Geographic correlation of morphological and ...

Published 29 March 2004

Phycologia (2004) Volume 43 (2), 204-214

Geographic correlation of morphological and molecular variation in Silvetia compressa (Fucaceae, Fucales, Phaeophyceae) PAUL C. SILVAi*, FRANCISCO F. PEDROCHEi,2, MAX E, CHACANA i , RA(iL AGUILAR-RoSAS3, LUIS E. AGUILAR-RoSAS4 AND JENNIFER RAUM5

iUniversity Herbarium, University of California, Berkeley, CA 94720-2465, USA 2Departamento de Hidrobiolog(a, Universidad Autonoma Metropolitana - Iztapalapa, Apdo, Postal 55-535, Mexico D,F. 09340, Mexico 3Facultad de Ciencias Marinas, Universidad Autonoma de Baja California, Apdo. Postal 453, Ensenada, Baja California, Mexico 4Instituto de Investigaciones Oceanologicas, Universidad Autonoma de Baja California, Apdo. Postal 453, Ensenada, Baja California, Mexico 5Department of Biology, University of California, Santa Cruz, CA 95064, USA

P.c. SILVA, F.F. PEDROCHE, M.E. CHACANA, R. AGUILAR-RoSAS, L.E. AGUILAR-RoSAS AND J. RAUM. 2004. Geographic cor­ relation of morphological and molecular variation in Silveria compressa (Fucaceae, Fucales, Phaeophyceae). Phyc% gia 43: 204-2 14, Silvetia compressa is a common member of the upper intertidal fucoid community on the Pacific coast of North America from Humboldt County, California, to Punta Baja, Baja California, Mexico, including coastal islands. On the mainland, there is considerable morphological variability involving robustness, branching pattern, and size and shape of receptacles. A latitudinal cline is not evident. By contrast, there is relatively little morphological variability among populations in the Channel Islands of southern California and coastal islands of northern Baja California, These insular populations are per­ ceptibly distinct from all mainland populations except for several in northern Baja California. After comparing populations from various parts of the range of the species, including all coastal islands, we conclude that two subspecies may be recognized. In subsp, compressa, which occurs only on the mainland, the frond is robust and straggly, with dichotomous branching that tends to be irregular, and with linear receptacles often tapered to a point. In the newly described subsp. deliquescens, which is chiefly insular but also occurs on the coast of northern Baja California, the fronds form hemispherical clumps, with densely and regularly branched slender axes and short, blunt, ellipsoidal receptacles. A few populations on the Monterey Peninsula in which the fronds are unusually delicate were described by Setchell and Gardner as f. gracilis, to which was assigned a population from Santa Catalina Island. We conclude that the Monterey Peninsula populations of f. gracilis constitute an ecotype of subsp, compressa, whereas the Santa Catalina Island popUlation is referable to subsp. deliquescens. Comparison of nucleotide sequences from the ITS regions of rDNA revealed no molecular differentiation in populations of subsp. compressa from Baja California and central California, including those assignable to f. gracilis. The sequence in the three populations of subsp, deliquescens was identical, but differed by 2 bp (0.3%) from that of subsp, compressa.

INTRODUCTION

by meiotic division of the oogonial nucleus. The perspicacious French phycologists did not need these details, however, and

Generic considerations After comparing the reproductive structures of four species of Fucus Linnaeus common along the Atlantic coast of France, Decaisne & Thuret (1845) concluded that four different gen­ era should be recognized. They considered two characters to be of diagnostic value: (1) the occurrence of oogonia and an­ theridia in relation to individual conceptacles and individual thalli and (2) the number of 'sporules' (eggs) into which the 'epispore' (oogonium) divides. The first character - whether oogonia and antheridia occur on separate thalli or, if on the same thallus, whether they occur in unisexual or bisexual con­ ceptacles - is now considered of diagnostic value only at the species level. The second character has subsequently been re­ inforced as a generic criterion by the addition of cytological details stemming from the discovery of meiosis and recogni­ tion that the formation of eggs in the conceptacle is preceded

proposed that the genus Fucus be reserved for such species

as F. serratus Linnaeus and F. vesiculosus Linnaeus, in which

the oogonium produces eight eggs. For F. nodosus Linnaeus,

in which only four eggs are produced, they proposed the ge­

nus Ozothallia, a genus previously named Ascophylla by Stackhouse (1809), now accepted with the conserved spelling Ascophyllum. For the alga passing under the incorrect name F. tuberculatus Hudson, in which oogonia are clustered on the floor of a bisexual conceptacle and produce only one egg each, they proposed the genus Cymaduse, a genus previously named Bifurcaria by Stackhouse (1809) and now placed in

the Cystoseiraceae rather than the Fucaceae. Lastly, for F.

