Figure S1. DNA sequence chromatograms of wt or mutant ... - MDPI
Recommend Documents
ÎC4;4;4S-ol, ÎC6;6;6S-ol, C6;4;0S-ol and ÎC4;2,6;6S-ol] ... Figure S6: [MS2 of [M + Na]+ (m/z 556.2) for derivatized unreduced disaccharide standards] ....10 ...
Sequence alignment between the four PIIIA binding domains of the varied NaV subtypes. Loops with low sequence identify as well as the voltage sensing ...
K. J. Beumer et al. 6 SI. WT sequence. TTGGATATCACCCGGAAACGAATCCCAATGCTCGCACCTATAGCTACTACACGAATGGC.
Peaks without numbers were contaminations. n = 6. 6.00. 8.00. 10.00. 12.00. 14.00. 16.00. 18.00. 20.00. 100.000. 200.000. 300.000. 400.000. 500.000. 600.000.
Supplementary Figure S1. Expression of a mutant Ezrin resistant to siRNA for WT Ezrin reverses the morphological change induced by depletion of Ezrin.
Absolute numbers (left) and Vα composition (right) of CD45.1+ WT or ... CD45.1+CD45.2+ WT recipients after cotransfer in equal numbers and FV infection.
SLCO4A1. PRDM16. ADRB2. ELOVL3. DIO2. PGC1ACPT1B. 0. 5. 10. 15. Re la tive m. RNA. E xp re ssio n vehicle. Rosi. GQ-16 average ± SEM; *p
Md Shakir Hussain Haider, Wajihul Hasan Khan, Farah Deeba, Sher Ali, Anwar Ahmed, Irshad H Naqvi, Ravins Dohare,. Hytham A. Alsenaidy, Abdulrahman M.
K3,8,10,14R, the four lysines at K3, 8, 10, and 14 of endogenous Htz1 were mutated to ... Data are the average of at least three independent experiments ± SD.
Supplemental Fig S1: 127bp homozygous (or hemizygous) dele on affec ng TP53 exon 4 in the MCAS mucinous carcinoma cell line. This muta on was apparent ...
Supplementary Figure S1 â MEFs WT were grown in T-25 flasks and, where indicated, media was replaced with DMEM - FBS 0.1% for 12 hours to induce the ...
4KO+Tg. WT. 4KO. Figure S1. D. Bbs4. Tub merged. WT. GFP merged. L. AP-BBS4. T g. Bbs1. Bbs2. Bbs7. LAP-. BBS4. IP: G. F. P. LAP-BBS4. Bbs4 +/+ -/- +/- -/-.
Pop500m-1km Population between 500m and 1km from HCF 5 ... 3 Population Services International, Scaling Up Point-of-Use Water Treatment in Rwanda.
genetic clades (isolates from the Queen Elizabeth National Park (QENP) and âunusualâ sequences from East Africa. (uEA)). The evolutionary history based on ...
injection in Freund's adjuvant, with a total of three times of immunization with a time interval of two weeks. Upon collecting the anti-X protein polyclonal serum,.
RIPC by 4 cycles of 5min arm ischemia/5 min reperfusion (n=19) and sham (n=21) procedure, after connection to cardiopulmonary bypass (CPB), at the end of ...
Glycosylation âhotspotâ clusters among human H1N1 hemagglutinin (HA) sequences. 2. The probability of glycosylation for each hotspot cluster was calculated ...
Figure S1. Phylogenetic relationship between Azospirillum strains. A 16S rRNA maximum likelihood tree was constructed using the following sequences ...
SUPPLEMENTAL FIGURE LEGENDS. Figure S1. Mmp2 and Mmp9 are expressed in discrete populations within hemogenic regions. Related to Figure 1.
progressive allograft vasculopathy; (b) representative photomicrographs of elastin van Gieson stained paraffin sections depicting typical fibroproliferative arterial ...
Chryssa Kanellopoulou, Timothy Gilpatrick, Gokhul Kilaru, Patrick Burr, Cuong K. Nguyen, Aaron Morawski, Michael J. Lenardo, and Stefan A. Muljo ...
Quantibody arrays using Genepix Pro software. .... PBS and serum-free MesenCult® XF media (Stem Cell Technologies) was added, stimulated with 10 ng/ml TNF-α ..... Lee, R.H., Pulin, A.A., Seo, M.J., Kota, D.J., Ylostalo, J., Larson, B.L., ...
Figure S1. DNA sequence chromatograms of wt or mutant ... - MDPI
Figure S1. DNA sequence chromatograms of wt or mutant viruses. To verify the mutations introduced in to the genomes as well as to detect possible revertants ...
Figure S1. DNA sequence chromatograms of wt or mutant viruses. To verify the mutations introduced in to the genomes as well as to detect possible revertants we isolated DNA from virus preparations and performed sanger sequencing reaction by using The BigDye® Terminator v3.1 Cycle Sequencing Kit's robust (Thermofisher). The primers used were selected to amplify terminal part of MPyV VP2 gene (VP2 gene has 960 nucleotides). The nucleotides 929 to 952 are displayed in the figure. The introduced mutations are underlined.
Figure S2. Nuclear assembly of the Mutant 2 virus and the wt virus. Electron microscopy of ultrathin sections of 3T6 transfected with Mutant 2 genomes cells (A-C) or wt genomes (D, E) or infected with wt virus (F, G). Cells were fixed and processed after 48 h. Cy, cytoplasm; Nu, nucleus.
Table S1. Comparison of NLS signals strength in members of Polyomavirus family. Sequences of VP2 and VP1 proteins of the different members of polyomavirus were analyzed by NucPred Program available online [35]. proteins with score between 0.10 and 1 are predicted to spend some time in the nucleus. The higher score most likely indicates that the protein is located at the nucleus.
