Genetic polymorphism between and within ...

Genetic polymorphism between and within Meloidogyne species detected with RAPD markers PHILIPPE CASTAGNONE-SERENO,' FLAVIE VANLERBERGHE-MASUTTI, A N D FREDERIC LEROY Instirut national de la recherche agronomique, Laboratoire de biologie des invertu'bru's, BP 2078, Antibes Cu'dex, France Corresponding Editor: J . Bell Received March 1 1, 1994

Genome Downloaded from www.nrcresearchpress.com by Renmin University of China on 06/06/13 For personal use only.

Accepted July 6, 1994 CASTAGNONE-SERENO, P., VANLERBERGHE-MASUTTI, F., and LEROY, F. 1994. Genetic polymorphism between and within Meloidogyne species detected with RAPD markers. Genome, 37: 904-909. Genetic analyses were conducted on root-knot nematode populations belonging to the four major species of the genus Meloidogyne and originating from many countries throughout the world. Discrete genetic markers used in this study were random genomic DNA sequences amplified by the pol y~nerasechain reaction (RAPD). Primers of 17-30 nucleotides with 30-55% G + C content were tested. Five of them generated a total of 74 scorable markers that provided reliable polymorphisms both between and within l-,pecies.Using RAPD patterns alone or in combination, all the Meloidogyne species and populations studied could be unambiguously discriminated. Based on the presence or absence of bands, maximum-parsimony analysis of the data resulted in clustering of species and populations congruent with previous isoenzymatic and molecular data. The resulting tree confirmed the early divergence of M. hapla from the other species and also that M. arenaria is closer to M, juvanic.~than it is to M. incognitu. The bootstrap analysis significantly supported most of the specific branching observed in the topology but did not identify the three M. arenuria populations as a monophyletic group. Key words: Meloidogyne spp., parsimony, phylogenetic analysis, RAPD. CASTAGNONE-SERENO, P., VANLERBERGHE-MASUTTI, F., et LEROY,F. 1994. Genetic polymorphism between and within Meloidogyne species detected with RAPD markers. Genome, 37 : 904-909. Des analyses ginitiques ont it6 effectuies sur des populations de nimatodes a galles appartenant aux quatre especes majeures du genre Meloidogyne, originaires de divers pays au monde. Des siquences d'ADN ginomique amplifiies au hasard par riaction de polymirisation en chaine (RAPD) ont it6 utilisies comme marqueurs ginitiques discrets. Des amorces de 17 a 30 nucliotides, avec un contenu en G + C variant de 30 a 55%, ont it6 testies. Cinq d'entre elles ont g i n i r i un total de 74 marqueurs qui ont permis d'obtenir des polymorphismes fiables a la fois entre les especes et au sein de celles-ci. En utilisant les profils d'amplification seuls ou en combinaison, toutes les especes et populations de Meloidogyne utilisies dans cette itude ont pu Etre discriminies sans ambigui'ti. Fondie sur la prisence ou l'absence des bandes, l'analyse des donnies par la mithode du maximum de parcimonie a abouti a un regroupement des especes et populations en accord avec les donnies isoenzymatiques et moliculaires antirieures. L'arbre obtenu a confirmi la divergence pricoce entre M. haplu et les autres especes, ainsi que le fait que M. arenaria est plus proche de M. javanica qu'il ne I'est de M. incognitu. L'analyse en bootstrap a corrobori de faqon significative la plupart des branches de la topologie observie, mais n'a pas identifii les trois especes de M. arenaria en tant que groupe monophylitique. Mots cle's : Meloidogyne spp., parcimonie, analyse phyloginitique, RAPD.

