with B-precursor acute lymphoblastic leukemia ...

From bloodjournal.hematologylibrary.org by guest on March 4, 2013. For personal use only.

Prepublished online October 18, 2011; doi:10.1182/blood-2011-04-350850

Overexpression of LEF1 predicts unfavorable outcome in adult patients with B-precursor acute lymphoblastic leukemia Andrea Kühnl, Nicola Gökbuget, Martin Kaiser, Cornelia Schlee, Andrea Stroux, Thomas Burmeister, Liliana H. Mochmann, Dieter Hoelzer, Wolf-Karsten Hofmann, Eckhard Thiel and Claudia D. Baldus

Articles on similar topics can be found in the following Blood collections Editorials (149 articles) Clinical Trials and Observations (3667 articles) Lymphoid Neoplasia (1329 articles) Pediatric Hematology (214 articles) Information about reproducing this article in parts or in its entirety may be found online at: http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requests Information about ordering reprints may be found online at: http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprints Information about subscriptions and ASH membership may be found online at: http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtml

Advance online articles have been peer reviewed and accepted for publication but have not yet appeared in the paper journal (edited, typeset versions may be posted when available prior to final publication). Advance online articles are citable and establish publication priority; they are indexed by PubMed from initial publication. Citations to Advance online articles must include the digital object identifier (DOIs) and date of initial publication.

Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036. Copyright 2011 by The American Society of Hematology; all rights reserved.

Blood First Edition Paper, prepublished online October 18, 2011; DOI 10.1182/blood-2011-04-350850 From bloodjournal.hematologylibrary.org by guest on March 4, 2013. For personal use only.

Overexpression of LEF1 predicts unfavorable outcome in adult patients with B-precursor acute lymphoblastic leukemia Andrea Kühnl,1 Nicola Gökbuget,2 Martin Kaiser,1 Cornelia Schlee,1 Andrea Stroux,3 Thomas Burmeister,1 Liliana H. Mochmann,1 Dieter Hoelzer,2 Wolf-Karsten Hofmann,4 Eckhard Thiel,1 and Claudia D. Baldus1 1

Charité University Hospital Berlin, Campus Benjamin Franklin, Department of Hematology

and Oncology, Berlin, Germany; 2Johann Wolfgang Goethe-University, Department of Hematology and Oncology, Frankfurt/Main, Germany; 3Charité University Hospital Berlin, Campus Benjamin Franklin, Institute for Biometry and Clinical Epidemiology, Berlin, Germany; 4University Hospital Mannheim, Department of Hematology and Oncology, Mannheim, Germany

Correspondence: Claudia D. Baldus, M.D. Charité - Universitätsmedizin Berlin Campus Benjamin Franklin Hämatologie und Onkologie Hindenburgdamm 30 12203 Berlin, Germany Telephone:

+49-30-8445-2337

Fax:

+49-30-8445-4468

E-mail:

[email protected]

1 Copyright © 2011 American Society of Hematology


Abstract Aberrant activation of the Wnt pathway plays a pathogenetic role in various tumors and has been associated with adverse outcome in acute lymphoblastic leukemia (ALL). LEF1, a key mediator of Wnt signaling, has been linked to leukemic transformation and recurrent mutations of LEF1 have been identified in pediatric T-ALL. Here, we evaluated the prognostic significance of LEF1 expression in B-precursor ALL patients. LEF1 expression was determined by quantitative real-time RT-PCR in 282 adult B-precursor ALL patients treated on 06/99 and 07/03 GMALL trials. Patients were grouped into quartiles (Q1-4) according to LEF1 expression levels [LEF1 high (Q4; n = 71); LEF1 low (Q1-3; n = 211)]. Patients with high LEF1 expression had a significantly shorter relapse-free survival (RFS) compared to low LEF1 expressers (5-year RFS: LEF1 high: 27%, LEF1 low: 47%; P = 0.05). Importantly, high LEF1 expression was also associated with inferior RFS in standard risk patients and was independently predictive for RFS (P = 0.02) in multivariate analyses for this subgroup. Thus, high LEF1 expression identifies B-precursor ALL patients with inferior RFS, supporting a pathogenetic role of Wnt signaling in ALL. Standard risk patients with high LEF1 expression might benefit from early treatment modifications and new molecular therapies including agents targeting the Wnt pathway.

2


Introduction Long-term outcome of most adult patients with B-precursor acute lymphoblastic leukemia (ALL) remains unsatisfactory, although intensified therapy regimens have resulted in high complete remission (CR) rates.1,2 During the last decade, overall survival (OS) of adult ALL patients has primarily been improved by risk-adapted treatment stratification based on clinical and molecular risk factors and by the use of tyrosine kinase inhibitors in BCR-ABL-positive patients. In the large, heterogeneous group of standard risk patients without established risk factors, the relapse rate is still about 40-50% and not predictable with pretreatment markers.3,4 Prospective evaluation of minimal residual disease (MRD) has improved individual risk assessment of standard risk patients; however, the identification of new prognostic factors is of particular interest for this subgroup of ALL. Moreover, characterization of aberrant signaling pathways with prognostic relevance in standard risk B-precursor ALL might elucidate molecular mechanisms of therapy resistance and may help to develop novel targeted therapies for these patients.

