Functional expression of the alpha-hemolysin of Staphylococcus

THEJOURNAL OF BIOLOGICAL CHEMISTRY

Vol. 267, No. 15, Issue of May 25, pp. 10902-10909,1992 Printed in U.S.A.

Functional Expressionof the a-Hemolysin of Stuphylococcus uureusin Intact Escherichia coli and in Cell Lysates DELETION OF FIVE C-TERMINAL AMINO ACIDS SELECTIVELYIMPAIRS

HEMOLYTIC ACTIVITY*

(Received for publication, December 27, 1991)

Barbara Walker+, Musti KrishnasastryS, Lynda ZornP, John Kasianowiczll, and Hagan BayleySQ From the $Worcester Foundation for Experimental Biology, Shrewsbury, Massachusetts 01545, the §Graduate School of Biomedical Sciences, University of Massachusetts Medical Center, Worcester, Massachusetts 01655, and the llNationul Institutes of Diabetes and Digestive and Kidney Diseases-Laboratory of Biochemistry and Metabolism, National Institutes of Health, Bethesda, Maryland 20892

The a-hemolysin gene fromStaphylococcus aurew, tion of hemolysin a t least 1000 times greater (3, 4). The excludingthe 5’ regionencodingthehydrophobic polypeptide forms cylindrical oligomers in target membranes, leader sequence, was amplified from genomic DNA. and it is probable that these structures arelarge pores responThe identity of the disputed C terminus has beencon- sible for the lytic activity of aHL (5, 6). Based upon the firmed and revisions made to the internal sequence. conductance of single oligomers, the pore has been assigned a The hemolysin is expressed at high levels in Esche- diameter of 1.1-1.2 nm (7), althoughother measurements richia coli and has been purified to homogeneity fromincluding the leakage of macromolecules from resealed red this source. In addition, active [S6S-Met]a-hemolysin ofcell ghosts have suggested it is wider (2, 5, 8). Recordings high specific radioactivity can be generated in an E. from planar bilayers indicate that thepore is a partial rectifier, coli transcription-translation system. criteria By based has a weak selectivity for anions, and is inactivated by mulon protein chemistry, and biological and electrophysiological assays, the recombinant polypeptide is closely tivalent cations in a voltage-dependent manner (7). Recent evidence similar to the staphylococcal polypeptide ruling out the suggests that the conductance of the pore is altered possibility of functionally important posttranslational by the protonation of titratable groups (9), distinguishable by modifications inS.aureus. Convenient newassays uti- their accessibility at one or the other side of the bilayer (10). While oligomerization of aHL is presumably triggered by lizing the ‘%-labeled polypeptide to measure erythrocyte binding, oligomer formation in detergent andon receptors on susceptible cells (4, ll), apparently identical target cells, and hemolysis have been developed. Theyoligomers are generated in uitro by treatment of monomeric have been used to demonstrate that a deletion mutant aHL with heat (12), deoxycholate (13) or lipids (14), or by of a-hemolysin, in whichfive C-terminal amino acids treatment of resistant cells with high concentrations of aHL are absent, is severely compromised inits ability both (4). Chemical cross-linking studies have confirmed earlier to oligomerizeand to lyse rabbiterythrocytes.The suggestions that theoligomers are hexamers (15). In aworking mutant polypeptide nevertheless binds tightly to eryth- model for assembly of the pore (15; for a critique see Ref. 2), rocytes as amonomer,strengtheningtheideathat monomeric aHL undergoes a conformational change, involvoligomerizationis required forcell lysis. ing the movement of two rigid domains about a hinge near

a-Hemolysin (aHL),’ a polypeptide toxin of 33,200 daltons whose gene has been sequenced (1, 2) is secreted by StuphyZococcus uureus as a water-soluble monomer. Red blood cells from certain species are far more susceptible to lysis by aHL than others. For example, rabbit erythrocytes are lysed at -20 ng aHL/ml, while human erythrocytes require a concentra*This study was supported by grants from the Department of Energy, Divisions of Energy Biosciences and Materials Sciences (to H. B.) and the Office of Naval Research (to V. A. Parsegian), and by a postdoctoral fellowship (to J. J. K.) from the National Institutes of Health Intramural Research Training Award. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The nucleotide sequence(s) reported in thispaper has been submitted to the GenBankTM/EMBL Data Bankwith accession number(s) M90536. The abbreviations used are: aHL, a-hemolysin of S. aureus; DOC, deoxycholate; hRBC, human RBC; MES, 2-(N-morpholino)ethanesulfonic acid; PCR, polymerase chain reaction; r-aHL, recombinant a-hemolysin isolated from E. coli; RBC, red blood cell; rRBC rabbit RBC; SDS, sodium dodecyl sulfate, PAGE, polyacrylamide gel electrophoresis; s-aHL, wild-type a-hemolysin isolated from S. aureus.

the midpoint of the polypeptide chain, converting the molecule to an amphipathic rod. The rod inserts into the lipid bilayer where, because of an exposed hydrophilic face, it aggregates into the hexamer. This type of conformational change is supported by circular dichroism spectroscopy, which reveals that there is no pronounced change in secondary structure upon hexamer formation (both the monomer and hexamer are predominantly @-sheet(14, 15)), andby limited proteolysis, which reveals a glycine-rich loop thought to be the hinge that is exposed to theaqueous phase in the monomer but not in the hexamer (15). Alternatively, the molecule may open up after oligomerization on the membrane surface. This view is based on diffraction studies of cubic arrays of oligomers (16) and thefinding that trypsin-treated aHL forms oligomers but cannot lyse erythrocytes (16, 17). Such models (2) are oversimplifications and further intermediatesin the assembly process must exist and have perhaps been detected (7, 15, 17, 18). Because of its relative simplicity, a-hemolysin represents an excellent model system with which to study the assembly, structure, and function of a membrane pore (13). It has also been used extensively as atool in cell biology and electrophysiology to permeabilize mammalian cells (19). In addition, it has been suggested that a-hemolysin might form a useful building block for biomaterials (20). To further work in these

