Fig. S1. Randomized block design (RBD) of field trial.

Recommend Documents

The progression pattern of male hyrax songs and the role of climactic ending ... 4. 6. 8. 10. 12. 14. 16. MON1. Num ber of vocal elem ents. â« Wail. â« Chuck. â« Snort ...

S1 Fig

Indicator. N. Odds ratio [95%CI]. Recommended prescribing. Intensify GLD. 56 ... Medication burden. MRCI. 1035 ... MRCI: medication regimen complexity index.

Fig. S1

Mycale (Mycale) lingua. Phakellia bowerbanki. Polymastia hemisphaerica. Forcepia (Forcepia) forcipula lophon cf. piceum. Polymastia cf. uberrima. Weberella ...

Fig. S1

B8-B9. A8-A9 C9-C10. Core Breaks. M. /G. H o le. B. 5. 8 .0. 6 m. 1. 0. 4. G. 2. G .... 1,03. 41. 162-982-A-7H-3, 0. 58,70. 2,44. 3,08. 0,86. 42. 162-982-B-7H-6, 40.

Fig. S1

Sep 13, 2012 ... Platyhelminthes: Proseriata. Pseudomonocelis Monocelis lineate. Pse. 18S. 31. 9 . 2. 4. 3. 5. N/A. 1. 0.010. 0.06. G. Rotifera: Bdelloidea. Rotaria.

Fig S1

8.6e-4. Free Ca+2 [mM] ns. Figure S1. A: Scheme of the micro-fluidic device used ... a representative experiment out of two is shown with its standard deviation.

S1 Fig

Potosia angustata. (063PA_GR). Potosia cuprina. (076CU_TR). 1/3. 3/1. 4/0. 5/0. 4/1. 5/0. 6/4. 6/0. 710. 8/0. 9/2. 10/0. 11/3. 12/3. 15/0. 16/0. 8/3. 9/3. 10/3. 11/3.

S1 Fig

Oct 4, 2018 - Dec-14 34. 23. 5. 38. 5. 10. 7. 7. 4. 4. Table 2. Comparison Sp. for Table 2. Month Sp. J Sp. K Sp. L Sp. M Sp. N Sp. O. Jan-04 35 2 14 0 25 55.

Fig. S1

5! sequence. 502 bp. 515 bp. 3! sequence. porA promoter. CmR. FAM20 genome. DUS. 842 bp. 1649 bp. pDONR P4-P1R 5-porA-pro. pDONR P2R-P3 CmR-3.

S1 Fig

GCTGAATGTC AAAAGGGAAG TGAGGTCCCTGGGTGAGTAA GGGACGTGCA ... +1. CCCACAGCCC CCGGCAGATG CATGGGGAGG TGGGGCTGTC CTTGGCCCCC ... CGGCTGCTCC AGATCCCCGG GAGACGATGG GGGTTTTCCA ...

Fig S1

f1: R1=H, R2=rha, R3=rha f2: R1=H, R2=glc, R3=rha f3: R1=H, R2=rha(1â2)glc, R3=rha f4: R1=H, R2=glc(1â6)glc, R3=rha f5: R1=OH, R2=rha, R3=rha.

Rationale and Design of Randomized Clinical Trial

Oct 5, 2016 - ignacio Michel, Joaquin de haro, silvia Bleda, ilsem V. laime, Jhenifer ..... Medina Maldonado F, de Haro Miralles J, Martinez Aguilar E, Florez ...

Supplement S1. Fig. S1-S12, Tables S1-S3 Fig. S1. Map of ... - TSpace

3445. 1137. 41. Fagus. Fagus sylvatica. 27 022. 6869. 20 153. 4128. 126. Fraxinus. Fraxinus excelsior. 7875. 159. 7716. 1757. 80. Larix. Larix decidua. 1169. 0.

Randomized comparative trial of cervical block protocols for pain ...

2015 Lukes et al. This work is published by Dove Medical Press Limited, and licensed under Creative Commons Attribution â Non Commercial (unported, v3.0).

Randomized complete block design with three ...

Randomized complete block design with three treatments and three replications. Treatment 1 (M+N): 6t/ha poultry manure plus 150 kg/ha N fertilizer; Treatment ...

Fig. S1

(CFTR/MRP), member 3. 1.1527. 0.73. 1.1234. 0.71. 1.8241. 0.34. NM_005845. ABCC4. ATP-binding cassette, sub-family C. (CFTR/MRP), member 4. -1.0153.

Fig S1 LasA 23Feb.pptx

Supplementary Figure 1. Accumulation of anthocyanins in response to exogenous treatment with JA, LasA or COR.! Wild-type (Col-0) mutant seedlings (N ...

fig S1.tif - PLOS

Ü© Ü¤ ÜÜ¢ Ü Ü Ü Ü Ü¢ Ü Ü. 0 0.01 0. 1 1 5 10. mBCD (MM). UU. T. 1.2 cell viability (arb. units) . : : : : 0.6. 0.4. 0.2. b.g. 0 0.01 0. 1 1 5 10. mBCD (mm)

S1 Fig. - PLOS

A Gorilla gorilla gorilla (233). A Pan paniscus (242). - A Pongo abeli (230). âA Nomascus leucogenys (224). - A Chlorocebus sabaeus (226). âA Macaca ...

S1 Fig. - PLOS

V. harveyi Luxo. AMRHGSQOFLIKPCEADRLAVfVNNAIRKAtKIK--- NEaDNPgNQNYGGFIGSSQTMQQVYRTIDSAASSKASIFITGESGTGKEVCAEAIHAASKRG.

Fig. S1

Insm1 flox/lacZ. Insm1 flox/+; RIPCreER Insm1 flox/lacZ; RIPCreER min. B. 0. 50. 100. 150. 0.0. 0.2. 0.4. 0.6. 0.8. 1.0. )l m/ g n( nil u s. nI. Glucose stimulated.

Fig. S1. - ScienceCentral

-4.21. Hey1. -3.67. -3.64. Lrp4. -3.59. -6.53. Sulf2. -2.88. -2.19. Ncam1. -2.82. -17.57. Nfatc4. -2.56. -3.11. Pparg. 3.23. 2.52. Signaling. Itga11. -6.00. -4.26. Cthrc1.

Fig. S1

r217I. rMga. rDs. rDb. r104V. r104I. 15: 8-13 m. r104V. r104I. 25: 3 m. 2. 5. 10. 20. 30. r217I. rMga. rDs. rDb. r104V. r104I. r104V. r104I. 8: 2-5 m. 21: 2-6 m. r104I.

Fig S1 GnfM_align_motif - CiteSeerX

Figure S3. GnfR. .... encoding a putative radical SAM domain protein and a ... Table S3. Conservation of EBPs in Geobacter species. Presence and absence of ...