Correlation between mechanical strength of messenger RNA pseudoknots and ribosomal frameshifting Thomas M. Hansen, S. Nader S. Reihani, Lene B. Oddershede, and Michael A. Sørensen PNAS published online Mar 27, 2007; doi:10.1073/pnas.0608668104 This information is current as of March 2007. Supplementary Material
Supplementary material can be found at: www.pnas.org/cgi/content/full/0608668104/DC1 This article has been cited by other articles: www.pnas.org#otherarticles
E-mail Alerts
Receive free email alerts when new articles cite this article - sign up in the box at the top right corner of the article or click here.
Rights & Permissions
To reproduce this article in part (figures, tables) or in entirety, see: www.pnas.org/misc/rightperm.shtml
Reprints
To order reprints, see: www.pnas.org/misc/reprints.shtml
Notes:
Correlation between mechanical strength of messenger RNA pseudoknots and ribosomal frameshifting Thomas M. Hansen*†‡, S. Nader S. Reihani†§, Lene B. Oddershede†, and Michael A. Sørensen* *Department of Molecular Biology, University of Copenhagen, Ole Maaløesvej 5, DK-2200 Copenhagen N, Denmark; †Niels Bohr Insitute, University of Copenhagen, Blegdamsvej 17, DK-2100 Copenhagen, Denmark; and §Institute for Advanced Studies in Basic Sciences, P.O. Box 45195-1159, Zanjan, Iran Edited by Peter B. Moore, Yale University, New Haven, CT, and approved February 13, 2007 (received for review September 30, 2006)
Programmed ribosomal frameshifting is often used by viral pathogens including HIV. Slippery sequences present in some mRNAs cause the ribosome to shift reading frame. The resulting protein is thus encoded by one reading frame upstream from the slippery sequence and by another reading frame downstream from the slippery sequence. Although the mechanism is not well understood, frameshifting is known to be stimulated by an mRNA structure such as a pseudoknot. Here, we show that the efficiency of frameshifting relates to the mechanical strength of the pseudoknot. Two pseudoknots derived from the Infectious Bronchitis Virus were used, differing by one base pair in the first stem. In Escherichia coli, these two pseudoknots caused frameshifting frequencies that differed by a factor of two. We used optical tweezers to unfold the pseudoknots. The pseudoknot giving rise to the highest degree of frameshifting required a nearly 2-fold larger unfolding force than the other. The observed energy difference cannot be accounted for by any existing model. We propose that the degree of ribosomal frameshifting is related to the mechanical strength of RNA pseudoknots. Our observations support the ‘‘9 Å model’’ that predicts some physical barrier is needed to force the ribosome into the ⴚ1 frame. Also, our findings support the recent observation made by cryoelectron microscopy that mechanical interaction between a ribosome and a pseudoknot causes a deformation of the A-site tRNA. The result has implications for the understanding of genetic regulation, reading frame maintenance, tRNA movement, and unwinding of mRNA secondary structures by ribosomes. macromolecular mechanics 兩 optical tweezers 兩 protein synthesis 兩 single molecules 兩 translation
W
hen an mRNA sequence is translated into protein by the ribosome, the nucleotide sequence is read in codons of three nucleotides and hence the mRNA in principle has three reading frames. In the vast majority of mRNAs, only one reading frame, defined by the initiation codon, is exploited and translated into protein. The elongation phase of protein synthesis is a precise process and intrinsic mechanisms exist in the ribosome to enhance translational fidelity (1, 2). The frequency of frameshift errors has been estimated to ⬍3 ⫻ 10⫺5 (3, 4). However, many examples of naturally occurring and highly efficient programmed frameshift sites have been described (5, 6). There is considerable interest in how ribosomal frameshift occurs, as this may provide insight into mechanisms behind reading frame maintenance, tRNA movement, and unwinding of mRNA secondary structures by ribosomes. Typically, a ⫺1 frameshift site comprises two elements, a slippery sequence, X XXY YYZ, where the frameshifting occurs, and additionally, a stimulatory RNA element positioned downstream in the mRNA (7). Frameshifting is thought to happen by dual tRNA slippage. In the original zero reading frame, the P-site tRNA and the A-site tRNA pair to codons XXY and YYZ, respectively, whereas after the shift to the ⫺1 frame they pair to XXX and YYY. At the new 5830 –5835 兩 PNAS 兩 April 3, 2007 兩 vol. 104 兩 no. 14