10902

Recombinant a-Hemolysin

10903

fragment was inserted upstream of the NdeI-HindIII fragment. Plasmids with the 5' fragment in the correct orientation were selected by digestion with ChI (Fig. 1B).The sequence of the entire coding region of pT7NNH-13, the isolate used in this work, was determined by dideoxy chain termination using modified T7 DNA polymerase (Sequenase, USB) and a series of strategically placed primers and compared with the sequence of Gray and Kehoe (1). Several differences were noted that result in the reassignment of 3 amino acid residues in the predicted sequence: nucleotides 549-556 (numbering as in Ref. 1) CGCAATT + TCACAAT, amino acids 47-49 (N-terminal Ala = 1)Asn-Ala-Ile + Asn-His-Asn; nucleotide 697 G + C, Ghg7+ Gln; nucleotide 933 C + G, Val'75 unchanged. These changes are unlikely to be due to errors introduced by Taq polymerase (28) as they were also found in independently amplified clones. The minus 3 position in pT7NNH-13 was found to be T and not the expected C. As a EXPERIMENTAL PROCEDURES consequence, this plasmid cannot be digested at the initiation codon Protein Determination and Gel Electrophoresis-Protein concen- with NdeI. tration was determined with the Bradford reagent (Bio-Rad) using Purification of Recombinant aHL (r-aHL)-In the pT7 vector the bovine serum albumin (ultrapure, lipid-free: BM Biochemica) as the cDNA insert is downstream from the phage T7 RNA polymerase standard. SDS-PAGE was carried out as described by Tobkes et al. promoter. A T7 polymerase termination sequence is located -110 (15). Unless otherwise stated the gels shown were run according to base pair downstream from the HindIII site. Expression occurs in E. Laemmli (22). The Fairbanks gels (23) contained 1% SDS. For coli strains harboring the polymerase gene such as E. coli JMlOg(DE3) Coomassie Blue-stained gels the markers (Bio-Rad) were: phospho- (Promega), which was used in this work. To prepare r-aHL, 2 liters rylase b (97,000), bovine serum albumin (66,000), ovalbumin (45,000), of LB medium containing ampicillin (100 pg/ml) were inoculated carbonic anhydrase (31,000), soybean trypsin inhibitor (22,000), and with 5 ml of a 24-h culture of the transformant JMlOg(DE3) NNHlysozyme (14,000).Radiolabeled markers (Amersham Corp.) were "C- 13-9 and shaken at 37 "C until the A650 was -0.5. This took 24 h as methylated proteins: myosin (200,000), phosphorylase b (92,500), NNH-13-9 grow rather slowly. The cells were harvested and susbovine serum albumin (69,000), ovalbumin (46,000), carbonic anhy- pended in lysis buffer (40 ml: 50 mM Tris.HC1, 50 mM EDTA, pH drase (30,000),and lysozyme (14,300). 8.0, 1%(v/v) Triton X-100, and 1mg/ml lysozyme) using a glass rod Purification of aHL from S. aureus (s-aHL)-s-aHL was purified for 15 min on ice. Debris was removed by centrifugation a t 100,000 by amodification of the procedure of Lind et ai. (19). S. aureus (FDA X g for 75 min. The clear supernatant was brought to 75% saturation Wood strain 46, American Type Culture Collection), was grown in 4 with ammonium sulfate. After 1 h at 4 "C, the precipitate was colliters of tryptic soy broth (Difco) for 20 h at 37 "C.The inoculum was lected by centrifugation at 41,000 X g for 50 min and dissolved in 10 1 ml of a log-phase culture that had been frozen in 50% glycerol. The mM Na-acetate, pH 5.0, 20 mM NaC1, and dialyzed against the same cells were removed bycentrifugation and the supernatantbrought to buffer for 18 h. At this stage most of the hemolysin is soluble while a 75% saturation with ammonium sulfate. After 2.5 h at 4 "C, the significant amount of E. coli protein precipitates. The dialysate was precipitate was collected by centrifugation and dissolved in 10 mM centrifuged a t 41,000 X g for 1 h and the clear supernatant loaded Na-acetate, pH 5.0, containing 20 mM NaCl and dialyzed against the onto an SP-Sephadex C-50 column and eluted as described for ssame acetatebuffer for 24 h. The dialysate was centrifuged to remove aHL. Further steps were similar to those described for s-aHL. The any precipitate and loaded onto a SP-Sephadex C-50 column equili- yield was typically -3.5 mg/liter culture. brated with the acetate buffer. The column was eluted with a gradient 35S-hbeled r-aHL by in Vitro Transcription-Transhti~n-~~S-laof 0-500 mM NaCl in 10 mM Na-acetate, pH5.0. The fractions testing beled r-aHL was obtained by in uitro synthesis in the presence of positive for hemolysis were pooled and concentrated using a Centri- [35S]methionine. An E. coli transcription-translation mix (25 pl) prep device (Amicon, M, 30,000 cut-off). Finally, a portion of the contained supercoiled pT7NNH-13 DNA (0.5 pg), amino acid "prehemolysin (1.0-1.5 mg), which by this stage was quite pure, was mix" minus methionine (10 pl, Promega No. L468), [35S]methionine subjected to gel filtration on Sephacryl S-300 HR (34 X 2.2-cm). The (10 pCi, 1176 Ci/mmol, Du Pont-New England Nuclear), an E. coli B fractions testing positive for hemolysis were pooled, concentrated, strain S30 extract (7.5 pl, Promega No. L464) and T7 RNA polymand stored at -70 "C in aliquots. In a typical preparation, the total erase (50 units, New England Biolabs). After 60 min at 37 "C, the yield was 24 mgof electrophoretically pure hemolysin. mix containing 35S-labeledr-aHL was used directly or frozen at PCR Amplication of the aHL Gene and Expression Plasmid Con- -70 "C for up to 1 week. In some cases rifampicin (20 pg/ml) was struction-S. aureus genomic DNA was prepared as described by used to inhibit transcription of the (3-lactamase gene by E. coli RNA O'Reilly et al. (24) and treated with DNase-free RNase, followed by polymerase present in the S30 extract. phenol/chloroform extraction and ethanol precipitation. The hemoProtein Chemistry-N-terminal sequence analysis was performed lysin gene, excluding the 5' region that encodes the hydrophobic using an Applied Biosystems model 477A sequencer on r-aHL that leader sequence, was amplified using Taq polymerase with the 5' had been transferred to a polyvinylidinedifluoride membrane (Proprimer HB180 (5' AATCCTGTCGCTcaTatgGCAGATTCTGAT Blott, Applied Biosystems). Amino acid analysis was also done on mismatches in lower case) and the3' primer HB172 (5' AAACATCA polyvinylidinedifluoride-immobilizedsamples (29). The C termini of TTTCTGAAGcTtTCGGCTAAAG). The 5' primer createsa new both s-aHL and r-aHL were resistant to carboxypeptidase Y digestion initiation codon and an NdeI site ( C A ' T a ) immediately before even after denaturation in 8.0 M urea and 1.0% SDS. Digestion was the Alacodon of the mature polypeptide, the first 44 residues of after dilution to 1.0 M urea and 0.1% SDS, concentrations which do which had previously been determined by protein sequence analysis not inactivate the enzyme. (see Ref. l).' The 3' primer creates a new HindIII site in the 3' Generation of the Deletion Mutant A289"Part of the aHLcoding untranslated region of the gene. Genomic DNA (40 ng) in 100 pl of region was amplified from the plasmid pT7NPH-8, which contains a PCR buffer (50 mM KCl, 10 mM Tris-HC1 pH 8.5, 2.5 mM MgClzand copy of the aHL gene in which the internal NdeI site has been 0.2mg/ml gelatin)containing 100 pmol of each primer, 200 p~ converted to a PuuI site. The oligonucleotides used were HB203 dNTPs and 2.5 units of Taq polymerase (Perkin Elmer-Cetus) was (5'CGGGATCCTAATACGACTCACTATAGGG), which primes a t heat denatured at 95 "C for 3 min prior to amplification, using the the T7 promoter in the pT7flA vector, and HB223 (5'GCGCAAfollowing program: 95 "C, 1.5 min; 55 "C, 2 min; and 72 "C, 3 min. GCTTTCATTATTTTTCCCAATCGAT'M'TATATC), which is a After 20 rounds of amplification an additional 10 min were allowed primer containing aHL anticodons from Arg" to LysZBB followed by for extension at 72 "C. The PCR product, which contains an internal tandem stop anticodons and a HindIII recognition site. The amplifiNdeI site, was cut to completion with NdeI and HindIII yielding a 5' cation product was cut with NdeI and HindIII and ligated into the NdeI-NdeI fragment and a 3' NdeI-Hind111 fragment (Fig. lA). The plasmid pT7SflA toyield pT7NPH-A289. pT7SflA is a derivative of latter was ligated into theexpression vector pT7flA. The vector was pT7flA containing synthetic a transcription stop signal obtained by using NdeI and HindIII to remove the insert from pT7/ (5'GATCTAGCCCGCCTAATGAGCGGGCTTTTTTTTA)inserted BCYl/flA, the kind gift of Mark Zoller (Genentech (25-27). The at the BglII site upstream from the T7 promoter to prevent readresulting plasmid was cut with NdeI and the5' NdeI-NdeI aHL gene through from the amppromoter (30). 125Z-LabeledaHL-aHL (50 pl, 1.0 mg/ml in 10 mM Tris. HC1, pH * N. Tobkes, S. Birken, and Hagan Bayley, unpublished data. 8.0) was mixed with 2.0 M NaCl (4.5 pl), lactoperoxidase (3.0 pl, 1.0