Lymphoid enhancer factor (LEF) 1 is a member of the LEF/T-cell factor (TCF) family of transcription factors and a key mediator of the canonical Wingless-type (Wnt) pathway.5 Wnt activation results in the accumulation of β-catenin, which translocates to the nucleus and forms a complex with LEF/TCF DNA binding proteins, thereby enhancing the transcription of target genes. Wnt downstream target genes (eg MYC, CCND1) are involved in the regulation of central cellular processes such as differentiation, cell cycle, proliferation, and survival.6 Activation of the Wnt pathway has been implicated in leukemic transformation7-9 and was shown to promote proliferation and survival of leukemic cells in vitro.9-11 In ALL patients, a frequent down-regulation of Wnt antagonists sFRP1, sFRP2, sFRP4, sFRP5, WIF1, DKK3, and HDPR1 by promoter hypermethylation has been observed.12 This aberrant methylation profile was associated with activation of the Wnt pathway and with inferior long-term survival.

In normal hematopoiesis, LEF1 plays a crucial role in the development of B- and Tlymphocytes, as well as neutrophilic granulocytes.13-15 In different hematological malignancies, including lymphomas,16,17 chronic lymphocytic leukemia (CLL),18 ALL and acute myeloid leukemia (AML),19-21 LEF1 was found to be highly expressed. In vitro studies revealed a pro-survival effect of LEF1 in an AML1-ETO-positive leukemic cell line,9 primary 3


CLL cells,18 and murine T-cell lymphomas.17 Moreover, high expression of LEF1 was demonstrated to induce B-lymphoblastic leukemia and myeloid leukemia in a mouse model.20 Gutierrez and colleagues recently identified recurrent inactivating monoallelic and biallelic microdeletions and truncating mutations of the LEF1 gene in pediatric T-ALL.22 The subgroup of LEF1-inactivated T-ALL patients was characterized by a younger age and a trend towards a better OS.

Given the functional role of LEF1 in ALL and its putative prognostic impact, we evaluated the prognostic significance of LEF1 mRNA expression in 282 adult patients with B-precursor ALL enrolled on multicenter treatment protocols of the German Multicenter ALL (GMALL) study group in the context of known risk factors.

Patients and methods Patients We analyzed 282 adult patients with newly diagnosed B-precursor ALL that were enrolled between 1999 and 2006 on GMALL multicenter trials (GMALL 06/99: n = 138; GMALL 07/03: n = 144).23 Samples with sufficient diagnostic material available were selected from consecutive patients. Clinical and molecular features and outcome of our patient cohort were comparable with those from the total study population.24,25 Both study protocols included intensive chemotherapy, radiotherapy, and autologous or allogeneic stem cell transplantation (SCT) according to risk-adapted stratification. The GMALL 07/03 protocol also contained rituximab for CD20-positive patients. The following risk factors were used: White blood cell (WBC) count > 30/nl, late CR (> 3 weeks), pro-B ALL, t(9;22)/BCR-ABL, and t(4;11)/MLLAF4. Risk groups were assigned as follows: standard risk (no risk factor), high risk (≥ 1 risk factor), and very high risk (presence of t(9;22)/BCR-ABL). High risk and very high risk patients with a sibling or matched unrelated donor were scheduled for allogeneic SCT in first CR (CR1). Details of the study protocols are available in the European Leukemia Trial Registry.26 The studies were approved by the ethics board of the Johann Wolfgang GoetheUniversity Frankfurt/Main, Germany. Informed consent was given according to the Declaration of Helsinki. Diagnostic analyses Immunophenotypic analyses were performed by flow cytometry on fresh pretreatment bone marrow (BM) and peripheral blood (PB) samples at the GMALL central reference laboratory 4


at Charité (Berlin, Germany).27 A cell-surface antigen was defined positive when fluorescence intensity of at least 20% of cells exceeded fluorescence of negative control. Determination of BCR-ABL and MLL-AF4 were performed at the GMALL central reference laboratory at Charité (Berlin, Germany), as previously described.27,28 AnalysisE of MLL-AF4 was only done in CD10-negative samples, because the presence of MLL-AF4 is nearly exclusively restricted to this subgroup in B-precursor ALL.29 BAALC expression levels were measured as reported before.30 Real-time RT-PCR assays RNA isolation and synthesis of complementary DNA from diagnostic BM samples were done as previously described.30 Quantitative real-time reverse transcriptase polymerase chain reaction (RT-PCR) was done for each sample in duplicate. Multiplex PCR was performed with the housekeeping gene GUS (β-glucoronidase) and the comparative cycle threshold (CT) method was used to determine the relative expression levels of LEF1. The mean of the cycle number difference of the two replicates (∆CT = GUS-LEF1) was calculated, expressed as 2µ (∆CT). Amplifications were carried out on the Rotor Gene real-time PCR 3000 system (Corbett Research, Wasserburg, Germany) at 50°C for 2 minutes, 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. GUS and LEF1 were coamplified using 2 µL cDNA, 1x master mix (IQ Mix, BioRad, München, Germany), 600 nM of each primer and 350 nM of each probe. Primers for GUS and LEF1 were intron spanning: GUS probe 5´-HEX-CCAGCACTCTCGTCGGTGACTGTTCA-BHQ1, GUS forward