canaliculatus Linnaeus, in which only two eggs are produced,

they proposed the genus Pelvetia, named for a French natu­ ralist of unknown accomplishments. Meanwhile, two species had been described from California that would eventually be assigned to the erstwhile monospe­

* Corresponding author ([email protected]).

204

cific Pelvetia: F. compressus C. Agardh (Agardh 1824) and

Silva et al.: Morphological variation in Silvetia compressa F. jastigiatus J. Agardh (Agardh 1841). The taxonomic and

nomenclatural history of these species was discussed by Silva (1996), who concluded that only one species was involved and that its correct name was P. compressa (J. Agardh) De Toni. Subsequent to the establishment of Pelvetia, Harvey (1860) described two species from Japan that would eventu­ ally be assigned to that genus: F. babingtonii and F. wrightii. The taxonomic and nomenclatural history of the Japanese spe­ cies was discussed by Yoshida & Silva (1992), who concluded that only one species was involved and that its correct name was P. babingtonii (Harvey) De Toni. A fourth species, P. siliquosa, was described from China by Tseng & Chang (1953). Primarily on the basis of a cytological character to be dis­ cussed in detail later in this introduction, namely, that the two eggs are separated by a horizontal division in P. canaliculata, whereas they are separated by a longitudinal or oblique divi­ sion in the three Pacific species of Pelvetia, Song et ai. (1996) suggested that there was an urgent need to re-examine all species of the genus. Molecular data in support of the generic segregation of the three Pacific species of Pelvetia were first provided in an abstract by Serrao & Brawley (1997), who compared nucleotide sequences of the internal transcribed spacer (ITS) regions of the genome of these three species together with the type species, P. canaliculata. The results of this study were published in extenso by Serrao et ai. (1999). Further support was provided by the results of a simultaneous and independent study undertaken by W.J. Lee et ai. (1998), who compared nucleotide sequences of small subunit ribo­ somal DNA (SSU rDNA) in P. babingtonii and P. canalicu­ lata. Serrao et al. (1999) found that P. canaliculata is more closely related to Fucus, Hesperophycus Setchell & Gardner, and Pelvetiopsis Gardner than to the Pacific species of Pel­ vetia. Primarily on the basis of molecular data, Serrao and Brawley, joined by two Korean authors, established the genus Silvetia Serrao, Cho, Boo & Brawley (Serrao et al. 1999) to receive the three Pacific species formerly placed in Pelvetia. The Korean co-authors contributed to the diagnosis of Silvetia the cytological character mentioned previously in this intro­ duction, namely, the plane of division separating the two eggs. Longitudinal division in the oogonium of S. compressa (1. Agardh) Serrao et al. was illustrated by Harvey (1852, pl. 3A, as F. jastigiatus), but not discussed. A similar division was observed in S. babingtonii (Harvey) Serrao et ai. by Yendo (1907, p. 25, as P. wrightii), who was of the opinion that 'This character would not be important enough to walTant a claim for a new generic position for the species. . .'. In S. siliquosa (Tseng & Chang) Serrao et a i., Tseng & Chang (1953, p. 294) found that the two eggs 'are generally longitudinally or slight­ ly obliquely separated from each other'. Abnormal divisions were noted in S. compressa by Gardner (1910, p. 130) and in S. siliquosa by Tseng & Chang (i.e.) and Song et al. (1996). Gardner (1910, p. 13 I) pointed out an additional cytological difference between S. compressa and P. canaliculata, namely, that the six supernumerary nuclei are cast out in the centre between the two eggs in S. compressa rather than on the sur­ face as in P. canaliculata. Cho et al. (2001) have shown that S. babingtonii and S. siliquosa agree with S. compressa with regard to this character. Support for the new genus has been provided most recently by comparisons among nucleotide se­ quences of the Rubisco spacer region (YK. Lee et al. 1999)