position, the tRNAs remain paired to mRNA at the two most upstream XX and YY nucleotides in each codon. Examples of stimulatory elements include downstream self pairing mRNA sequences called mRNA pseudoknots (Fig. 1). The requirement for these elements to function is a placement at a proper distance from the slippery sequence. In many viral frameshift sites, the stimulatory element is a pseudoknot positioned 6–9 nt downstream of the slippery sequence. The mechanism of frameshift stimulation by pseudoknots is not well understood. Involvement of protein factors binding to the mRNA seems unlikely because, in a competition experiment, addition of excess RNA pseudoknots did not affect frameshift efficiencies (8). Furthermore, that many pseudoknot-stimulated programmed frameshifts function in heterologous organisms from different kingdoms of life makes it unlikely that the function requires transacting factors. It has been suggested that the stimulatory structure pauses the ribosome while the slippery sequence is positioned in the decoding site of the ribosome, thus increasing the chance of tRNA slippage (9). However, the data from measurements of ribosomal pausing with pseudoknots, mutated pseudoknots, and related stem-loops support the view that pausing alone cannot mediate frameshifting and that additional events are required (10, 11). The programmed frameshift in infectious bronchitis virus (IBV) has been investigated, and it was found that pseudoknots, but not similar stem-loop structures, stimulate efficient frameshifting (10). As shown in Fig. 1c, a pseudoknot can be viewed as a stem-loop where nucleotides in the loop form a second stem with downstream mRNA. This may lock or decrease the rotational freedom of the first stem, and hence induce supercoiling while the ribosome unfolds the first stem. Experimental data support a role for torsional restraint in positioning the ribosome to pause with the slippery sequence in the A- and P-site when unfolding pseudoknots (12). This model makes it clear that an optimal spacing of 6–9 nt between slippery sequence and pseudoknot is crucial and positions the pseudoknot close to the entrance of the mRNA tunnel of the ribosome. Recently, the ‘‘9 Å model’’ was suggested for the mechanism of frameshift stimulation (13). Structural studies have revealed a 9-Å movement by the anti-codon loop of the aminoacyl-tRNA between the state of initial binding and the fully accommodated Author contributions: T.M.H., S.N.S.R., L.B.O., and M.A.S. designed research; T.M.H. performed research; T.M.H. and S.N.S.R. analyzed data; T.M.H., L.B.O., and M.A.S. wrote the paper; and S.N.S.R. wrote software. The authors declare no conflict of interest. This article is a PNAS Direct Submission. Freely available online through the PNAS open access option. Abbreviation: IBV, infectious bronchitis virus. ‡To
whom correspondence should be addressed. E-mail:
[email protected].
This article contains supporting information online at www.pnas.org/cgi/content/full/ 0608668104/DC1. © 2007 by The National Academy of Sciences of the USA
www.pnas.org兾cgi兾doi兾10.1073兾pnas.0608668104
pTH400: AGCUUUUUAAAGCAGUAAGCGCGCGCACGAGCGUCGGUGCGCGCGCAG CUAGUGGAUGUGAUCCUGAUGUUGUAAAGCGACGCUUGGGCC
the two different pseudoknots and for a control RNA. From the unfolding mechanics, the energetics of the process are considered. Finally, we show how the rates of frameshifting for the two investigated pseudoknots correlate with the mechanical stability of the pseudoknots.
pTH401:
Results
AGCUUUUUAAAGCAGUAAGCGCGCGCACGGAGCGUCGCGUGCGCGCGC
Description of Frameshift Sites. In this work, we investigated an
AAGCUAGUGGAUGUGAUCCUGAUGUUGUAAAGCGACGCUUGGGCC pTH421: AGCUUUUUAAAGCAGUAAGCGCGGGCC
b
PK400: 31 nt
c
Loop2
Stem1
Stem2 Loop1
Loop2 Stem2 32 nt CGCGCGCGUGC GCUGCG 5‘ AGCUUUUUAAAGCAGUAA GCGCGCGCACG CGACGCUUGGGCC 3‘ Stem1 G A Loop1 PK400: ∆
PA
........... ......
Fig. 1. Pseudoknots and frameshift sites. (a) Sequences of frameshift sites encoded in plasmids pTH400, pTH401, and pTH421. The slippery sequence is underlined, and the stop codon UAA is marked by a black ‘‘stop sign.’’ pTH400 and pTH401 encode the pseudoknots PK400 and PK401. The nucleotides that can form double-stranded stems are underlined by arrows. Stem1 is indicated by black arrows, and stem2 is indicated by gray arrows. The three nucleotides present only in PK401 are in bold. (b) Schematic drawing of an mRNA where the ribosome is positioned with the slippery sequence in its A and P sites. The secondary structure of PK401 is indicated with coaxially stacked stems and single-stranded loops. Differences from PK400 are indicated by arrows. (c) A schematic drawing of a pseudoknot.