5´-GAAAATATGTGGTTGGAGAGCTCATT,

CCGAGTGAAGATCCCCTTTTTA;

LEF1

probe

GUS

reverse

5´-

5´FAM-CCAGATTCTTGGCA-

GAAGGTGGCAT-TAMRA, LEF1 forward 5´-AATGAGAGCGAATGTCGTTGC, LEF1 reverse 5´-GCTGTCTTTCTTTCCGTGCTA. LEF1 forward and reverse primer sequences were obtained from a public database (http://pga.mgh.harvard.edu/primerbank/; Primer Bank ID 7705917a1). Each assay included positive and negative controls. RNA from the cell line BE-13 was measured in each run to calibrate between runs. In all samples, amplification of GUS reached the threshold within 30 cycles. Mutational analyses of LEF1 We performed mutational analyses of LEF1 exons 2 and 3, as the reported hotspot regions in T-ALL.22 Sufficient genomic DNA (gDNA) was available from 40 patients of the 282 patients’ cohort. Patients’ clinical and molecular characteristics were comparable with those from the total study population. gDNA was isolated from pretreatment BM samples using 5


Trizol reagent (Invitrogen, Karlsruhe, Germany) following the manufacturer’s instructions. DNA fragments spanning the entire LEF1 exons 2 and 3 were amplified by PCR using AmpliTaq Gold (Applied Biosystems, Foster City, CA, USA) and the following primers: exon

2

forward

5´-TTTTCTTTCTTTTGGGTGTGG,

exon

2

reverse

5´-

AAATTGCACCCCTTATCTGC; exon 3 forward 5´-AAAGGGAAGTCAGTGCATCATT, exon 3 reverse 5´-ACAAATCAATTTGCACTTCTGAAC. DNA sequencing was performed on purified PCR products. Statistical analyses Patients were grouped into quartiles according to LEF1 expression levels (Q1-4; each quartile containing 25% of patients) and divided into high LEF1 (Q4; n = 71) and low LEF1 (Q1-3; n = 211) based on the trend observed in clinical outcome after performing a Cox regression analysis for relapse-free survival (RFS) with LEF1 quartile grouping as the independent variable. In this model, patients in the highest LEF1 quartile showed a substantially different RFS compared to the remaining patients with lower LEF1 expression levels. The differences in regression coefficients with standard errors (SE) for each quartile were as follows: Q1 vs Q4: -0.61 (SE 0.44); P = 0.17, Q2 vs Q4: -1.3 (SE 0.60); P = 0.03, Q3 vs Q4: -1.0 (SE 0.50); P = 0.05. LEF1 expression ranged between 0-1.24 with the following median expression for each quartile: 0.02 (Q1), 0.08 (Q2), 0.19 (Q3), and 0.42 (Q4).

Remission was determined after completion of induction chemotherapy. CR was defined by a granulocyte count of at least 1.5/nl, a platelet count of at least 100/nl, the absence of PB blasts, a BM cellularity of at least 20% with maturation of all cell lines and less than 5% blasts, and the absence of extramedullary leukemia. Primary therapy failure was defined as persistence of PB blasts or more than 5% blasts in BM. Relapse was defined as reappearance of PB blasts, more than 5% blasts in BM, or appearance of extramedullary leukemia after achievement of CR. OS was measured from the beginning of therapy until date of death or last follow-up. RFS was determined from the date of first CR until relapse. Patients without reported relapse were censored by the end of follow-up. Patients with withdrawal in CR were censored at the respective dates. Patients who received SCT in CR1 were censored at the time of transplantation for RFS analyses. OS analyses were performed both with inclusion of SCT patients as well as with censoring of SCT patients at the time of transplantation. The median follow-up for all living patients was 42.6 months.

6


Survival curves were calculated by the Kaplan-Meier-method with the log-rank comparing differences between survival curves. Clinical features across groups were compared using the

χ2 or a two-sided Fisher’s exact test for categorical data and the nonparametric Mann-Whitney U test for continuous variables. A P value ≤ 0.05 (two-sided) was considered significant. Multivariate analyses were performed using the Cox proportional hazards model for survival and with logistic regression for the relapse rate, both with stepwise forward selection including the following variables in the full model: LEF1 expression (Q4 vs Q1-3), age (10year increase), WBC (10/nl increase), CD20 (positive vs negative), BCR-ABL (presence vs absence), MLL-AF4 (presence vs absence), and immunophenotype (pro-B vs common/pre-B). For OS analysis, also BAALC expression was integrated as continuous variable in the Cox model, since this marker was of prognostic relevance for OS, but not for RFS in B-precursor ALL.30 SPSS software package (version 18.0 for Windows; SPSS Inc., Chicago, IL, USA) was used for calculations.