areas, we have expressed the a-hemolysin gene at high levels in Escherichia coli, overcoming earlier difficulties (21). The recombinant a-hemolysin has been purified to homogeneity and is indistinguishable from the protein purified from S. aureus. Further, 35S-labeledaHL of high specific activity has been generated-by in vitro transcription and translation inan E. coli lysate, allowing the development of convenient new assays for erythrocyte binding, oligomer formation, and cell lysis. The utility of these assays is demonstrated here by experiments in which the properties of A289, a C-terminal deletion mutant of aHL, are determined.

Recombinant a-Hemolysin

10904

mg/ml in 50 mM sodium phosphate, pH 8.0), '1 (1.0 pl, 100 mCi/ml, 13.3 mCi/pg in NaOH, pH 7-11), and hydrogen peroxide (1.5 pl, 0.88 mM). After 1 h, the reaction was stopped by the addition of 100 mM sodium azide (5.0 pl). Unreacted radioiodine was converted to iodide by the addition of 20 mM sodium metabisulfite (15 pl) before isolation of the '251-labeledaHL on a column of Sephadex G-25 eluted with KPBSA (20 mM KH2P04,150 mM NaC1, pH 7.4, containing 1 mg/ml bovine serum albumin). Binding of r-aHL to RedBloodCells-In a kinetic assay, the competition between lZ51-labeleds-aHL andunlabeled aHL for sites on rabbit red blood cells was examined (11).s-aHL and r-aHLwere serially 2-fold diluted in K-PBSA. A portion of '251-labeleds-aHL (10 A C

C

A

22-

1 2

B

1

2

30-

N

I4c

HE I72

PCR

J N

c n

N

C

FIG. 2. SDS-PAGE of purified r-aHL and of 3sS-labeledraHL and A289. Panel A, Coomassie Blue-stained SDS-polyacrylamide gel of s-aHL and r-aHL purified as described in the text. A 12% Laemmli gel was used. Lune 1, staphylococcal a-hemolysin (saHL, 3.5 pg); lane 2, recombinant a-hemolysin (r-aHL, 5.0 pg). Panel B, electrophoresis of r-aHL and thedeletion mutant AC289 in which the five most C-terminal amino acids have been deleted. Coupled transcription-translation was carried out using supercoiled plasmids as templates in an S30 extract containing [35S]methionine,treated with rifampicin, and supplemented with T7 RNA polymerase. The products were separated by SDS-PAGE in a 12% Laemmli gel, which was subjected to autoradiography. Lane 1, r-aHL; lane 2, AC289.