Introduction Root-knot nematodes of the genus Meloidogyne constitute the most widely distributed group of plant-parasitic nematodes. Over the 55 described species, M. arenaria, M. incognita, and M. javanica from temperate to tropical regions, and M. hapla under cooler climates, are considered the four major species, and account for at least 90% of the estimated worldwide damages (Lamberti 1979). The three former species are known to reproduce exlusively by mitotic parthenogenesis, while M. hapla populations can reproduce by either parthenogenesis or amphimixis (Triantaphyllou 1985). As most plant resistance genes are often effective against only a subset of Meloidogyne isolates, unambiguous identification of species and populations is essential for the design of successful management practices. Although characterization of the main species has been achieved by electrophoresis of their proteins (Dickson et al. 1970; Hussey et al. 1972) or isozymes (Dalmasso and Berg6 1978), this technique cannot easily distinguish populations within one species (Janati et al. 1982). Recent advances in molecular tech' ~ u t h o to r whom correspondence should be sent. Printed I n Canada Ilrnprlrnk au Canada

nologies have provided new approaches in plant nematode diagnostics. Analysis of restriction fragment length polymorphism (RFLP) of purified genomic DNA observed in agarose gels stained with ethidium bromide revealed few differences in Meloidogyne species genotypes (Curran et al. 1985). The use of radioactively labeled DNA hybridization probes including total genomic DNA (Garate et al. 1991), randomly cloned repetitive sequences (Castagnone-Sereno et al. 199 1 ; Piotte et al. 1992), mitochondria1 DNA (Powers et al. 1986), and satellite DNA (Piotte et al. 1994) provided evidence for polymorphism at the specific and (or) subspecific levels. But needs of large amounts of biological material for DNA extraction and Southern blot experiments (from 5.10) to 1 . lo4 juveniles are needed to obtain 1 kg of total DNA) as well as use of radioactive isotopes constitute the practical limits of those promising approaches for routine diagnostic procedures. The development of the polymerase chain reaction (PCR) technique (Sai'ki et al. 1988) has provided a highly sensitive method that avoids both of these inconveniences, since a few nanograms of template DNA are enough to obtain accurate patterns and radioactivity is no longer necessary. PCR even allows the identification of

CASTAGNONE-SERENO ET AL.

TABLE1. Meloidogyne species and populations used for RAPD analysis

Genome Downloaded from www.nrcresearchpress.com by Renmin University of China on 06/06/13 For personal use only.

Population

Meloidogyne species

Origin

arerluriu arenuriu arenuria huplu huplu huplu incognitu incognitu incogn itc~ incognitcz ju vun icu juvun icu

Ain Taoujdate, Morocco Espiguette, France Monteux, France England Frontignan, France La MGle, France Calissane, France CGte d'Ivoire, Ivory Coast Tai'wan Valbonne, France La Reunion, La Reunion Island Oualidia, Morocco

TABLE2. Primers tested for RAPD analysis of Meloidogyne spp. Primer

Sequence (5'

+ 3')

Length (nts)

NOTE: Ma, M r l o i d o g y n r crrrnuritr; Mh. M . hrrplu; Mi, M . inc.o,gnircr: Mj, M . jrrl'rrtticrr: amplification pattern not reproducible.

Meloidogyne species from individual eggs or juveniles when using primers homologous to mitochondria1 D N A genes (Harris et al. 1990; Powers and Harris 1993). Recently, the four major Meloidogyne species were characterized by means of random amplified polymorphic DNA (RAPD-PCR) using 10-mer oligonucleotides as primers, but subspecific polymorphism appeared to be poor, no genomic variations being detected within M. incognita and M. javanica species (Cenis 1993). In this study, RAPD-PCR was evaluated for its ability to detect polymorphisms within and between the four major Meloidogyne species using 17-30 nucleotides long primers. Our aim was to provide new tools for genotype identification and to use the RAPD approach to estimate the degree of genetic similarity and the phylogenetic relationships within the genus.

Materials and methods Nematode populations Names and geographical origins are reported in Table 1. Each nematode population used in this study consisted of a field isolate and originated from a single female. The nematodes have been maintained in the INRA Antibes collection for several years and were identified, at the species level, according to their isoesterase electrophoretic pattern (Dalmasso and Berg6 1978). This biochemical characterization was performed on several individual females to insure that no mixture had occurred during nematode multiplication. Except for the M. huplu populations La M61e (code Mh2) and Frontignan (Mh3), which reproduce by both facultative amphimixis and meiotic parthenogenesis, all the nematode isolates used in this study belong to mitotic parthenogenetic species.