Results LEF1 expression with respect to clinical and molecular characteristics We determined LEF1 mRNA expression in 282 patients with newly diagnosed B-precursor ALL. For statistical analyses, patients were divided into high and low LEF1 expression groups (Q4 vs Q1-3). High LEF1 expression was significantly associated with CD20 positivity (P = 0.009) and inversely associated with the expression of myeloid markers (P = 0.001; Table 1). No other significant correlations between LEF1 expression levels and clinical, molecular features, immunophenotypic subgroups or the GMALL risk groups were found (Table 1). Of note, there were not enough patient samples assayed for MRD to allow correlation of LEF1 expression and MRD. In the standard risk group, high LEF1 expression was again significantly associated with the absence of expression of myeloid markers (P = 0.01). No significant differences were observed regarding CD20 positivity or other patients’ characteristics and LEF1 expression. LEF1 expression and outcome in B-precursor ALL patients (overall cohort) Patients with high compared to low LEF1 expression showed no significant differences regarding achievement of CR or the frequency of primary refractory disease (Table 2). High LEF1 expression was significantly associated with a higher relapse rate (LEF1 high: 74%, LEF1 low: 49%; P = 0.03; Table 2). In multivariate analyses, LEF1 expression was the only predictive variable for the relapse rate in the overall cohort [odds ratio 3.4 (95% CI 1.2-9.4); 7


P = 0.02]. High LEF1 expressers showed a significantly inferior RFS as compared to low LEF1 expressers (5-year RFS: LEF1 high: 27%, LEF1 low: 47%; P = 0.05; Table 3; Figure 1A). Upon Cox regression analysis, LEF1 expression was not independently predictive for RFS in the overall cohort (Table 4). Patients with high LEF1 expression showed a trend towards an inferior OS (5-year OS: LEF1 high: 29%, LEF1 low: 47%; P = 0.06; Table 3) in the overall cohort of B-precursor ALL. No significant differences regarding deaths in induction therapy (P = 0.2) or deaths in CR (P = 0.3) were found between the two LEF1 groups (data not shown). LEF1 expression and survival in standard risk B-precursor ALL As identification of molecular markers is of particular importance for standard risk ALL patients, we evaluated the prognostic significance of LEF1 expression in the standard risk group as defined by GMALL (BCR-ABL- and MLL-AF4-negative patients with CR after first induction therapy and WBC ≤ 30/nl at initial diagnosis; n = 91). In this subgroup, patients with high LEF1 expression had a significantly inferior RFS as compared to low LEF1 expressers (5-year RFS: LEF1 high: 36%, LEF1 low: 57%; P = 0.02; Table 3; Figure 1B). In multivariate analyses, LEF1 expression was the only factor with prognostic significance for RFS (P = 0.02; Table 4). Like in the overall cohort, high LEF1 expression was associated with inferior OS without reaching statistical significance (5-year OS: LEF1 high: 53%, LEF1 low: 72%; P = 0.08; Table 3; Figure 2A). Cox regression analysis revealed a significant interaction between age and LEF1 expression [hazard ratio 1.2 (95% CI 1.0-1.5); P = 0.03], indicating that the impact of LEF1 expression on OS was most evident in standard risk patients older than 35 years. In this subgroup of standard risk patients over 35 years of age (n = 41), high LEF1 expression was significantly associated with inferior OS (5-year OS: LEF1 high: 27%, LEF1 low: 63%; P = 0.02; Table 3; Figure 2B). Moreover, LEF1 was the only significant factor for OS in this subgroup in multivariate models [hazard ratio 2.7 (95% CI 1.0-7.2); P = 0.02]. Data for OS refer to analyses done with censoring of SCT patients at the time of transplantation. However, similar results were obtained when patients who received allogeneic SCT in CR1 were not censored (data not shown). In the subgroups of high risk and very high risk ALL, LEF1 expression had no significant impact on outcome (data not shown).

8


Mutational analyses of LEF1 Inactivating LEF1 mutations as mechanism of LEF1 dysregulation have been reported in TALL.22 To evaluate the presence of LEF1 mutations in B-lineage ALL, we performed DNA sequencing of LEF1 in 40 B-precursor ALL patients. We restricted our analysis to exons 2 and 3, as mutations in T-ALL were found in these two exons of the LEF1 gene. In two patient samples we found a missense Asp85Asn single nucleotide polymorphism [SNP; rs61752607 (National Center for Biotechnology Information build 129/132)] in exon 2. No further mutations in exon 2 or exon 3 were detected. This may indicate that transcriptional activity of the LEF1 gene rather than truncating mutations of LEF1 play a role in B-precursor ALL.

Discussion The identification of prognostic markers in B-precursor ALL, particularly in standard risk patients, is important for the development of new molecular therapies and might also allow to improve risk-adapted treatment stratification for these patients.

In this study we have identified high LEF1 expression as an independent prognostic factor associated with a high risk of relapse and inferior RFS in adult standard risk B-precursor ALL patients. Standard risk patients with high LEF1 expression (Q4) had an about 2.5-fold shorter RFS as compared to standard risk patients with low LEF1 expression (Q1-3). The impact of LEF1 expression on OS was age-dependent and most pronounced in standard risk patients older than 35 years. In this small standard risk subgroup (n = 41), high LEF1 expression was independently predictive for inferior OS, with a 5-year survival rate of only 27% for high LEF1 expressers compared to 63% in the low LEF1 group. In addition, LEF1 expression was of stronger prognostic impact for OS than expression of BAALC, a gene we have previously demonstrated to be of prognostic significance in standard risk B-precursor ALL patients.30 In younger standard risk patients, the influence of LEF1 on OS was not statistically significant.

