeria densa (Hydrocharitaceae) in arctic and subarctic Iceland P. Wasowicz*1, E. M. Przedpelska-Wasowicz2, L. Guðmundsdo´ttir1, M. Tamayo3 1

Icelandic Institute of Natural History, Akureyri, Iceland, 2Institute of Botany, University of Warsaw, Poland, Faculty of Life and Environmental Science, University of Iceland, Reykjavı´k, Iceland

3

We report the spread of two aquatic invasive plants, Vallisneria spiralis L. and Egeria densa Planch., into geothermal ponds in Iceland. These species are effective invaders due to their efficient dispersal, vegetative reproduction, high biomass production, and popularity in the aquarium trade. V. spiralis and E. densa were found in 2013 in a man-made pond near Husavik in northern Iceland. E. densa also occurs, at least since 2004, in southern Iceland, in Opnur Springs. Both species were confirmed by DNA sequencing. Our results indicate that V. spiralis and E. densa have established self-sustaining populations in Iceland, representing to date the northern-most confirmed occurrences of both species. These Icelandic populations extend the northern limit of E.densa and V. spiralis by at least 1000 km and, to our knowledge, are the first records of non-native invasive aquatic plants in the arctic and subarctic. Our study shows that geothermally heated water bodies can further facilitate the spread of aquatic invasive plants into arctic and subarctic areas. Keywords: aquatic, DNA-barcoding, freshwater, geothermal, invasive species

Introduction One of the main drivers of change in freshwater ecosystems worldwide is the presence of aquatic invasive species, which can cause substantial ecological and economic impacts (Carpenter et al., 2011; Strayer, 2010; Vila` et al., 2010). Aquatic invasive plants, for example, can ‘re-engineer’ freshwater communities by displacing native vegetation, altering food web structure, changing hydrochemistry, and increasing primary production and sedimentation (Laranjeira & Nadais, 2008; Siters et al., 2011; Strayer, 2010). Non-native aquatic plants have spread worldwide and, currently, Europe has 96 non-native aquatic plant species from 30 families (Hussner, 2012). Most of these records come from countries in relatively warm climatic zones (oceanic-temperate and Mediterranean) and only a few species occur in northern and eastern Europe (Husser, 2012). These geographical differences seem to be due to climatic factors that significantly limit the distribution of non-native aquatic species (Chytry et al., 2009). Harsh climatic conditions are also regarded as one of the main factors that contribute to a relatively low percentage of non-native plant species in arctic and subarctic floras (Wasowicz et al., 2013). To

*Corresponding author: [email protected]

ß Botanical Society of Britain & Ireland 2014 DOI 10.1179/2042349714Y.0000000043

date, non-native aquatic plants have not been recorded in the arctic and subarctic, as defined by the Circumpolar arctic vegetation map (CAVM Team, 2003). Here we report the spread of two invasive, aquatic plants, Vallisneria spiralis L. and Egeria densa Planch., to the subarctic and arctic areas of Iceland, facilitated by the occurrence of a novel habitat: geothermally heated water bodies.

Methods The sequence of the ribulose-1,5-bisphosphate carboxylase/oxygenase chloroplast gene (rbcL), commonly used in species molecular barcoding (Hollingsworth et al., 2009), was employed to confirm species identifications. This was particularly important in the case of Vallisneria spiralis, where reproductive material was unavailable and the presence of flowers is crucial for its distinction from V. americana Michx.

DNA sequencing and data analysis DNA extraction followed the method of Doyle & Doyle (1987) with minor modifications. The following primers were used in the amplification and sequencing of the rbcL gene: rbcLa — F: ATGTCACCACAAACAGAGACTAAAGC (Levin et al., 2003), and rbcLa — R: GTAAAATCAAGTCCACCRCG (Kress & Erickson, 2007). Sequences were aligned using

New Journal of Botany

2014

VOL.

4

NO.

2

85

Wasowicz et al.