+C

60 53 53 30 53 38 50 55

ATGGATCCGC TGACCCTCCAAGAAGGT CCCTGGACGTCTACAAT CTTATTTGGATTCTTTTGCT CCTCAGGTATTTGCCAAGGCTCCTGCAGAT GCTTTCGAATTCTTAAAC ACC CGCTTGTACTTCGACATG CCCTGGACACCTACAATG

-.

%G

( k ) , species

Polymorphic bands detected 16 8 15

Species where populations can be distinguished Ma, Mh Ma, Mi(+), Mj Mh

-

19 16

Ma, Mh, Mi(&), Mj Ma(*), Mh, Mi(+)

for which s o m e but not all the populations c a n be distinguished;

DNA extruction For each nematode population, total genomic DNA was purified from I00 to 200 pL of second-stage juveniles pooled together. Nematodes were frozen in liquid nitrogen, ground with a mortar and pestle, and total genomic DNA was extracted from the resulting powder according to a phenol~hloroformprocedure (Maniatis et al. 1982). Following ethanol precipitation, DNA was resuspended in TE buffer (0.01 M Tris (pH 8) and 0.001 M EDTA) to a final concentration of 5 ng/pL and stored at -20°C. PCR procedure and electrophoretic unulysis DNA primers tested in this study were purchased from Eurogentec and are listed in Table 2. Primer 2 is 10 nucleotides long and used as control, while the length of all other primers (originally designed for other purposes) ranged from 17 to 30 nucleotides. PCR was carried out in a final volume of 25 p L containing 10 ng of genomic DNA; 80 pM of primer; dATP, dCTP, dGTP, and dTTP (Boehringer) each at 200 pM final concentration; 1 X Tuq incubation buffer and 0.25 U Tuq polymerase (Appligene). Each reaction was overlaid with 100 pL of mineral oil to prevent evaporation. Amplifications were performed on a Biometra TRIOThermoblock thermal cycler. The cycling program when using the 10-nucleotide primer was (i) 94"C, 1 min; (ii) 35 cycles of 94"C, 20 s; 36"C, 30 s; and 70°C, 2 min; and (iii) a final incubation of 70°C 10 min. As described in Akopyanz et al. (1992), the cycling program when using 17- to 2 1 -nucleotide primers was (i) 3 cycles of 94"C, 5 min; 40°C, 5 min; and 70°C, 5 min; (ii) 40 cycles of 94"C, 1 min; 55"C, 1 min; and 70°C, 2 min; and (iii) a final incubation of 70°C, 10 min. The cycling program, when using the 30-nucleotide primer, was ( i ) 2 cycles of 94"C, 5 min; 43"C, 5 min; and 70°C, 5 min, (ii) 40 cycles of 94"C, 1 min; 60°C, 1 min; and 70°C, 2 min, and (iii) a final incubation of 70°C, 10 min. Amplification products were stored at 4°C before use and separated through electrophoresis in 1.4% agarose gels in TBE

GENOME, VOL. 37, 1994

Genome Downloaded from www.nrcresearchpress.com by Renmin University of China on 06/06/13 For personal use only.

Ma1 Ma2 Ma3 Mil Mi2 Mi3 Mi4 Mjl Mj2 MhlMh2 Mh3

FIG. 1. Representative RAPD banding pattern of the 12 Meloidogyne populations tested with primer 20. Population codes are given in Table 1. Sizes of molecular weight markers are in base pairs. buffer (89 mM Tris, 89 mM boric acid, and 2 mM EDTA, pH 8.0) at a constant current of 150 mA for about 3 h. Gels were stained with ethidium bromide (0.5 pg/mL) and observed and photographed under UV light. Data analysis RAPD markers that were consistently reproduced in at least two replicate PCR reactions and that were reproducible across successive DNA extractions were taken into account for further analysis. From the whole set of reproducible RAPD bands generated in the 12 Meloidogyne populations by the different primers, only bright bands were considered and scored as present ( I ) or absent (0) in each nematode population. A global matrix, with primers in columns and populations in lines, was assembled. Only the polymorphic markers were included in the data set, and band-sharing analysis was conducted using the Dollo parsimony method in PHYLIP package version 3.4 r o v i d e d by J. Felsenstein (Department of Genetics, University of Washington, Seattle Wash.). In the Dollo parsimony algorithm, it is assumed that it is harder to gain a complex feature (state I ) than to lose it (state 0). Therefore, the probability of a reversion (from state 1 to 0) is far larger than the probability of a forward change (from state 0 to 1) over the length of time involved in the evolution of the group studied. In the case of RAPDs, it means that it is easier to lose a band than to gain it. Moreover, both characters and lineages are expected to evolve independently. Confidence limits for branches of the most parsimonious tree(s) obtained were estimated by the bootstrap approach (Felsenstein 1985).