pl containing 35.3 ng at 8.5 X 10' cpm/mg) was added to each sample of aHL (40 pl), which was cooled on ice. Cold rRBCs (50 pl of 5% cells) were then added and,after 1 h on ice, each sample was transferred to a 1.5-ml polyethylene tube containing dibutylphthalate (150 pl) at 4 "C. The tubes were centrifuged at 9000 rpm inan Eppendorf model 5415 centrifuge. The aqueous layer was removed frqmnl NH from each and thesurface of the dibutylphthalate washed repeatedly with cold K-PBSA (6 X 1 ml). Iz5Iin the cell pellet was then assayed in a y-counter. N C In a second qualitative assay, E. coli S30 containing [35S]r-aHL - "_ (2.5 ull was incubated with 1%RBCs (50 pl) on ice for 30 min._. The frqmnt NN red cells were then recovered by centrifugation and washed twicewith K-PBSA. Protein in the first supernatant was precipitated with 19 volumes of cold acetone. The extents of binding of [35S]r-aHLto hRBCs and rRBCs were compared by autoradiography after SDSPAGE of the supernatants and pellets. Quantitative HemolysisAssay-Hemolysinwas diluted into KPBSA and subjected to up to twelve 2-fold serial dilutions in the same buffer. One volume of 1% RBCs was then added to each tube, which was then gently shaken and incubated at 37 "C for 30 min. After centrifugation at 14,000 X g for 30 s at 4 "C, the A515 of the pT7NNH-I 3 supernatant was recorded. The H G Ois the concentration of aHL required to give 50%lysis of rRBCs. Lytic concentrations refer to the aHL concentration after the addition of RBCs. To compare the hemolytic potencies of r-aHL and A289, the polypeptides were prepared by in vitro transcription and translation as described above, except that a complete amino acid mix (Promega No.L469)was used to increase the concentration of methionine *I 0 thereby ensuring the synthesis of concentrations of polypeptides in FIG. 1. PCR cloning of aHL gene and expression plasmid the range 10-50 pg/ml (38). The S30 extracts were serially diluted construction. Shaded, leader sequence; filled, coding sequence of with K-PBSA in microtiter wells before the addition of 1%rRBCs. mature aHL; open, untranslated sequences; line, plasmid sequences. The concentrations of the polypeptides were subsequently compared Restriction sites: C, ClaI; H, HindIII; N, NdeI. Panel A, the aHLgene by SDS-PAGE and autoradiography. Hexamer Formation Mediated by Rabbit Erythr~cytes-[~~S]r-aHL was amplified from S. aureus genomic DNA using primers based on the sequence of Gray and Kehoe (1).The 5' primer (HBIBO) creates (or A289: 2.5-5.0 pl of the S30 mix) was incubated with 10% rRBCs a new initiation codon and an NdeI site ( C A ' T a ) immediately (50 pl) for 30 min on ice. The cells were spun down at 4 'C, resusbefore the Alacodon of the mature polypeptide. The 3' primer pended in 50 pl of K-PBSA, and brought to 37 "C for 2 min. s-aHL (HBl72) creates a new HindIII site in the 3' untranslated region of or r-aHL (1 pl, 1.0 mg/ml) was then added, and the cells were the gene. The PCR product was cut with NdeI and HindIII generating incubated at 37 "C for 15 min, during which lysis occurred. The red centrifugation at room temperature two fragments, aHL-NNandaHL-NH.Panel B, aHL-NH was cell membranes were recovered by ligated into the plasmid pT7/BCYl/flA (25) from which the BCYl for 5 min at 12,000 X g, dissolved in 2 X loading buffer without insert had been removed using NdeI and HindIII. The new construct heating, and subjected to SDS-PAGE in a 4.5% Fairbanks gel. Oligomer Formation in Presence of Deoxycholate-Na-deoxycholate was linearized with NdeI and ligated to aHL-NNyielding the expression plasmid pT7NNH-13. The orientation of fragment aHL-NN in (100 mM, pH 8.2, containing 10 mM Tris-HCl) was added to r-aHL this plasmid was checked byClaI digestion. The NdeI site at the (0.87 mg/ml) or s-aHL (0.80 mg/ml) in 92.5 pl of 10 mM TriseHCl, initiator Met was found to be mutated when the insert was sequenced pH 8.0, to a final concentration of 6.33 mM. This was done over 40 (see "Experimental Procedures") and cannot be cleavedin pT7NNH- min at room temperature by adding a portion of DOC solution (1.25 13. $10, bacteriophage T7 gene 10 promoter region; 2'4, T7 polym- pl) every 10 min. After each addition the mixture was stirred for a erase transcriptionterminator. few seconds. After the fifth and final addition, the mixture was left M I / Hlndlll

'

'-I

i

i

Recombinant

a-Hemolysin

2500

2000 P 3 z

1500

i N”

1000

1 500

0 0

5 unlabeled

hsRBC P s

10 hemolysln

15

20

(pg/mL) Dllutlon

rRBC P s

aHL

No.

FIG. 4. s-aHL and r-crHL compared in quantitative hemolysis assays. RBCs were added to serial 2-fold dilutions of hemolysin as described under “Experimental Procedures.” The concentration of aHL in the first dilution was 1.0 rg/ml, after the addition of RBCs. Hemolysis was measured by assaying the AM of the supernatant after incubation at 37 “C. Open circks, rRBCs treated with s-cuHL; filled circles, rRBCs treated with r-aHL; open squures, hRBCs treated with s-aHL; filled squares, hRBCs treated with r-cuHL.