Vallisneria spiralis and Egeria densa in arctic and subarctic Iceland

Figure 1 Neighbour-joining bootstrap trees based on rbcL sequences from (A) Vallisneria spiralis and (B) Egeria densa, and other morphologically similar taxa. Numbers above the branches show bootstrap confidence levels (from 10 000 replicates); values lower than 50% are not shown. GenBank accession numbers are given below species names. Accessions from Iceland are marked in red.

ClustalW (Thompson et al., 1994) and adjusted manually. The final alignment had 534 nucleotide positions. In our analyses, we also used sequences from the following morphologically similar taxa, retrieved from Genbank: Egeria densa (JX100677.1, JX100676.1, JX100685.1), Elodea canadensis Rich. in Michx. (DQ859167.1, HQ901556.1), Elodea nuttallii (Planch.) H. St. John (U806696.1, AB004888.1), Hydrilla verticillata (L.f.) Royle (GU135242.1, GU13549.1), Hydrocharis morsus-ranae L. (JN891258.1), Lagarosiphon major (Ridley) Moss (JX100698.1, JX100699.1), Sagittaria sagittifolia L. (JN890853.1, GU344676.1), Sparganium emersum Rehmann (HQ590285.1, GU344676.1), Vallisneria americana (EF143015.1, EF143005.1), and Vallisneria spiralis (EF694963.1). Trex-online (Boc et al., 2012) was employed to construct NJ trees using uncorrected distances and 10 000 bootstrap replicates. Sequences of the rbcL gene were deposited in GenBank under the accession numbers: KJ647331.1 (V. spiralis) and KJ647331.1 (E. densa). Species occurrences were documented by herbarium vouchers deposited in the AMNH herbarium (V. spiralis — VA21240; E. densa — VA18996, VA21241).

Results Vallisneria spiralis DNA rbcL sequences showed clearly that V. spiralis (Fig. 1A) is indeed present in Iceland. We first recorded this invasive aquatic plant in 2013 in a

86


2014

VOL .

4

NO .

2

man-made pond south-west of the town of Husavik (66.01576uN, 17.35678uW) in northern Iceland (Fig. 2). The pond is about 1.2 ha and is created by warm geothermal water discharged from a local geothermal pipeline network. V. spiralis is widespread in the pond and is reproducing vegetatively through runners. Currently, we have not seen any signs of sexual reproduction, but long-term monitoring is needed to confirm this. Given that V. spiralis is naturalised and present throughout the pond, we suspect that colonisation took place several years ago.

Egeria densa Both vegetative and reproductive material was examined and, on the basis of morphological characters alone, it was possible to determine both accessions from Iceland as E. densa. This determination was confirmed by sequencing the rbcL gene (Fig. 1B). The presence of E. densa in Iceland was first reported in 2004, from Opnur Pond (63.97uN, 21.173uW, Fig. 2) ¨ lfusforir wetland area, about 2 km south from in the O the town of Hveragerdi in southern Iceland, as well as in a ditch system originating from the pond (loo´rðarson, 2010); 9 years later (in 2013) we found another population in a pond close to Husavik (66.01576uN, 17.35678uW) in northern Iceland (Fig. 2) Opnur Pond is a shallow (0.3–1.5 m) natural pond with an area of c.1 ha, fed by several tepid springs. E. densa has already started to displace the natural vegetation and is

Wasowicz et al.


Figure 2 Geographical distribution of (A) Vallisneria spiralis and (B) Egeria densa, in Europe (GBIF, 2014) and in Iceland.

now the dominant aquatic plant there, reproducing by fragmentation and often forming dense monotypic stands, especially during the winter when other aquatic

plants are dormant (loo´rðarson, 2010). We recorded the presence of male plants only, in both northern and southern Iceland.


2014

VOL .

4

NO .

2

87

Wasowicz et al.