Results Amplification of nematode DNA Eight different RAPD oligomers were used for an initial screening and five of them, which generated informative amplification products, were chosen for the whole experiment. The three others, which generally led to extremely complex and nonreproducible patterns, were subsequently no longer

used in this study (Table 2). Among the discarded primers, one was 3 0 nucleotides long with a G + C content of 53% (primer 58), while the two others were 20 and 21 nucleotides long with G + C contents of 3 0 and 3 8 % , respectively (primers 45 and 59). Scorable amplification patterns were obtained with the five other primers tested, four of them being 17 o r 18 nucleotides long and their G + C content ranging from 5 0 to 55%. Since RAPD reactions are classically carried out with decamers, primer 2 (a 10-mer oligonucleotide) was used as "positive" control. Depending o n the nematode DNA and primer combination, 3-18 reproducible bands were detected in the 0.1-2.5 kb size range. Figure I shows a typical example of RAPD banding pattern obtained with primer 20 for the 12 populations tested. Genotnic polymorphism between a n d within Meloidogyne species Each polymorphic and reproducible band in the gels was scored as one RAPD marker. Of the five primers a total of 7 4 m a r k e r s w a s o b t a i n e d , w i t h 8-19 l o c i p e r p r i m e r detected (Table 2). The occurrence of these markers in the 12 Meloidogyne genotypes tested is reported in Fig. 2. As shown in the matrix, some bands appeared to be species specific, while others were characteristic for one population within a species. Whatever the primer used, differences between M. hapla and the three other species were readily observed. A total of 13 markers were simultaneously common to M. arenaria, M. incognita, and M. javanica and absent from M. hapla. On the contrary, 11 markers were specific for the three M. hapla isolates. Primers 6 0 and 6 6 allowed to identify three of the f o u r n e m a t o d e species (M. h a p l a , M. incognita, and M. j a v a n i c a ) , while only t w o species could alternatively be differentiated with the three other primers (M. arenaria and M. incognita for primer 2, M. hapla

CASTAGNONE-SERENO ET AL.

primer 2

primer 20

primer 41 A

primer 60

primer 66

v

M. hapla

Genome Downloaded from www.nrcresearchpress.com by Renmin University of China on 06/06/13 For personal use only.

Mh3 0 0 0 Q 1 0 0 1 0 ~ ~ ~ 0 0 1 F I G . 2. Polymorphic RAPD markers observed for the 12 Meloidogyne populations tested with primers 2, 20, 4.1A, 60, and 66. Population codes are given in Table 1 . The presence of a band is denoted by a 1 , while its absence is denoted by a 0. Grey boxes correspond to markers specific for a population within a species and white boxes correspond to species-specific markers.

Mhl --)

Mi4

1

Mil

-1

MJ2 Mjl

1

M.2

1

1 M. incognita

M. javanica

M. arenaria

F I G . 3 . Phylogenetic relationships between the 12 Meloidogyne populations tested inferred from Dollo parsimony analysis. Population codes are given in Table 1. Three equally most parsimonious trees were obtained that required 11 reversions of 53 phylogenetically informative sites: (a) one of the three proposed topologies; (b and c) the two other possible relationships between populations within the M. incognita monophyletic group, the rest of the tree being identical to topology (a). Numbers are bootstrapping indices of 100 replicates of the level of support for individual nodes.