position (reviewed in ref. 14). It is expected that the codon::anti-codon bound mRNA is pulled a similar distance further into the ribosome (13). The authors suggested that a downstream mRNA pseudoknot would provide resistance to this movement by becoming wedged into the entrance of the ribosomal mRNA tunnel. These two opposing forces result in the creation of a local region of tension in the mRNA between the A-site codon and the mRNA pseudoknot. The tension can be relieved by one of two mechanisms: unwinding of the pseudoknot, allowing the ribosome to move forward, or slippage of the proximal region of the mRNA backwards by one base. Even if it slips backwards one base, then still, afterward, it will have to unwind the pseudoknot to move forward. In this model, the stability of pseudoknots should play an important role in stimulation of frameshift. Of course, one crucial question is how ‘‘stability’’ is defined. A correlation has not been found between the frequency of frameshifting and the difference in Gibbs free energy between folded and unfolded pseudoknots measured from UV optical melting profiles (15). When the pseudoknot is opened by a ribosome, the action might not be thermodynamically reversible i.e., the work performed by the ribosome might be larger than ⌬G, and some fraction of the work might be dissipated irreversibly. In an attempt to simulate the action of a ribosome, we mechanically unfold the pseudoknot using optical tweezers. By applying a load on the structure, it is forced to unfold. This type of experiment is similar to previous studies on RNA hairpin folding (16, 17). The pseudoknots are unfolded at a nonzero force-loading rate and, hence, in general, do not unfold or refold through an equilibrium process. Here, we first determine the degree of frameshift stimulation effected by two pseudoknots, then focus on the mechanical unfolding and refolding events for Hansen et al.
artificial site of programmed ribosomal frameshift resembling that of IBV, which have been studied extensively by Brierley and coworkers (10, 18–20). As a typical natural ⫺1 frameshift site, our site includes a slippery sequence and a stimulatory element, which in this case is a 3⬘ pseudoknot (Fig. 1). The slippery sequence we used was UUUAAAG rather than UUUAAAC found in IBV, because XXXAAAG is found to be a more efficient slippery sequence in Escherichia coli (7), the organism we used for the measurements of in vivo frame shift efficiencies. The choice of model pseudoknot was inspired by the work of Napthine et al. (20). They measured frameshift efficiencies in rabbit reticulocyte extracts of a series of IBV-derived pseudoknots with different lengths of stem1 sequences. Remarkably, frameshift efficiencies decreased 7-fold when the length of stem1 was reduced from the wild-type length of 11 bp to 10 bp. However, when the Napthine et al. (20) performed a structure probing analysis, both RNAs formed pseudoknots and appeared indistinguishable in conformation. Also, the predicted ⌬G for stem1 of the wild-type IBV and IBV-derived pseudoknots with 11 bp and 10 bp stem1 did not correlate with the differences in frameshifting efficiency (20). In this work, we chose to compare two IBV-like pseudoknots with 11 bp and 10 bp in their stem1 (see Fig. 1 and Materials and Methods). For those two pseudoknots, we examined the frameshift efficiency in vivo and the mechanical stability in single molecule experiments. Rather than using the exact same structures as Napthine et al., the pseudoknots in this work have longer loop2 sequences, as in the wild-type IBV pseudoknot. Apart from making our experiments closer to the wild-type situation, this also increased the difference in length for folded and unfolded pseudoknots for easier spatial detection. Pseudoknot Stimulated Frameshifts in E. coli. Three plasmid con-
structs were made for measurements of frameshift efficiencies. All three encode the slippery sequence and a 6-nt spacer (Fig. 1). This sequence is followed by either a pseudoknot with 11 bp in stem1, a pseudoknot with 10 bp in stem1, or no pseudoknot as a control. The shortest pseudoknot is henceforth named ‘‘PK400,’’ the longer pseudoknot is named ‘‘PK401,’’ and the control is named ‘‘PK421.’’ DNA oligonucleotides encoding these elements were inserted in the end of an orf that originates from bacteriophage T7 gene10 (see Materials and Methods). Translation of the gene10 orf and the slippery sequence without frameshift will lead to termination at a UAA stop codon in the spacer between slippery sequence and the pseudoknot. The result is the release of a 28-kDa termination product. If the ribosomes shift to read the ⫺1 frame at the slippery sequence, the UAA stop codon is out of frame, and translation continues through the pseudoknot and into a lacZ orf. The ⫺1 frame shift allows continuous translation to the end of the lacZ orf and results in a 147-kDa frameshift product. The relative amounts of termination and frame shift products were used to estimate the frameshift frequencies. The proteins were metabolically labeled by addition of [35S]methionine in pulse–chase experiments with cultures of E. coli expressing the individual constructs (see Materials and Methods). After harvesting the cultures, the proteins were separated by gel electrophoresis and visualized by autoradiography (Fig. 2). Prominent bands corresponding to the termination and frameshift products were identified by comparison of proteins harvested from IPTG-induced and uninduced PNAS 兩 April 3, 2007 兩 vol. 104 兩 no. 14 兩 5831
BIOPHYSICS
a
Biotin 2.1 µm Streptavidin bead
Frameshift
a
Pseudoknot
Digoxygenin
DNA/RNA handles
b
Laser trap
2.9 µm Antidigoxygenin bead
PK421 PK401 PK400 Frameshift efficiency