205

and by detailed morphological observations, emphasizing egg development (Cho et al. 200 I). Specific considerations Silvetia compressa is a common alga in the upper midtidal zone on rocky coasts from Shelter Cove, Humboldt County, California, to just south of Punta Baja, Baja California, in­ cluding all coastal islands except the Farallons. In both habit and habitat it is so distinctive that collectors have been able to put a name on their specimens without having to discrim­ inate among closely related taxa with overlapping patterns of morphological variability. The only variant that has been rec­ ognized taxonomically is a group of small populations of rel­ atively delicate thalli that occur at Pebble Beach and Pacific Grove on the Monterey Peninsula. This variant was named P. jastigiata f. gracilis by Setchell and Gardner (Gardner 1917), who assigned to it also a specimen from Santa Catalina Island. At that time, this specimen was the only one from the Channel Islands known to Setchell and Gardner. At the present time, abundant material from all the islands is available, calling into question the relationship between insular and mainland pop­ ulations. This paper presents the results of an attempt to cor­ relate the intraspecific morphological variability of S. com­ pressa with geography, using molecular data as supporting evidence.

MATERIAL AND METHODS Morphological study Collections of Silvetia in the herbaria of the University of California, Berkeley, California (UC: 109 sheets and numer­ ous duplicates), and Escuela Superior de Ciencias Marinas, Universidad Aut6noma de Baja California, Ensenada (CMMEX: 38 sheets), were supplemented by material bor­ rowed from the US National Herbarium (US: 184 sheets), Los Angeles County Museum (LAM: 48 sheets), and New York Botanical Garden (NY: 42 sheets). For each specimen, the following information was recorded: overall appearance, max­ imum length and diameter of mature receptacles, diameter of basal and middle portions of the primary axes, number of dichotomies (orders of branching), and length of interdicho­ tomies. To determine possible relationships among habitat, thallus structure, and latitude, similar information was ob­ tained from fi ve samples collected between February and April 2001 from each of 12 sites in central California: Dux­ bury Reef (Marin County); Pigeon Point (San Mateo County); Waddell Creek, Scott Creek, Sand Hill Bluff, and Terrace Point (Santa Cruz County); and Hopkins Marine Station, Still­ water Cove, Point Lobos, Soberanes Point, Andrew Molera and Mill Creek (Monterey County), representing a range of about 400 krn. Physical features of each site were noted, in­ cluding degree of exposure and proximity to upwelled water. Molecular study Collection data for the algae used in this study are given in Table 1. Voucher specimens have been deposited at Uc. Thalli dried in silica gel or frozen were rinsed in distilled water and checked microscopically to avoid epiphytes before being

206

Phycologia, Vol. 43 (2), 2004

Table 1. Collection data for samples used in sequencing ITS regions. Subspecies compressa compressa compressa compressa ('f. gracilis') compressa ('f. gracilis') deliquescens de/iquescens deliquescens

Locality

Date

Agua Blanca, Baj a California Pta. Morro, Baja California Islas de Todos Santos Sur, Baja California Pacific Grove, California Pebble Beach, California Isla Los Coronados Sur, Baja California Punta Mezquite, Baja California Rancho Packard, Baja California

ground. Total genomic DNA was extracted using hexadecyl­

trimethylammonium bromide (CTAB) buffer (Doyle & Doyle 1987) or with a DNeasy Plant Mini Kit (Qiagen, Hilden, Ger­ many). Quality of genomic DNA was estimated on J % aga­ rose gels. Double-stranded DNA copies of the ITS regions were amplified from genomic DNA using the polymerase chain reaction (PCR) in 25 ].LI reaction mixtures, which in­ cluded ITS5 forward primer (GGAAGTAAAAGTCGTAA­ CAAG) and ITS4 reverse primer (TCCTCCGCTTATTGA­ TATGC) (White et al. 1990). Conditions for PCR were 5 min at 94°C for initial denaturation, followed by 45 cycles of I