and M. incognita for primer 20, and M. hapla and M. javanica for primer 41A). With our PCR conditions, M. arenaria and M . hapla were the more polymorphic species, while M. incognita appeared to be the only species for which a single primer could not provide enough markers to discriminate between each of the four populations (Table 2). Using RAPD patterns alone or in combinations, all the rootknot nematode species and populations used in this study could be unambiguously genetically identified. Phylogenetic analysis The matrix shown in Fig. 2 was submitted to the DOLLOP program in the PHYLIP package to draw the precise relationships between the nematode genotypes tested. A total of 21 phylogenetically uninformative characters, present in only a

single population, was noticed. Three equally parsimonious unrooted trees were obtained, in which populations of the four species formed four distinct monophyletic groups. The differences between the three trees consisted into the relative organization of isolates within the M. incognita species (Fig. 3 ) . The consensus tree topology indicated a clear separation of M. hapla from the three other species. The two M. hapla populations that reproduce by both amphimixis and (or) meiotic parthenogenesis were clustered together within the M. hapla group. Among the obligate parthenogenetic species, M. arenaria and M . javanica were closer to one another than to M. incognita. The bootstrap analysis significantly supported most of the specific branching observed in the topology described above. However, the confidence interval was poor for the

908

GENOME. V O L .

Genome Downloaded from www.nrcresearchpress.com by Renmin University of China on 06/06/13 For personal use only.

M. arenaria node (bootstrap index value of 43%). On the other hand, the specific clustering of M. hapla, M. incognita, and M. javanica populations, and the close relationships between M. arenaria and M. javanica populations were supported in 92-100% of the bootstrap iterations.

Discussion In their original paper describing RAPD technology, Williams et al. (1990) reported the use of 10-nucleotide random primers to detect genomic polymorphisms, while Welsh and McClelland (1990) simultaneously obtained the same kind of results with longer primers. From these pioneer studies, standard RAPD analysis has currently been performed according to the original method of Williams et al. (1990) using 10-mer oligonucleotide primers, which are commercially available (Hadrys et al. 1992). This methodology was recently developed to identify nematodes of the genus Meloidogyne and allowed the separation of the four major species but failed to detect any infraspecific polymorphisms within M. incognita and M. javanica populations (Cenis 1993). The results reported here show the ability of primers longer than the decamers generally used to generate RAPD markers useful for genetic analysis of root-knot nematodes. Using the RAPD patterns, alone or in combination, generated by 17- to 18-nucleotide random primers with G + C content ranging from 50 to 55%, it was possible to detect genomic polymorphisms that are diagnostic at both the species and the population levels. There are few examples in the literature of useful markers generated with long primers as compared with the amount of studies that used decamers (Welsh and McClelland 1990; Welsh et al. 199 1; Akopyanz et al. 1992). From that point of view, and because polymorphisms within both M. incognita and M. javanica were detected, the genetic variability reported here should be considered an original result in the field of nematology. The fact that primers longer than 10 nucleotides seem to be more informative for Meloidogyne fingerprinting is somehow surprising but not unique, since such a result has already been observed within the pathogenic bacteria Helicobater pylori (Akopyanz et al. 1992). The phylogenetic relationships within the genus Meloidogyne inferred from this RAPD analysis are consistent with existing phylogenies deduced from both isoenzyme surveys (Dickson et al. 1970; Esbenshade and Triantaphyllou 1987) and molecular studies based on total genomic DNA (Xue et al. 1992; Castagnone-Sereno et al. 1993). Our results confirm the early divergence of M. hapla from the other species and also that M. arenaria is closer to M. javanica than it is to M. incognita. The congruence observed here among independent studies based on different characters is strong evidence for the proposed phylogenetic construction (Nadler 1990), and it also indicates that RAPD fingerprinting can easily be used for phylogenetic evaluations between closely related taxa. Even if the validity of using RAPD markers for estimating genetic similarities between populations is sometimes questionable (Black 1993), the technique looked accurate, at least under our experimental conditions, in the case of root-knot nematodes. Most variability was observed within M. arenaria and M. hapla species, for which single primers were sufficient to distinguish all the populations tested. On the contrary, only a combination of RAPD patterns allowed the unambiguous characterization of the four different M. incognita isolates.

