Identification and validation of polymorphic

Journal of Microbiological Methods 110 (2015) 61–67

Contents lists available at ScienceDirect

Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth

Identification and validation of polymorphic microsatellite loci for the analysis of Phytophthora nicotianae populations Antonio Biasi a, Frank Martin b, Leonardo Schena a,⁎ a b

Dipartimento di Agraria, Università degli Studi Mediterranea, Località Feo di Vito, 89122 Reggio Calabria, Italy United States Department of Agriculture—Agricultural Research Service, 1636 East Alisal Street, 93905 Salinas, CA, United States

a r t i c l e

i n f o

Article history: Received 18 November 2014 Received in revised form 13 January 2015 Accepted 14 January 2015 Available online 17 January 2015 Keywords: Phytophthora parasitica P. nicotianae Microsatellites SSRs

a b s t r a c t A large number of SSR loci were screened in the genomic assemblies of 14 different isolates of Phytophthora nicotianae and primers were developed for amplification of 17 markers distributed among different contigs. These loci were highly polymorphic and amplified from genetically distant isolates of the pathogen. Among these, nine were further validated using a multiplexed genotyping assay with differentially labeled primers (FAM or HEX) to allow for duplex PCR amplification. The use of reverse primers with a 5′ PIG tail was important to increase the quality and reliability of the analyses. A total of 46 alleles were detected in 5 tester isolates of P. nicotianae representing the breadth of diversity in the species. Furthermore, a high incidence of heterozygosity was determined with two alleles detected in 67% of the primer/isolate combinations. Three different alleles where detected for a single locus/isolate combination, indicating variation in ploidy. These markers represent a valuable new tool for the characterization of populations of P. nicotianae. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Microsatellites, or simple sequence repeats (SSRs), are tandemly repeated motifs of one to six bases distributed in all eukaryotic genomes with a variable frequency among different organisms (Selkoe and Tonnen, 2006). They are appropriate for a number of applications, including fingerprinting, parentage analyses, genetic mapping and structure analyses (Ellegren, 2004; Jones et al., 2010). For these reasons, the availability of a validated panel of SSR markers is a valuable tool for the accurate characterization of populations in a number of different organisms, including plant pathogens. The design of reliable SSR markers requires careful selection and optimization in order to avoid a number of challenges that could limit their utility and/or confound results of the analyses. An important issue is the presence of homoplasy, i.e. a phenomenon that dampens the visible allelic diversity of populations and may inflate estimates of gene flow when mutation rate is high (Blankenship et al., 2002). In particular, alleles can be identical in sequence but not identical by descent. Such non-identity occurs when there is a back-mutation to a previously existing size or when two unrelated alleles converge in sequence by changing repeat number in two different places in the sequence (Selkoe and Tonnen, 2006). However, it has been reported that when an appropriate number of high variable SSRs is selected, homoplasy does not present a significant problem in population genetic analyses since the large amount of variability at microsatellite loci compensates ⁎ Corresponding author. E-mail address: [email protected] (L. Schena).

http://dx.doi.org/10.1016/j.mimet.2015.01.012 0167-7012/© 2015 Elsevier B.V. All rights reserved.

for their homoplasious evolution (Estoup et al., 2002). Furthermore, the presence of mutation in the primer region and the quality of DNA may strongly decrease or prevent amplification of target loci (Paetkau and Strobeck, 1995). Another possible issue when working with SSR markers concerns the interpretation of the data. Stutter peaks are minor peaks generated through strand slippage during amplification by the DNA-polymerase which generate incorrect amplicons, typically repeat unit length shorter or longer than the real allele fragment (Walsh et al., 1996). Stutter peaks can interfere with data interpretation by artificially increasing the number of alleles or by preventing the detection of alleles that co-localize in the same position on a chromatogram. In addition, some alleles can be underestimated because of an imbalance of the allele peak height or peak area ratios at heterozygous loci (Leclair et al, 2004). In recent years SSRs have been proposed as powerful markers to study the population biology, epidemiology, genetics and evolution of plant pathogenic Phytophthora species (Schena et al., 2008). Indeed microsatellites are largely accepted as the most powerful tool for investigating the genetic structure and the reproductive biology of this important genus of plant pathogens, although a limitation to their wider exploitation is the need for prior sequence data to identify SSR loci and design primers in the flanking regions for their amplification (Schena et al., 2008). Methods for the discovery of SSR loci have been based on constructing genomic DNA libraries enriched for SSR sequences. These methods were utilized for Phytophthora cinnamomi and Phytophthora ramorum, however, they are time-consuming and the sequencing of DNA libraries required is expensive (Dobrowolski et al., 2002; Prospero et al., 2004).