bla

B

A 1

FIG. 3. Binding of r-aHL to red blood cells. Panel A, a quantitative kinetic assay for aHL binding to rabbit RBCs. A fixed amount of [iz51]s-cyHL (35.3 ng) was added to each tube of a 2-fold dilution series of s-cuHL or of r-aHL. Rabbit RBCs were then added to each tube. After 1 h on ice, the red cells were recovered by centrifugation through oil and the bound radioactivity determined with a y-counter. Open circles, s-cuHL; filled circles, r-aHL. Bars show standard deviations (un.i) for four determinations. Panel B, qualitative assay for [““S]aHL binding to rabbit and human RBCs. E. coli S30 containing [““S]r-cuHL was incubated with 1% RBCs on ice for 30 min. The red cells were then recovered by centrifugation. Protein in the supernatant was precipitated with acetone. The extents to which hRBCs and rRBCs bound [35S]r-aHL were compared by autoradiography of SDSpolyacrylamide gels in which polypeptides from the supernatants and pellets were separated. P, pellet; S, supernatant; bin, p-lactamase. at room temperature for 20 additional min, before the addition of 1 volume of 2 x loading buffer at room temperature and analysis of 50 ~1 in a 4.5% Fairbanks gel run at low voltage to prevent overheating. To assay 35S-labeled r-cuHL, S30 mix (10 ~1) was mixed with s-cuHL (1.8 mg/ml, 30 ~1). DOC (32 mM) was then added over 30 min (4 X 2.5 rl), followed by a 20-min incubation, all at room temperature. Pore Characterization Using Planar Lipid Biluyers-The reagents used in these measurements were: diphytanoyl phosphatidylcholine (Avanti Polar Lipids), citric acid (Sigma), hexadecane (purum, Fluka), pentane (Burdick & Jackson), and potassium chloride (Mallinckrodt). Deionized water was twice distilled from quartz. Aqueous solutions were filtered through Millex-GV 0.22-pm filters (Millipore). Experiments were performed at 22-25 “C with solvent-free phosphatidylcholine membranes (31) formed over a 200~pm diameter hole in a Teflon partition. The orifice was pretreated with a solution of hexadecane in pentane. Single or many pores were reconstituted into the bilayer by adding 52 ~1 of r-cuHL (0.87 mg/ml) in 10 mM Tris. HCl, pH 8.0, to 4 ml of 0.1 M KC1 containing 5 mM citric acid or 5 mM MES (titrated with NaOH to the appropriate initial pH value (see figure legends)) in the CIS chamber while stirring. The CIS chamber was flushed with fresh buffer to halt further pore incorporation. Small portions of either 1.0 M Tris base or 2.0 M acetic acid were added to the chambers to adjust the pH to the same desired value on each side. The pH values of small volumes (10 ~1) removed from each chamber were checked with a microelectrode (Microelectrodes Inc., model MI-410). The current was amplified with an inverting amplifier (Burr-Brown OPA-111) with 0.5% precision feedback resistors (K&M). The CIS chamber was connected to virtual

I

2

r)

2

wm

a6

a6

FIG. 5. r-cxHL forms hexamers on rRBCs or when treated with DOC in solution. Panel A, [35S]r-aHL in an S30 mix was allowed to bind to rRBCs at 4 “C. The cells were washed and treated with a high concentration of s-aHL at 37 “C to induce lysis. The red cell membranes were recovered by centrifugation, dissolved in loading buffer, and subjected to SDS-PAGE in a 4.5% Fairbanks gel. An autoradiogram of the dried gel is shown. Lone I, r-cuHL recovered from red membranes: the sample was not heated in the loading buffer; lone 2, r-aHL recovered from red membranes: the sample was heated in the loading buffer for 5 min at 95 “C. Panel B, aHL was treated with 6.33 mM DOC at room temperature. Samples were loaded into the dry wells of a 4.5% Fairbanks gel and overlayed with 1 X loading buffer at room temperature. After electrophoresis the gel was stained with Coomassie Blue. Lane 1, s-aHL; lone 2, r-orHL.

ground, and the current is defined as positive for cations flowing from the TRANS to the CIS compartment. The current was simultaneously recorded on both a Kipp and Zonen BD-41 chart recorder and a National Instruments 16-bit A/D board (NB MIO-16XL-18) in a Macintosh II fx microcomputer running LabView software. Input voltage pulses were produced with either the 12 bit D/A segment of the National Instruments board or a PGEN pulse generator (NBD Electronics). RESULTS

AND

DISCUSSION

Expression of LYHL in E. coli Cells and Lysates-Previous attempts to express the (YHL gene of S. aureus in E. coli have involved the insertion of various staphylococcal genomic fragments into the plasmid vectors pBR322 and pBR327 (21,24). The low levels of expression that were obtained in K-12 strains (-0.01 ng/pg protein) presumably depended upon use

10906

Recombinant a-Hemolysin

FIG. 6. The currentflowing through pores formed by r-aHL in a planar lipid bilayer of diphytanoyl phosphatidylcholine. The major conductance transitions arerapid and nearly equal with an average conductance

of = 180 pS. The membrane, which contained six r-aHL channels, was bathed by symmetric solutions of 0.1 M KCl, 5 mM citric acid at pH 4.5. The channels formed spontaneously after adding r-aHL (1pl, 25 pg/ml) to one side of the bilayer. The potential applied across the membrane is denoted at the arrows. The time between transitions is a function of applied potential (data not shown) and varies over a wide range.

of the aHL promoter by E. coli RNA polymerase or readthrough from other promoters on the vectors. Our goal has been to obtain high levels of expression of the mature aHL polypeptide in a system compatible with efficient in uitro mutagenesis and inuitro transcription-translation.Therefore, we chose an expression plasmid, pT7flA, that utilizes the T7 phage RNA polymerase promoter and contains the fl phage origin so that single-stranded DNA template for mutagenesis might be made (25). The T7 phage sequences between the promoterand the initiatorMet, which areimportant for efficient translation (32), are retained inthe pT7flAvector. The aHL insert was obtained by direct PCR amplification of S. aureus genomic DNA using a 5’ primer that eliminated DNA encoding the hydrophobic leader sequence (see “Experimental Procedures” and Fig. lA). The PCR product was assembled in the expression vector in two steps to yield the plasmid pT7NNH-13 (Fig. lB), which was used to transform E. coli JMlOg(DE3). Thisstrain is a XDE3 lysogen (33) containing acopy of the T7polymerase gene under control of the lacUV5 promoter. Because of leaky expression of T7 polymerase, genes under control of the T7promoter are often constitutively expressed in E. coli JMlOg(DE3) and similar strains (33) and this was the case with the aHL gene. Despite the high A+T content of the gene (34), up to 50% of the E. coli protein was r-aHL as judged by SDS-PAGE, andthe polypeptide couldbe purified from adetergentEDTA-lysozyme lysate by a straightforward procedure involving cation-exchange chromatography and gel filtration (Fig. 2 A ) (19). Because much of the recombinant protein is insoluble, only -3.5mgof r-aHL was obtained per liter of culture. Although this is more than adequate for our present studies, attempts are being made to improve the recovery by extracting the polypeptide in urea, followed by renaturation (12). In addition, [35S]r-aHLof high specific radioactivity was obtained by using pT7NNH-13 as a template in an E. coli S3O-coupled transcription-translation system supplemented with T7 RNA polymerase. This reagent is rather useful (see below) as previous methods for radiolabeling aHL have involved chemical modification (4, 17, 35), which can alter the properties of the polypeptide (4, 35-37). In contrast to the findings of Noren et al. (38), the transcription-translation system responded to the addition of T7 polymerase when supercoiled plasmid was used as template. Like Lesley et al. (39), we have also used PCR generated templates with builtin T7polymerase promoters for direct in uitro transcriptiontranslation. In thiscase, lower amounts of labeled polypeptide were obtained and in agreement with these authors theaddition of T7 polymerase did not enhance the yields. Protein Chemistry of r-aHL-Recombinant aHL is indis-