37, 1994

No definite conclusion can be reached for M. javanica, since only two populations were tested for this species. The polymorphism we found between M. arenarin populations is in agreement with previous RAPD analysis (Cenis 1993) and is also congruent with the high isoenzymatic variability characteristic for this particular species (Dalmasso and Berg6 1983; Esbenshade and Triantaphyllou 1987). Moreover, the clustering of the three M. cirenaria isolates into a monophyletic group was supported by a very poor confidence, thus raising questions about the taxonomic status of this species. Cytological analysis of more than 100 M. arenaria populations revealed the occurrence of a most common triploid form (somatic chromosome numbers larger than 50), along with rare diploid (2n = 30-38) and hypotriploid (2n = 40-48) isolates (Triantaphyllou 1985). Based on these results, it has been assumed that the taxonomic status of the diploid and hypotriploid forms was rather uncertain. Mitochondria1 DNA restriction fragment polymorphism data also do not support that M. cirenaria is a discrete genetic unit (Hyman and Powers 199 1 ). Within the M. hapla cluster, populations Mh2 and Mh3 are closely related, while M h l is isolated from them. These relationships, strongly supported by the bootstrap analysis, are to be correlated with both the respective chromosome numbers (n = 16-17 for Mh2 and Mh3; 2n = 45 for M h l ) and mode of reproduction (meiotic parthenogenesis with facultative amphimixis for Mh2 and Mh3; mitotic parthenogenesis for M h l ) of these populations (Dalmasso and Berg6 1975). It could be argued that, because of the small sample size used in this study, the species-specific or population-specific patterns observed might no longer be significant if more isolates were analyzed within each species. From that point of view, it is clear that a more extensive sampling of populations within each species, from worldwide locations, is required to strengthen the informative value of the specific and (or) subspecific cluster(s) detected.

Acknowledgements We thank Dr. Didier Fournier for providing the oligonucleotides used as primers and Christian Slagmulder for the photographic artwork. Akopyanz, N., Bukanov, N.O., Westblom, T.U., Kresovich, S., and Berg, D.E. 1992. DNA diversity among clinical isolates of Helic.obc1ctt.r pylori detected by PCR-based RAPD fingerprinting. Nucleic Acids Res. 19: 5 137-5 142. Black, W.C., 1V. 1993. PCR with arbitrary primers: approach with care. Insect Mol. Biol. 2: 1-6. Castagnone-Sereno, P., Piotte, C., Abad, P., Bongiovanni, M., and Dalmasso, A. 199 1. Isolation of a repeated DNA probe showing polymorphism among Meloidogyne incognita populations. J. Nematol. 23: 3 16-320. Castagnone-Sereno, P., Piotte, C., Uijthof, J., Abad, P., Wajnberg, E., Vanlerberghe-Masutti, F., Bongiovanni, M., and Dalmasso, A. 1993. Phylogenetic relationships between amphimictic and parthenogenetic nematodes of the genus Meloidogyne as inferred from repetitive DNA analysis. Heredity, 70: 195-204. Cenis, J.L. 1993. Identification of four major Meloidogyne spp. by random amplified polymorphic DNA (RAPD-PCR). Phytopathology, 83: 76-80. Curran, J., Baillie, D.L., and Webster, J.M. 1985. Use of genomic DNA restriction fragment length differences to identify nematode species. Parasitology, 90: 1 37- 144. Dalmasso, A., and Berge, J.B. 1975. Variabilitd gdndtique chez les Meloidogyne et plus particulikrement chez M. hapla. Cah. ORSTOM Sdr. Biol. 10: 233-238.

CASTAGNONE.-SERENO ET AL.

Genome Downloaded from www.nrcresearchpress.com by Renmin University of China on 06/06/13 For personal use only.