Interestingly, high LEF1 expression was inversely associated with expression of myeloid markers. This finding corresponds to the predominant role of LEF1 in lymphoid development, where LEF1 protein directly promotes cell cycle entry and proliferation of pro-B cells.13,31 We found no association between LEF1 expression and molecular genetic subgroups of Bprecursor ALL, suggesting that LEF1 was not activated by BCR-ABL or MLL-AF4. In contrast, induction of LEF1 by AML1-ETO and FLT3-ITD has been described in AML.9,32 9


Thus far, little is known about the impact of LEF1 expression on outcome of patients with acute leukemias or other malignancies. Gutierrez et al. analyzed microarray-based expression data of 40 pediatric T-ALL patients and found no association of clinical characteristics with high LEF1 expression levels, whereas in the same study T-ALL patients with inactivating LEF1 mutations showed a trend towards a favourable OS.22 Conversely in patients with myelodysplastic syndrome, advanced disease and poor prognosis were associated with downregulation of LEF1,33 probably reflecting the impaired maturation of myeloid progenitors associated with loss of LEF1 function.15 In leukemic cells, LEF1 enhanced selfrenewal properties and survival in vitro9,18 and was shown to confer leukemogenic potential in a mouse model.20 Our clinical findings underscore the pro-survival effect of LEF1 in acute leukemias, revealing an aggressive subtype of B-precursor ALL with inferior outcome associated with high LEF1 expression.

The optimal therapy management for standard risk patients, particularly the indication for allogeneic SCT in CR1, remains controversial.34-36 In the GMALL studies, post-remission therapy for standard risk patients is guided by determination of MRD.4,37 This approach intends to molecularly detect a poor response or upcoming relapse in order to start salvage therapy at an early time point, as outcome for ALL patients with full-blown hematological relapse is very poor.38 Pretreatment markers for standard risk ALL patients predicting a high relapse risk at the time of diagnosis might therefore add prognostic information to the subsequent MRD assessment. In this regard, determination of LEF1 expression could possibly facilitate to discriminate standard risk patients who might benefit from early treatment intensification including allogeneic SCT. However, future studies are needed to confirm the prognostic significance of LEF1 expression in the context of MRD.

Furthermore, patients with high LEF1 expression should be considered for new molecular directed therapies, especially agents targeting the Wnt pathway39 or demethylating drugs.12 Recently, two small molecules have been identified that specifically inhibit the LEF1/βcatenin complex and have shown promising in vitro efficacy in AML cell lines.6,39 Of note, most relapses in B-precursor ALL patients with high LEF1 expression occurred early within the first year of remission, underlining the importance of adapted first-line therapies for this particular high risk group. As Wnt signaling has been implicated in self-renewal of leukemic stem cells,40-42 early relapse of patients with LEF1 overexpression might reflect a survival 10


advantage of leukemic stem cells due to LEF1 expression. Thus, targeting the LEF1/β-catenin protein complex might overcome persistence of residual leukemic cells. Because inactivating mutations of LEF1 have previously been identified in pediatric T-ALL,22 we performed mutational analysis of the two hotspot regions, exons 2 and 3, in 40 Bprecursor ALL patients. In two patients we detected a missense SNP (rs61752607), that was also found in one of 44 T-ALL patients.22 However, due to the small patient number, the clinical relevance of this finding is not clear. We did not find any other SNPs or mutations in our cohort. In the study of Gutierrez et al., the frequency of LEF1 mutations was 7% (3/44), and array CGH revealed focal microdeletions in the LEF1 coding sequence in 11% of cases.22 In contrast in pediatric B-precursor ALL, the frequency of inactivating copy number alterations of the LEF1 gene was only 1.6%.43 Thus, compared to T-ALL, genomic lesions of LEF1 might not play a pathogenetic role in B-precursor ALL but rather transcriptional activation of LEF1 mRNA expression.

In recent years, several genetic and molecular markers with independent prognostic significance in adult B-precursor ALL have been identified, such as cytogenetics,44,45 high BAALC expression,30 or deletion of the IKAROS gene in BCR-ABL-positive ALL.46 This more and more detailed cytogenetic and molecular classification of adult ALL might help to better predict a patient’s individual treatment response and to develop targeted therapies for different subgroups of B-precursor ALL.

In conclusion, we have for the first time identified high LEF1 expression as an independent adverse prognostic factor in adult B-precursor ALL. Our data support a pathogenetic role of Wnt signaling in B-lineage ALL. Determination of LEF1 expression might contribute to riskassessment of standard risk B-precursor ALL patients.

Acknowledgements This study was supported by grants from the Deutsche Krebshilfe (Max Eder Nachwuchsförderung) to C.D.B.. The GMALL studies were supported by the Deutsche Krebshilfe and the Deutsche José Carreras Leukämiestiftung.