min at 97°C, 2 min at 48-52°C for annealing, 3 min at 72°C for primer extension and, after the cycles, a final 15 min in­ cubation at 72°C to complete the reaction. A negative and a positive control was included in each set of reactions. To de­ termine their yield and size, PCR products were separated on 1 % agarose gels and checked by a 100 bp ladder. Amplified DNAs were purified using a QIAquick PCR purification kit (Qiagen). The PCR products from one to three individuals per population were cycle sequenced using a Thermo Sequenase Cycle Sequencing Kit (Amersham Pharmacia Biotech, Little Chalfont, UK) in an ABI 377 automated sequencer (Applied Biosystems, Foster City, CA, USA). Because of the extension of the ITS regions, we also employed internal primers F2 (TCACTGGATTCTGCAAGTCG) and F3 (GCGACTTGCA­ GAATCCAGTG) designed by Serrao et al. (1999). The ITS 1 region was amplified using ITS5 and F2 primers, whereas the ITS 2 region was amplified using ITS4 and F3 primers. Sequences from both strands from each sample were edited using the software Sequencer Navigator version 1.0.1 (Ap­ plied Biosystems) and aligned manually or with the help of CLUSTAL option in Sequencer Navigator. Resultant align­ ments were compared with S. compressa sequences deposited in GenBank (AF102956).

12 26 19 28 28 20 27 26

Jan. Feb. Mar. Mar. Mar. Mar. Jan. Feb.

1998 1999 2000 1999 1999 2000 1999 1999

Collector R. Aguilar-Rosas L. Aguilar-Rosas F.F. Pedroche Silva et al. Silva et al. F.P. Pedroche L. Aguilar-Rosas L. Aguilar-Rosas

RESUL TS AND DISCUSSION Morphological study Examination by the first author of approximately 300 speci­ mens of S. compressa collected by other workers confirmed the conclusion that he had drawn previously from his own fieldwork, namely, that this species exhibits more morpholog­ ical variation than has previously been acknowledged. Vari­ able morphological features include the size, robustness, and shape of the thallus, the regularity of branching, the number and spacing of dichotomies, and the size and shape of the receptacles. On the California mainland, thalli of S. compressa are usually robust (Fig. 1) and have long, tapered receptacles (Fig. 17C). Unequal development of the two branches of a dichotomy coupled with indeterminate growth often results in tall, straggly plants. The tallest (to c. 0.9 m) and oldest of these usually have massive bases, with the lowermost part of the axis compressed and occasionally as broad as 12 mm (Fig. 2). Most often, however, the axis is 4-5 mm broad basally and about 3 mm broad in the middle portion, becoming some­ what more slender distally. The distance between the dichot­ omies is highly variable, even in one plant, ranging from less than 10 mm to more than 70 mm and tending to be shorter distally, so that the branching never gives the impression of being uniformly and closely dichotomous. Fastigiate branch­ ing is common, as a response either to grazing or to some unknown internal signal. The clusters of regenerating branch­ es are unmistakably different from normal polychotomies. Morphometry conducted in central California to ascertain possible interrelationships of habitat, thallus structure, and lat­ itude (see Material and Methods) demonstrated strong intra­ thallus correlation for all measured characters: the longest thalli usually had the largest number of dichotomies, the most irregular branching, the longest internodes, the thickest lower

Table 2. Morphological comparison of the two subspecies of S. compressa. Character Habit Branching Order of branching Thickness of axis Maximum length Receptacle shape Receptacle size

Subsp. compressa straggly irregularly dichotomous, often fastigiate usually 8- 12 4-5(-12) mm at base, 3 mm midthallus, taper­ ing slightly towards apex 90 cm linear, often tapered to a point, at times with sterile tip 3-5 mm broad, 20-40(-97) mm long

Subsp. deliquescens compact, hemispherical regularly dichotomous profuse usually 10-20 4-5 mm at base, 2-3 mm midthallus, 1-2 mm distally usually less than 35 mm ellipsoidal, blunt, frequently bifurcate, without sterile tip 2.5-3.5 mm broad, (2-)3-5(-8) mm long

Silva et al.: Morphological variation in Silvetia compressa

2 Figs 1-4. Silvelia compressa subsp. compressa. Scale = 40 ffiffi. Fig. !. Typical thallus (Silva j j 148. Arena Cove, Mendocino County, California, 17 May 1972, UC). Fig. 2. Base of very old plant from same col lection, showing regeneration. Fig. 3. Thallus with unusually long receptacles (Hollenberg 1286, Point Dume, Los Angeles County, California, 3 1 March 1935, US). Fig. 4. 'f. gracilis' (J. Norris 1 05, Pebble Beach, Monterey County, California, 16 June 1969, US).

207

208

Phycoiogia, Vol. 43 (2), 2004

"'luth ta",tfg1 r ettt rrleninGcrdn-r

Looeolity, S.ntaC...I'�.I.lu4

C..U.