Discussion Both V. spiralis and E. densa are popular aquarium plants, which has contributed to their spread beyond their native ranges. V. spiralis is native to Asia, southern Europe, and North Africa, and it has been introduced to 22 European countries, making it the third most widespread non-native aquatic plant in Europe (Hussner, 2012). E. densa is native to Brazil, Uruguay, and Argentina, but it has been introduced to at least twelve European countries (Hussner, 2012) and is now included in the EPPO (European and Mediterranean Plant Protection Organization) list of invasive non-native plants (http://www.eppo.org). Distribution data from Europe suggest that both species have been spreading extensively in Europe in the last few decades (Fig. 2). Their spread, however, has been limited primarily to areas with a relatively mild oceanic climate. According to the Global Biodiversity Information Facility Data Portal (GBIF, 2014), the northernmost locations of V. spiralis and E. densa are in the UK and Denmark, respectively. Our data, however, extends the northern limits of E. densa and V. spiralis by at least 1000 km. There is no doubt that distribution data obtained from the GBIF database are far from complete and neither of the maps should be treated as definitive. However, we reviewed additional sources of information, including published literature and databases, e.g. Alien Species Compendium (http://.www. cabi.org), NOBANIS (http://www.nobanis.org), and DAISIE (http://www.europe-aliens.org), in order to check thoroughly the northernmost locations of both species in Europe. During this task, we rejected doubtful data, such as a record of V. spiralis from Denmark (Jørgensen, 1927). Geothermally heated water bodies are relatively rare habitats. In the case of hot springs (with the temperature approaching 100uC), both the water temperature and high content of dissolved substances (Arnorsson et al., 2008) makes these environments inhospitable for plant growth. In contrast, tepid springs, with lower water temperature and lower content of dissolved matter, create suitable growing conditions for non-native species in arctic and subarctic areas. Biological invasions are known throughout the world but significantly few are recorded from the arctic (Lassuy & Levis, 2013). The number of nonnative terrestrial plants in the arctic follows the same pattern, with fewer records than in lower latitudes (Lassuy & Levis, 2013). The status of non-native, invasive, freshwater aquatic plant species in the arctic and subarctic is even less well known. To our knowledge, the presence of E. densa and V. spiralis in northern Iceland is the first record of such species in the arctic and subarctic as defined by CAVM Team (2003).

88


2014

VOL .

4

NO .

2

Both species are dispersed by natural and humanmediated means. Their spread is greatly facilitated by their vegetative reproduction, high biomass production, and the careless disposal of aquaria content into local ponds, lakes, and rivers (Hussner, 2012; Hussner & Lo¨sch, 2005). We suspect that both species were introduced to Iceland via aquarium disposal. Currently, E. densa is classified as a naturalised alien in Iceland (Wasowicz et al., 2013), and in southern Iceland (at Opnur Pond), it is displacing native aquatic plants (loo´rðarson, 2010). V. spiralis also seems to be locally naturalised. We expect that both species will continue to spread in Iceland, invading both natural and man-made water bodies fed by geothermal water; these are fairly abundant in the country and follow roughly the spatial distribution of warm springs. This invasion risk, however, can be reduced by increasing public awareness on proper aquarium disposal, banning the trade of known invasive species, controlling and eradicating existing invasions, and monitoring geothermally heated water bodies.