tinguishable from s-aHL by several criteria, the first being protein chemistry. s-aHLandr-aHL comigrate on SDSPAGE and one-dimensional peptide maps of r-aHL made after partial tryptic cleavage are very similar to those of saHL (data notshown). Edman degradation demonstrated that the N-terminal sequence of r-aHL is NH2-Ala-Asp-Ser-AspIle-Asn-Ile-Lys-Thr-Gly.. . (data not shown), which is identical to that of s-aHL (see Ref. 1): The initiator methionine that replaces the leader sequence in thepolypeptide encoded by pT7NNH-13 (Fig. lA)was expected to be cleaved efficiently as it is followed by a residue with a small side chain (40). The sequence at the C terminus of aHL has been in doubt (1)as two previous reports assign the C-terminal residue as lysine (41, 42), while the C-terminal residue predicted by the sequence of the gene is asparagine. In our hands both s-aHL and r-aHLwere resistant to carboxypeptidase Y even in the presence of urea and SDS (see “Experimental Procedures”). Further,A289, a deletion mutant of aHL missing the five amino acids following LysZM(the lysine residue closest to the stop codon), clearly migrates faster than the full-length polypeptide in SDS-polyacrylamide gels (Fig. 2B) ruling out the unlikely possibility that these residues were removedboth in S. aureus and in E. coli and affirming the C terminus assigned by Gray and Kehoe (1).However, during the course of this work, the internal sequence of the aHL gene was revised and as aresult 3 amino acid residues were reassigned (see “Experimental Procedures”). The presence of a fourth histidine residue at position 48 is significant as itwill require reinterpretation of recent data on the effects of chemical modification of aHL with diethylpyrocarbonate (36). Biological Activityof r-aHL-Next, the ability of r-aHL to bind to rabbit red blood cells was examined. There are 10005000-binding sites for s-aHL/rRBC (4, ll),and far fewer or no sites on hRBCs (4, ll),which are relatively insensitive to the hemolysin (3). s-aHL and r-aHL compete equally effectively with trace-labeled [‘251]s-aHL(4, 11, 35) for binding sites on rRBCs at 4 “C (Fig. 3A). As binding is essentially irreversible (4, l l ) , this is a kinetic assay reflecting the relative rates of association of the labeled polypeptide and its competitor. The ICbovalues of-1.25Ng/mlof unlabeled aHL agree with a previous determination for s-aHL conducted under somewhat different conditions (35). In a second, direct but qualitative assay [35S]r-aHLwas allowedto bind to RBCs at sublytic concentrations. As expected, hRBCs exhibited a lower apparent affinity for r-aHL than did rRBCs (Fig. 3B). Despite the complexities associated with aHL binding to RBCs (4, 11, 17, 43), these data at theleast show that s-aHL and r-aHLhave rather similar binding properties. The hemolytic activities of s-aHL and r-aHL were compared in a quantitative assay. The recombinant protein was

10907

Recombinant a-Hemolysin A 1

12

2

8

-8

-17

1.6

24 h

l h

time

FIG. 8. Properties of the aHL deletion mutant A289, Panel A, oligomer formation on rRBCs. 3sSS-labeled r-aHL or A289 in an S30 mix was allowedto bind to rRBCs a t 4 "C. The cells were washed and treated with a high concentration of s-aHL a t 37 "C to induce lysis. Membranes were recoveredby centrifugation, dissolved in loading buffer without heating, and subjected to SDS-PAGE in a 4.5% Fairbanks gel. A purposely overexposed autoradiogram of the dried gel is shown. Lane I , r-otHL control; lune 2, A289. Panel B, hemolytic activity. r-otHL or A289 was generated inan S30 extract in the presence of a high concentration of [35S]Metof low specific radioactivity. The samples were serially diluted in K-PBSA in microtiter wells. Well I contained a 2-fold dilution and well IO a 1024-fold dilution, before the addition of an equal volume of 1% rRBCs. Incubation was a t 18 "C for 1 and 24 h. The initial concentrations of r-aHL and A289 were closely similar as judged by SDS-PAGE and autoradiography.

DH

The ability of r-aHL to form the hexamers that have been implicated as the hemolytic lesion (5, 6 ) was assayed in two independent ways.Red cell-dependent hexamer formation was observed by allowing [35S]r-aHLto bind to rRBCs at 00 1 4 "C. This was followed bya chase at 37 "C with unlabeleds60 aHL or r-aHL. Hexamer formation was clearly demonstrable FIG. 7. pH dependence of the instantaneous conductance by SDS-PAGE and autoradiography, whether s-aHL (Fig. and decay kinetics of r-aHL. Panel A , plot of the I-V relationship 5A) or r-aHL was used in the chase. In theformer experiment for a membrane containing several hundred pores as a function of r-aHL polypeptides are presumably incorporated into hexpH. The solutions bathing both sides of the membrane contained 0.1 amers formed by excess s-aHL. Red cell-independent hexM KCl, 5 mM citric acid at pH5.0 (circles), pH 5.5 (triangles), pH 6.0 (squares), and pH 7.0 (diamonds). Panel B, the pH dependence of amer formation was detected after incubation of r-aHL with the rectification ratio at 100 mV. Aratio of one signifies ohmic deoxycholate at just above the critical micelle concentration behavior. A least squares fit to the Henderson-Hasselbach equation (Fig. 5B) (13). is shown for a pK, value of 6.2. Panel C, the decay kinetics of the Electrophysiological Properties of r-aHL-Finally, the pore t = 0) as a function of voltage. current (normalized to the current at forming properties of aHL were examined using the planar The current decay can be described by the sum of two exponentials. The time constants themselves are not strong functions of applied lipid bilayer technique. The pores formed by r-aHL have a potential over the range explored here. The solutions bathing both well-defined conductance of 180 pS k 25 ( V = 15 mV, 0.1 M sides of the bilayer contained 0.1 M KCl, 5 mM citric acid, pH 5.0. KC1, pH 4.5; Fig. 6 ) . This value is similar to that previously determined for s-aHL 195 pS 10 ( V = 15 mV, 0.1 M KC1 consistently -20% more active than s-aHL, and there is no pH 4.5). I-V curves obtained for r-aHL are closely similar to ready explanation for this small difference. For example, in those observed with s-aHL (7, 8, 10). The instantaneous the experiment shown (Fig.4), the HCso values at 37 "C were: current-voltage relationship of r-aHL is pH-dependent (Fig. s-aHL, 31 ng/ml and r-aHL, 25 ng/ml. As expected hRBCs 7A). For all voltages, the current decreases when the pH is were far less susceptible to lysis by both r-aHL and s-aHL increased over the range 5.0 < pH < 7.0. Near neutral pH, (Fig. 4). In agreement with Kehoe et al. (21), expression of the curve exhibits rectification. The titration of the current the aHL gene alone is sufficient for full hemolytic activity. limiting groups can be visualized more easilyif the rectificaBy contrast, for example, E. coli prohemolysin (hlyA) also tion ratio at 100 mV, I I(+ 100 mV)/I(- 100 mV) I, is plotted requires the expression of hlyC for posttranslational activa- as a function of pH (Fig. 7 B ) .The rectification ratios meastion involving fatty acylation (44). ured for r-aHL at 100 mV are in good agreement with the 1