11


We thank the members of the GMALL study group for their support and the participating centers for enrolling patients and providing the clinical data for the study. A complete list of the members of the GMALL study group appears as a data supplement to the online version of this article.

Authorship Contribution: A.K.: performed research, analyzed data, and wrote the manuscript; N.G.: head of GMALL study center and reviewed the manuscript; M.K.: contributed to the analysis of this study; C.S.: performed laboratory work; A.S.: performed statistical analyses; T.B.: provided diagnostic molecular genetic data and reviewed the manuscript; L.H.M.: provided primers and reviewed the manuscript; D.H.: head of GMALL study group; E.T.: head of the central immunophenotyping and molecular genetic laboratory and reviewed the manuscript; C.D.B.: contributed to the design of the research, to the analysis of this study, and to the writing of this manuscript.

Conflict-of-interest disclosure: The authors declare no competing financial interests.

Correspondence: Claudia D. Baldus, M.D. Charité - Universitätsmedizin Berlin Campus Benjamin Franklin Hämatologie und Onkologie Hindenburgdamm 30 12203 Berlin, Germany Telephone:

+49-30-8445-2337

Fax:

+49-30-8445-4468

E-mail:

[email protected]

12


References 1.

Gökbuget N, Hoelzer D. Treatment of adult acute lymphoblastic leukemia. Semin Hematol. 2009;46(1):64-75.

2.

Rowe JM, Buck G, Burnett AK, et al. Induction therapy for adults with acute lymphoblastic leukemia: results of more than 1500 patients from the international ALL trial: MRC UKALL XII/ECOG E2993. Blood. 2005;106(12):3760-3767.

3.

Gökbuget N, Hoelzer D, Arnold R, et al. Treatment of Adult ALL according to protocols of the German Multicenter Study Group for Adult ALL (GMALL). Hematol Oncol Clin North Am. 2000;14(6):1307-1325, ix.

4.

Brüggemann M, Raff T, Flohr T, et al. Clinical significance of minimal residual disease quantification in adult patients with standard-risk acute lymphoblastic leukemia. Blood. 2006;107(3):1116-1123.

5.

Clevers H. Wnt/beta-catenin signaling in development and disease. Cell. 2006;127(3):469-480.

6.

Gehrke I, Gandhirajan RK, Kreuzer KA. Targeting the WNT/beta-catenin/TCF/LEF1 axis in solid and haematological cancers: Multiplicity of therapeutic options. Eur J Cancer. 2009;45(16):2759-2767.

7.

Van Den Berg DJ, Sharma AK, Bruno E, Hoffman R. Role of members of the Wnt gene family in human hematopoiesis. Blood. 1998;92(9):3189-3202.

8.

Jamieson CH, Ailles LE, Dylla SJ, et al. Granulocyte-macrophage progenitors as candidate leukemic stem cells in blast-crisis CML. N Engl J Med. 2004;351(7):657-667.

9.

Müller-Tidow C, Steffen B, Cauvet T, et al. Translocation products in acute myeloid leukemia activate the Wnt signaling pathway in hematopoietic cells. Mol Cell Biol. 2004;24(7):2890-2904.

10.

Khan NI, Bradstock KF, Bendall LJ. Activation of Wnt/beta-catenin pathway mediates growth and survival in B-cell progenitor acute lymphoblastic leukaemia. Br J Haematol. 2007;138(3):338-348.

11.

Lu D, Zhao Y, Tawatao R, et al. Activation of the Wnt signaling pathway in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A. 2004;101(9):3118-3123.

12.

Roman-Gomez J, Cordeu L, Agirre X, et al. Epigenetic regulation of Wnt-signaling pathway in acute lymphoblastic leukemia. Blood. 2007;109(8):3462-3469.

13.

Reya T, O'Riordan M, Okamura R, et al. Wnt signaling regulates B lymphocyte proliferation through a LEF-1 dependent mechanism. Immunity. 2000;13(1):15-24.

14.

Okamura RM, Sigvardsson M, Galceran J, Verbeek S, Clevers H, Grosschedl R. Redundant regulation of T cell differentiation and TCRalpha gene expression by the transcription factors LEF-1 and TCF-1. Immunity. 1998;8(1):11-20.

15.

Skokowa J, Cario G, Uenalan M, et al. LEF-1 is crucial for neutrophil granulocytopoiesis and its expression is severely reduced in congenital neutropenia. Nat Med. 2006;12(10):1191-1197.

16.

Gelebart P, Anand M, Armanious H, et al. Constitutive activation of the Wnt canonical pathway in mantle cell lymphoma. Blood. 2008;112(13):5171-5179.

17.

Spaulding C, Reschly EJ, Zagort DE, et al. Notch1 co-opts lymphoid enhancer factor 1 for survival of murine T-cell lymphomas. Blood. 2007;110(7):2650-2658.

18.

Gutierrez A, Jr., Tschumper RC, Wu X, et al. LEF-1 is a prosurvival factor in chronic lymphocytic leukemia and is expressed in the preleukemic state of monoclonal B-cell lymphocytosis. Blood. 2010;116(16):2975-2983.