References Arnorsson, S., Axelsson, G. & Saemundsson, K. 2008. Geothermal systems in Iceland. Jo¨kull, 58: 269–302. Boc, A., Diallo, B. & Makarenkov, V. 2012. T-REX: a web server for inferring, validating and visualizing phylogenetic trees and networks. Nucleic Acids Research, 40: W573–W579. Carpenter, S. R., Stanley, E. H. & VanderZanden, M. J. 2011. State of the world’s freshwater ecosystems: physical, chemical, and biological changes. Annual Review of Environment and Resources, 36: 75–99. CAVM Team. 2003. Circumpolar arctic vegetation map. Scale 1 : 7,500,000. Conservation of Arctic Flora and Fauna (CAFF) Map No. 1. Anchorage, AK: U.S. Fish and Wildlife Service. Chytry, M., Pysˇek, P., Wild, J., Pino, J., Maskell, L. C. & Vila`, M. 2009. European map of alien plant invasions based on the quantitative assessment across habitats. Diversity and Distributions, 15: 98–107. Doyle, J. J. & Doyle, J. L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin, 19: 11–15. GBIF. 2014. Global biodiversity information facility data portal. Copenhagen: GBIF [accessed 17 March 2014]. Available at: ,http://www.gbif.org/.. Hollingsworth, P. M., Forrest, L. L., Spouge, J. L., Hajibabaei, M., Ratnasingham, S., van der Bank, M., Chase, M. W., Cowan, R. S., Erickson, D. L., Fazekas, A. J., Graham, S. W., James, K. E., Kim, K. J., Kress, W. J., Schneider, H., van AlphenStahl, J., Barrett, S. C., van den Berg, C., Bogarin, D., Burgess, K. S., Cameron, K. M., Carine, M., Chacoń, J., Clark, A., Clarkson, J. J., Conrad, F., Devey, D. S., Ford, C. S., Hedderson, T. A., Hollingsworth, M. L., Husband, B. C., Kelly, L. J., Kesanakurti, P. R., Kim, J. S., Kim, Y. D., Lahaye, R., Lee, H. L., Long, D. G., Madrinãń, S., Maurin, O., Meusnier, I., Newmaster, S. G., Park, C. W., Percy, D. M., Petersen, G., Richardson, J. E., Salazar, G. A., Savolainen, V., Seberg, O., Wilkinson, M. J., Yi, D. K. & Little, D. P. 2009. A DNA barcode for land plants. Proceedings of the National Academy of Sciences USA, 106: 2794–12797. Hussner, A. 2012. Alien aquatic plant species in European countries. Weed Research, 52: 297–306. Hussner, A. & Lo¨sch, R. 2005. Alien aquatic plants in a thermally abnormal river and their assembly to neophyte dominated macrophyte stands (River Erft, Northrhine-Westphalia). Limnologica, 35: 18–30. Jørgensen, C. A. 1927. Chromosomes and sex in Vallisneria. Journal of Genetics, 18: 63–75.

Wasowicz et al.

Kress, W. J. & Erickson, D. L. 2007. A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH–psbA spacer region. PLoS ONE, 2(6): e508. Laranjeira, L. M. & Nadais, G. 2008. Eichhornia crassipes control in the largest Portuguese natural freshwater lagoon. Bulletin OEPP, 38: 487–495. Lassuy, D. R. & Lewis, P. N. 2013. Invasive species: humaninduced. In: Meltofte, H., ed. Arctic biodiversity assessment. Status and trends in arctic biodiversity, pp. 559–565. Akureyri: Conservation of Arctic Flora and Fauna. Levin, R. A., Wagner, W. L., Hoch, P. C., Nepokroeff, M., Pires, J. C., Zimmer, E. A. & Sytsma, K. J. 2003. Family-level relationships of Onagraceae based on chloroplast rbcL and ndhF data. American Journal of Botany, 90: 107–115. Strayer, D. L. 2010. Alien species in fresh waters: ecological effects, interactions with other stressors, and prospects for the future. Freshwater Biology, 55: 152–174.


Stiers, I., Crohain, N., Josens, G. & Triest, L. 2011. Impact of three aquatic invasive species on native plants and macroinvertebrates in temperate ponds. Biological Invasions, 13: 2715–2726. Thompson, J. D., Higgins, D. G. & Gibson, T. J. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22: 4673–4680. Vila`, M., Basnou, C., Pysˇek, P., Josefsson, M., Genovesi, P., Gollasch, S., Nentwig, W., Olenin, S., Roques, A., Roy, D., Hulme, P. E. & DAISIE partners. 2010. How well do we understood the impacts of alien species on ecosystem services? A pan-European, cross-taxa assessment. Frontiers in Ecology and the Environment, 8: 135–144. Wasowicz, P., Przedpelska-Wasowicz, E. & Kristinsson, H. 2013. Alien vascular plants in Iceland: diversity, spatial patterns, temporal trends, and the impact of climate change. Flora, 208: 648–673. loo´rðarson, T. 2010. Forekomst av Egeria densa pa˚ Island. Blyttia, 68: 231–244.


2014

VOL .

4

NO .

2

89