170

L

1

i RO

, o i

.

l,mC ( \ e c )

*

Recombinant a-Hemolysin

10908

values obtained with s-aHL (9, 10). The datacan be fitted to the Henderson-Hasselbach equation with an apparent pKa = 6.2 (Fig. 7B). However, it should be noted that the conductance of the pore appears to be modulated by at least two distinct titratable groups (9, 10). Like the pores formed by saHL, those formed by r-aHL are weakly anion selective at pH 4.5. For example, IPcI/PKI = 3.4 f 0.5 ( n = 4) for r-aHL and IPcL/PKI= 4.8 k 0.8 ( n = 4) for s-aHL. The selectivity is even weaker at pH 7.5, namely -2.2 for r-aHL, inagreement with a previously determined value of -2.6 for s-aHL (9). Under our experimental conditions, when a potential is applied across a membrane containing many r-aHL pores, the decay in the current can be described by the sum of two exponentials. Increasing the applied potential (Fig. 7C) and decreasing the pH (data notshown) favors fast decay. Pores formed by s-aHL behaved in a similar way. The ability of saHL to form pores in planar bilayer membranes is affected markedly by pH3 and the same is true for r-aHL. When raHL is added to theCIS chamber maintained at low pH, the current increases rapidly. If the pH on both sides of the bilayer is then increased, the current immediately decreases -1.6-fold, an amount predicted by the data in Fig. 7A. However, the change in current/unit time,AZlAt, decreases by 1020-fold (data notshown). This cannotbe accounted for solely by the lower conductance of the newly incorporated pores and suggests that the rate of incorporation itself must decrease with increasing pH. Properties of the Deletion Mutant A289"The preceding experiments, which demonstrate the close similarity between staphylococcal and recombinant aHL, areessential precursors to mutagenesis experiments designed to elucidate the assembly, structure, and function of the aHL pore. Further, the ability to generate aHL by in vitro transcription-translation in E. coli S30 lysates haspermitted the development of convenient new assays to measure erythrocyte binding, oligomer formation in detergent and on target cells, and cell lysis. These assays are demonstrated here in the analysis of the deletion mutant A289, which was initially made to help confirm the identity of the C terminus of the wild-type polypeptide (Fig. 2B). [36S]A289 wasincubated with rRBCs for 30 min at 4 'C, followed by a chase with a lytic concentration of unlabeled s-aHL at37 "C. SDS-PAGE revealed that themutant polypeptide had bound efficiently to theerythrocytes as a monomer (Fig. 8 A ) . However, by comparison to a [3SS]raHL control, the extent of conversion of A289 to anoligomer was very low but detectable. This assay measures the ability of A289 to replace a wild-type subunit in hemolysin a hexamer. A289 generated by in vitro transcription-translation was also assayed for hemolytic potency toward rRBCs and found to have no activity in the standardassay (37 "C, 30 min), which is capable of detecting polypeptides with less than 1%of the specific activity of s-aHL. A289 did however lyserRBCs very slowly at 18 "C (Fig. 8C), a temperature near the optimal for lysis by s-aHL (4). It is surprising that the deletion of only five C-terminal amino acids so severely compromises the ability of aHL to lyse rabbit erythrocytes. It is unlikely that A289 has folded incorrectly because binding activity is retained, andthe mutantdoes have detectable, albeit weak, lytic activity. Whether oligomerization, and hence cylindrical pore formation, is required for lysis (5, 6) has remained a contentious issue for aHL (2, 18, 45) and other lytic agents (45-47). The present data supportthe idea that oligomerization, if not pore formation, is required for efficient lysis of rRBCs by aHL, which is consistent with the finding that aHL is com_ _ _ _ ~ ~ ~~~

~

J. J. Kasianowicz, C. Moore, C. L. Bashford, C. Pasternak, and V. A. Parsegian, unpublished data.

pletely converted to hexamer on the surface of rRBCs under optimized conditions that also cause efficient lysis (17). Acknowledgments-We are indebted to our colleagues at Worcester Foundation for Experimental Biology (W.F. E. B.) and theNational Institutes of Health for their help and guidance: John Leszyk for protein sequencing and amino acid analysis at the W. F. E. B. Protein Chemistry Facility, Vipin Kohli and John Goodchild for oligonucleotides synthesized at the W. F. E. B. Cancer Center Core Facility, Stephen Cheley for advice on protein expression, Rekha Panchal for help with DNA sequencing and Harvey Florman for advice on cellbinding experiments. We thank Mark Zoller (Genentech) for the pT7flA vector.