19.

Simon M, Grandage VL, Linch DC, Khwaja A. Constitutive activation of the Wnt/beta-catenin signalling pathway in acute myeloid leukaemia. Oncogene. 2005;24(14):2410-2420.

20.

Petropoulos K, Arseni N, Schessl C, et al. A novel role for Lef-1, a central transcription mediator of Wnt signaling, in leukemogenesis. J Exp Med. 2008;205(3):515-522.

13


21.

Wang W, Ji P, Steffen B, et al. Alterations of lymphoid enhancer factor-1 isoform expression in solid tumors and acute leukemias. Acta Biochim Biophys Sin (Shanghai). 2005;37(3):173-180.

22.

Gutierrez A, Sanda T, Ma W, et al. Inactivation of LEF1 in T-cell acute lymphoblastic leukemia. Blood. 2010;115(14):2845-2851.

23.

Gökbuget N, Raff R, Brüggemann M, et al. Risk/MRD adapted GMALL trials in adult ALL. Ann Hematol. 2004;83 Suppl 1:S129-131.

24.

Gökbuget N, Baur K-H, Beck J, et al. Dexamethasone dose and schedule significantly influences remission rate and toxicity of induction therapy in adult acute lymphoblastic leukemia (ALL): results of the GMALL pilot trial 06/99 [abstract]. Blood. 2005;106: Abstract 1832.

25.

Gökbuget N, Arnold R, Böhme A, et al. Improved Outcome in high risk and very high risk ALL by risk adapted SCT and in standard risk ALL by intensive chemotherapy in 713 adult ALL patients treated according to the prospective GMALL study 07/2003 [abstract]. Blood. 2007;110: Abstract 12.

26.

European Leukemia Net. European Leukemia Trial Registry.http://www.leukemianet.org/content/leukemias/aml/aml_trials/database/. Accessed April 24, 2011.

27.

Schwartz S, Rieder H, Schläger B, Burmeister T, Fischer L, Thiel E. Expression of the human homologue of rat NG2 in adult acute lymphoblastic leukemia: close association with MLL rearrangement and a CD10(-)/CD24(-)/CD65s(+)/CD15(+) B-cell phenotype. Leukemia. 2003;17(8):1589-1595.

28.

Burmeister T, Schwartz S, Taubald A, et al. Atypical BCR-ABL mRNA transcripts in adult acute lymphoblastic leukemia. Haematologica. 2007;92(12):1699-1702.

29.

Ludwig WD, Rieder H, Bartram CR, et al. Immunophenotypic and genotypic features, clinical characteristics, and treatment outcome of adult pro-B acute lymphoblastic leukemia: results of the German multicenter trials GMALL 03/87 and 04/89. Blood. 1998;92(6):1898-1909.

30.

Kühnl A, Gökbuget N, Stroux A, et al. High BAALC expression predicts chemoresistance in adult Bprecursor acute lymphoblastic leukemia. Blood. 2010;115(18):3737-3744.

31.

Reya T, Clevers H. Wnt signalling in stem cells and cancer. Nature. 2005;434(7035):843-850.

32.

Tickenbrock L, Schwable J, Wiedehage M, et al. Flt3 tandem duplication mutations cooperate with Wnt signaling in leukemic signal transduction. Blood. 2005;105(9):3699-3706.

33.

Pellagatti A, Marafioti T, Paterson JC, et al. Marked downregulation of the granulopoiesis regulator LEF1 is associated with disease progression in the myelodysplastic syndromes. Br J Haematol. 2009;146(1):86-90.

34.

Hahn T, Wall D, Camitta B, et al. The role of cytotoxic therapy with hematopoietic stem cell transplantation in the therapy of acute lymphoblastic leukemia in adults: an evidence-based review. Biol Blood Marrow Transplant. 2006;12(1):1-30.

35.

Larson R. Allogeneic hematopoietic cell transplantation for adults with ALL. Bone Marrow Transplant. 2008;42 Suppl 1:S18-24.

36.

Goldstone AH, Richards SM, Lazarus HM, et al. In adults with standard-risk acute lymphoblastic leukemia, the greatest benefit is achieved from a matched sibling allogeneic transplantation in first complete remission, and an autologous transplantation is less effective than conventional consolidation/maintenance chemotherapy in all patients: final results of the International ALL Trial (MRC UKALL XII/ECOG E2993). Blood. 2008;111(4):1827-1833.

37.

Raff T, Gökbuget N, Lüschen S, et al. Molecular relapse in adult standard-risk ALL patients detected by prospective MRD monitoring during and after maintenance treatment: data from the GMALL 06/99 and 07/03 trials. Blood. 2007;109(3):910-915.

38.

Fielding AK, Richards SM, Chopra R, et al. Outcome of 609 adults after relapse of acute lymphoblastic leukemia (ALL); an MRC UKALL12/ECOG 2993 study. Blood. 2007;109(3):944-950.

39.

Minke KS, Staib P, Puetter A, et al. Small molecule inhibitors of WNT signaling effectively induce apoptosis in acute myeloid leukemia cells. Eur J Haematol. 2009;82(3):165-175.