Dalmasso, A., and Berge, J.B. 1978. Molecular polymorphism and phylogenetic relationship in some Meloidogyne spp.: application to the taxonomy of Meloidogyne. J. Nematol. 10: 323-332. Dalmasso, A., and Berge, J.B. 1983. Enzyme polymorphism and the concept of parthenogenetic species, exemplified by Meloidogyne. ltz Concepts in nematode systematics. Edited by A.R. Stone, H.M. Platt, and L.F. Khalil. Academic Press, London and New York. pp. 187-1 96. Dickson, D.W., Sasser, J.N., and Huishingh, D. 1970. Comparative disc-electrophoretic protein analyses of selected Meloidogyne, Ditylet~chu~s, Hererodera, and Aphelenchus spp. J. Nematol. 2: 286-293. Esbenshade, P.R., and Triantaphyllou, A.C. 1987. Enzymatic relationships and evolution in the genus Meloidogvne (Nematoda: Tylenchida). J. Nematol. 19: 8-18. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution (Lawrence, Kans.), 39: 783-79 1 . Garate, T., Robinson, M.P., Chacon, M.R., and Parkhouse, R.M.E. 1991. Characterization of species and races of the genus Meloidogyne by DNA restriction enzyme analysis. J. Nematol. 23: 4 14-420. Hadrys, H., Balik, M., and Schierwater, B. 1992. Applications of random amplified polymorphic DNA (RAPD) in molecular ecology. Mol. Ecol. 1: 55-63. Harris, T.S., Sandall, S.J., and Powers, T.O. 1990. Identification of single Meloidogyne juveniles by polymerase chain reaction amplification of mitochondrial DNA. J. Nematol. 22: 5 18-524. Hussey, R.S., Sasser, J.N., and Huishingh, D. 1972. Discelectrophoretic studies of soluble proteins and enzymes of Meloidogvne incognita and M. arenaria. J. Nematol. 4: 183-189. Hyman, B.C., and Powers, T.O. 1991. Integration of molecular data with systematics of plant parasitic nematodes. Annu. Rev. Phytopathol. 29: 89-1 07. Janati, A., Berge, J.B., Triantaphyllou, A.C., and Dalmasso, A. 1982. Nouvelles donnees sur I'utilisation des isoesterases pour l'identification des Meloidogvne. Rev. Nematol. 5: 147-1 54. Lamberti, F. 1979. Economic importance of Meloidogytze spp. in subtropical and mediterranean climates. In Root-knot nematodes (Meloidogyne species). Systematics, biology and control. Edited by F. Lamberti and C.E. Taylor. Academic Press, New York. pp. 341-357.

909

Maniatis, T., Fritsch, E., and Sambrook, J. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Nadler, S.A. 1990. Molecular approaches to studying helmith population genetics and phylogeny. Int. J. Parasitol. 20: 1 1-29. Piotte, C . , Castagnone-Sereno, P., Uijthof, J., Abad, P., Bongiovanni, M., and Dalmasso, A. 1992. Molecular characterization of species and populations of Meloidogyne from various geographic origins with repeated-DNA homologous probes. Fundam. Appl. Nematol. 15: 271-276. Piotte, C., Castagnone-Sereno, P., Bongiovanni, M., Dalmasso, A., and Abad, P. 1994. Cloning and characterization of two satellite DNAs in the low C-value genome of the nematode Meloidogyne spp. Gene, 138: 175- 180. Powers, T.O., and Harris, T.S. 1993. A polymerase chain reaction method for identification of five major Meloidogyne species. J. Nematol. 25: 1-6. Powers, T.O., Platzer, E.G., and Hyman, B.C. 1986. Speciesspecific restriction site polymorphism in root-knot nematode mitochondrial DNA. J. Nematol. 18: 288-293. Sai'ki, R.K., Gelfand, D.H., Stoffels, S., Higuchi, R., Horn, G.T., Mullis, K.B., and Erlich, H.A. 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science (Washington, D.C.), 239: 487-49 1. Triantaphyllou, A.C. 1985. Cytogenetics, cytotaxonomy and phylogeny of root-knot nematodes. In An advanced treatise on Meloidogyne. Vol. 1. Edited by J.N. Sasser and C.C. Carter. North Carolina State University Graphics, Raleigh. pp. 113-126. Welsh, J., and McClelland, M. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res. 18: 72 13-72 18. Welsh, J., Petersen, C., and McClelland, M. 1991. Polymorphisms generated by arbitrarily primed PCR in the mouse: application to strain identification and genetic mapping. Nucleic Acids Res. 19: 303-306. Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A., and Tingey, S.V. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18: 653 1-6535. Xue, B., Baillie, D.L., Beckenbach, K., and Webster, J.M. 1992. DNA hybridization probes for studying the affinities of three Meloidogyne populations. Fundam. Appl. Nematol. 15: 35-41.