REFERENCES 1. Gray, G. S., and Kehoe, M. (1984) Infect. Zmmun. 4 6 , 615-618 2. Thelestam, M., and Blomqvist, L. (1988) Toricon 2 6 , 51-65 3. Cooper, L. Z., Madoff, M.A., and Weinstein, L. (1966) J. Bacterial. 91,1686-1692 4. Hildebrand, A., Pohl, M., and Bhakdi, S. (1991) J. Biol. Chem. 266,17195-17200 5. Fussle, R., Bhakdi, S., Sziegoleit, A., Tranum-Jensen, J., Kranz, T., and Wellensiek, H.-J. (1981) J. Cell Biol. 9 1 , 83-94 6. Bhakdi, S., and Tranum-Jensen, J. (1983) Trends Biochem. Sci. 8,134-136 7. Menestrina, G. (1986) J. Membr. Biol. 90, 177-190 8. Krasilnikov, 0.V., Sabirov, R. Z., Ternovsky, V. I., Merzliak, P. G., and Tashmukhamedov, B. A. (1988) Gen. Physiol. Biophys. 7,467-473 9. Krasilnikov, 0.V., and Sabirov, R.Z. (1989) Gen. Physiol. Biophys. 8,213-222 10. Kasianowicz, J. J., Moore, C.,Zimmerberg, J.,Pasternak, C., Bashford, C. L., and Parsegian, V.A. (1991) Biophys. J. 6 9 , 458a 11. Cassidy, P., and Harshman, S. (1976) Biochemistry 1 6 , 23482355 12. Arbuthnott, J. P., Freer, J. H., and Bernheimer, A. W. (1967) J. Bacteriol. 9 4 , 1170-1177 13. Bhakdi, S., Fiissle, R., and Tranum-Jensen, J. (1981) Proc. Natl. Acad. Sci. U. S. A . 78,5475-5479 14. Ikiaai. H.. and Nakae., T. (1985) . . Biochem. Biophvs. Res. Commun. i30,li5-181 15. Tobkes, N., Wallace, B. A., and Bayley, H. (1985) Biochemistry 24.1915-1920 16. Olofsson, A., KavBus, U., Hacksell, I., Thelestam, M., and Hebert, H. (1990) J. Mol. Biol. 214,299-306 17. Thelestam, M., Olofsson, A., Blomqvist, L., and Hebert, H. (1991) Biochim. Biophys. Acta 1062,245-254 18. Harshman, S., Boquet, P., Duflot, E., Alouf, J. E., Montecucco, C., and Papini, E. (1989) J. Biol. Chem. 2 6 4 , 14978-14984 19. Lind, I., Ahnert-Hilger, G., Fuchs, G., and Gratzl, M. (1987) Anal. Biochem. 164,84-89 20. Bayley, H. (1991) MRS Symp. Proc. 218,69-74 21. Kehoe, M., Duncan, J., Foster, T., Fairweather, N., and Dougan, G. (1983) Infect. Zmmun. 4 1 , 1105-1111 22. Laemmli, U. K. (1970) Nature 227,680-685 23. Fairbanks, G., Steck, T. L., and Wallach, D. F. H. (1971) Biochemistry 10,2606-2617 24. O'Reilly, M., Azavedo, J. C. S., Kennedy, S., and Foster, T. J. (1986) Microbial Pathogen. 1 , 125-138 25. Kuret, J., Johnson, K. E., Nicolette, C., and Zoller, M. J. (1988) J. Biol. Chem. 263,9149-9154 26. Johnson, K. E., Cameron, S., Toda, T., Wigler, M., and Zoller, M. J. (1987) J. Biol. Chem. 262,8636-8642 27. Rosenberg, A. H., Lade, B. N., Chul, D.-S., Lin, S.-W., Dunn, J. J., and Studier, F. W. (1987) Gene (Amst.) 56,125-135 28. Bloch, W. (1991) Biochemistry 30,2735-2747 29. Cohen, S. A., and Strydom, D. J. (1988) Anal. Biochem. 174, 116 30. Christie, G. E., Farnham, P. J., and Platt, T. (1981) Proc. Natl. Acad. Sci. U. S. A . 78,4180-4184 31. Montal, M. (1974) Methods Enzymol. 3 2 , 545-554 32. Olins, P. O., Devine, C. S., Rangwala, S. H., and Kavka, K. S. (1988) Gene (Amst.) 73,227-235 33. Studier, F. W., Rosenberg, A. H., Dunn, J. J., and Dubendorff, J. W. (1990) Methods Enzymol. 186,60-89 34. Makoff, A. J., Oxer, M. D., Romanos, M. A., Fairweather, N. F., "

Recombinant a-Hemolysin and Ballantine, S. (1989) Nucleic Acids Res. 1 7 , 10191-10202 35. Cassidy, P., and Harshman, S. (1976) Biochemistry 1 6 , 23422348 36. Pederzolli, C., Cescatti, L., and Menestrina, G . (1991) J. Membr. Biol. 1 1 9 , 41-52 37. Cescatti, L., Pederzolli, C., and Menestrina, G . (1991) J. Membr. Biol. 119,53-64 38. Noren, C . J., Anthony-Cahill, S. J., Griffith, M. C., and Schultz, P. G . (1989) Science 244, 182-188 39. Lesley, S. A., Brow, M. A. D., and Burgess, R. R. (1991) J. Biol. Chem. 266,2632-2638 40. Hirel, P.-H., Schmitter, J.-M., Dessen, P., Fayat, G., and Blan-

10909

quet, S. (1989) Proc. Natl. Acad. Sei. U. S. A. 86,8247-8251 41. Six, H. R., and Harshman, S. (1973) Biochemistry 12,2672-2683 42. Kato, X., and Wanatabe, M. (1980) Toxicon 18,361-365 43. Bhakdi, S., Muhly, M., and Fussle, R. (1984) Infect. Zmmun. 4 6 , 318-323 44. Issartel, J.-P., Koronakis, V., and Hughes, C. (1991) Nature 3 6 1 , 759-761 45. Bashford, C . L., Alder, G . M., Menestrina, G., Micklem, K. J., Murphy, J. J., and Pasternak,C. A. (1986) J. Biol. Chem. 2 6 1 , 9300-9308 46, Esser, A. F. (1991) Immunol. Today 12,316-318 47. Bhakdi, S., and Tranum-Jensen, J. (1991) Immunol. Today 1 2 , 318-320