14


40.

Yeung J, Esposito MT, Gandillet A, et al. beta-Catenin mediates the establishment and drug resistance of MLL leukemic stem cells. Cancer Cell;18(6):606-618.

41.

Wang Y, Krivtsov AV, Sinha AU, et al. The Wnt/beta-catenin pathway is required for the development of leukemia stem cells in AML. Science. 2010;327(5973):1650-1653.

42.

Zhao C, Blum J, Chen A, et al. Loss of beta-catenin impairs the renewal of normal and CML stem cells in vivo. Cancer Cell. 2007;12(6):528-541.

43.

Mullighan CG, Goorha S, Radtke I, et al. Genome-wide analysis of genetic alterations in acute lymphoblastic leukaemia. Nature. 2007;446(7237):758-764.

44.

Moorman AV, Harrison CJ, Buck GA, et al. Karyotype is an independent prognostic factor in adult acute lymphoblastic leukemia (ALL): analysis of cytogenetic data from patients treated on the Medical Research Council (MRC) UKALLXII/Eastern Cooperative Oncology Group (ECOG) 2993 trial. Blood. 2007;109(8):3189-3197.

45.

Pullarkat V, Slovak ML, Kopecky KJ, Forman SJ, Appelbaum FR. Impact of cytogenetics on the outcome of adult acute lymphoblastic leukemia: results of Southwest Oncology Group 9400 study. Blood. 2008;111(5):2563-2572.

46.

Martinelli G, Iacobucci I, Storlazzi CT, et al. IKZF1 (Ikaros) deletions in BCR-ABL1-positive acute lymphoblastic leukemia are associated with short disease-free survival and high rate of cumulative incidence of relapse: a GIMEMA AL WP report. J Clin Oncol. 2009;27(31):5202-5207.

15


Table 1. Clinical and molecular features with respect to LEF1 expression in B-precursor ALL (overall cohort) LEF1 low

LEF1 high

n = 211

n = 71

37 15-64

39 16-65

50

56

15

14

0.8-594

0.5-581

37

38

8/156 (5)

2/52 (4)

BCR-ABL pos., no. (%)

82 (39)

35 (49)

0.13

MLL-AF4, pos., no. (%)

21 (10)

2 (3)

0.08

Characteristic

P 0.39

Age, y Median Range Sex, %

0.34

Male WBC, x 109/L*

0.58

Median Range 9

More than 30 x 10 /L, % CNS involvement, no. (%) Yes/total

0.89 1.0

Molecular genetics

BAALC, high %†

54

39

0.54

CD34 pos., %

76

75

0.87

CD20 pos., %

30

48

0.009

Myeloid markers, %‡

48

27

0.001

Immunophenotypic subtype, no. (%)

0.20§

Common ALL

138 (66)

45 (63)

Pre-B ALL

45 (21)

21 (30)

Pro-B ALL

28 (13)

5 (7)

GMALL risk groups, %§

0.25II

Standard risk

70/210 (33)

21/70 (30)

0.77

High risk

59/210 (28)

14/70 (20)

0.43

Very high risk

82/210 (39)

35/70 (50)

0.33

37

36

1.0

Allogeneic SCT in CR1, %

WBC indicates white blood cell; and CNS, central nervous system. *N = 268. †Above median expression level. ‡Coexpression of CD13, CD33, CD65s or CD15. §N=280. IIOverall P value for the frequency of the three immunophenotypes/risk groups across the LEF1 expression groups.

16


Table 2. Clinical response according to LEF1 expression (overall cohort) Clinical Outcome

LEF1 low

LEF1 high

P

173/199 (87)

57/68 (84)

0.54

16/189 (9)

4/61 (7)

0.79

41/84 (49)

20/27 (74)

0.03

Complete remission rate CR/total, no. (%)* Refractory disease Refractory/total, no. (%)† Relapse rate Relapse/total, no. (%)‡

CI indicates confidence interval. *N = 267. For 15 patients no remission status was available. †N = 250. 17 patients who died during induction therapy were excluded. ‡N = 111. Patients who received SCT in CR1 were excluded for evaluation of the relapse rate.

Table 3. Long-term survival with respect to LEF1 expression Clinical Outcome

LEF1 low

LEF1 high

P

Relapse-free survival, relapse-free at 5 y, % (95% CI) Overall cohort*

47 (35-59)

27 (8-47)

0.05

Standard risk†

57 (43-71)

36 (12-61)

0.02

Overall cohort‡

47 (38-56)

29 (14-44)

0.06

Standard risk§

72 (60-84)

53 (29-77)

0.08

Standard risk, age > 35 yII

63 (44-82)

27 (12-42)

0.02

Overall survival, alive at 5 y, % (95% CI)

CI indicates confidence interval. Patients who received SCT in CR1 were censored at the time of transplantation. *N = 230. †N = 85. ‡N = 282. §N = 91. IIN = 41.

17


Table 4. Multivariate analyses for relapse-free survival

HR

95% CI

P

WBC

1.1

1.0-1.1

0.02

Age

1.4

1.2-1.6