62

A. Biasi et al. / Journal of Microbiological Methods 110 (2015) 61–67

In recent years, the use of SSR markers has sharply increased by the use of next-generation sequencing (NGS) technologies that are enabling the genomic sequencing of an increasing number of species, thus facilitating the identification of large numbers of SSR loci (Guichoux et al., 2011). Specific SSR markers have been developed and used for the study of several Phytophthora species including Phytophthora infestans (Knapova and Gisi, 2002; Cooke et al., 2003; Lees et al., 2006; Li et al., 2013), Phytophthora alni (Ioos et al, 2007), Phytophthora ramorum (Ivors et al, 2006; Prospero et al., 2007; Mascheretti et al., 2008), Phytophthora sojae (Stewart et al., 2014), Phytophthora capsici (Hu et al., 2013), and Phytophthora plurivora, Phytophthora multivora, and Phytophthora pini (Schoebel et al., 2013, 2014). In November, 2011 a 71 Mb draft assembly of the entire genome of Phytophthora nicotianae was made available to the scientific community (http://www. broadinstitute.org) facilitating a number of new possible research opportunities, including SSR analyses. The first sequenced genome of P. nicotianae was for an isolate from Australia (INRA-310) and has been followed by analysis of 13 additional genomes representative of the genetic diversity within the species (Phytophthora parasitica Assembly Dev initiative, Broad Institute; https://olive.broadinstitute.org/ projects/phytophthora_parasitica). The objective of the present study was the identification, selection and validation of a panel of SSRs for the characterization of P. nicotianae taking advantage of the recently released genomes of this important plant pathogen for marker design. P. nicotianae stands out among plant pathogens since it is a threat to plant productivity on a global scale for a broad range of hosts (Erwin and Ribeiro, 1996). Cline et al. (2008) reported that the host range of P. nicotianae included 255 plant genera in 90 families. Among the several plant species this pathogen can infect it is worth mentioning Nicotianae and Citrus spp., since P. nicotianae is causal agent of the Black Shank and the citrus root rot and gummosis, respectively (the latter is also caused by Phytophthora citrophthora) (Cacciola and Magnano di San Lio, 2008). Apart from Nicotiana tabacum and Citrus species, P. nicotianae is responsible for heavy losses on a number of other economically important species, such as fruit trees and herbaceous hosts (Erwin and Ribeiro, 1996). Recent surveys have revealed that this species is one of the most common pathogen on ornamental plants, the cultivation and sale of which has been recognized as a principal pathway for the introduction and spread of invasive plant pathogens (Moralejo et al., 2009; Leonberger et al., 2013; Bienapfl and Balci, 2014). Given its heterothallic mating system (requires two isolates of opposite mating type) and global distribution it is important to obtain a better understanding of its population structure and the impact of sexual recombination on the genotypic diversity observed in nature. 2. Materials and methods

evaluate the consistency of the target regions among genomes. Regions with indels in the primer annealing sites in at least one of the sequenced genomes or containing indels not representative of SSR motifs were not investigated further. In a few cases primers were slightly modified by introducing degenerations or redesigned closer to the SSR motif to ensure a broader ability to amplify target loci in multiple isolates. The uniqueness of the primer sequences within the genome was also checked by BLAST analysis using BioEdit (Hall, 1999) in order to minimize the risk of mispriming and the consequent amplification of nonspecific fragments. Based on these comparisons 17 SSR loci were selected for further analyses taking into account amplicon length, motif type and the distribution of SSRs among different contigs. 2.2. DNA amplification and sequencing Five isolates (Table 2) representative of different P. nicotianae clades (Mammella et al., 2011) were utilized to experimentally evaluate the in silico selected SSRs. Total DNA was extracted as described by Ippolito et al. (2002) and amplified with all selected primers using different MgCl2 concentrations in order to optimize amplification conditions. Selected amplification conditions consisted of 1 cycle of 94 °C for 3 min followed by 35 cycles of 94 °C for 30s, 59 °C for 30 s, 72 °C for 45 s and a final extension cycle of 72 °C for 10 min. Reactions were performed in a total volume of 25 μl containing 15 ng of DNA, 1× PCR buffer, 2 or 3 mM MgCl2 (Table 3), 0.2 mM dNTPs, 1 unit AmpliTaq (Applied Biosystems, Foster City, CA) and 0.1 μM of each primer. PCR products were separated on 3% agarose gels in 1× Tris–borate–EDTA buffer and visualized with UV light after staining in ethidium bromide. Amplified fragments were visually inspected to confirm consistent amplification of PCR fragments of the expected size from all P. nicotianae isolates and selected PCR products (between 2 and 5 per each SSRs) were cloned with the TOPO® TA Cloning™ kit (Invitrogen, Carlsbad, California) and One Shot® TOP10 Escherichia coli cells according to the manufacturer's instructions. At least 10 E. coli recombinant colonies per isolate were randomly selected and analyzed by colony PCR (a small amount of a colony sampled with a sterile pipette tip was added to amplification mixtures) using plasmid primers T7 and T3 (Invitrogen) for amplification. Amplifications were performed as described above. Single PCR bands were purified with the ExoSAP-IT kit (Affimetrix, Santa Clara, CA) and sequenced with the same primers utilized for the amplification with BigDye® Direct Cycle Sequencing Kit on an ABI3500 automated sequencer (Life Technologies, Grand Island, NY). 2.3. Validation of SSR primers Seventeen selected primers were fluorescently labeled for detection on the ABI 3500 DNA Analyzer (Applied Biosystems) and validated in an

2.1. Identification and in silico evaluation of SSRs The complete panel of contigs (708) of the nuclear genome of isolate INRA-310 of P. nicotianae (http://www.broadinstitute.org) was analyzed to screen SSR regions and design corresponding primers for amplifications using the Batch Primer3 software (You et al., 2008). Contigs were scanned for the presence of microsatellites, defined as short tandem repeat motifs (SSRs) of 2–6 bp. SSRs were selected with a minimal acceptable number of repeats of 6 for dinucleotide motifs, 4 for trinucleotide motifs and 3 for tetranucleotide, pentanucleotide and hexanucleotide motifs. Primers flanking all identified loci were designed using the following criteria: TM of 50–60 °C (optimum at 55 °C), product size of 100– 450 bp (optimum at 200 bp), GC content of 30–60% (optimum at 50%), and primer size of 18–21 bp (optimum at 20 bp). Among the complete panel of identified SSRs, 200 were selected according to their length and type of repeats and compared against 13 other currently available genomes of P. nicotianae (https://olive. broadinstitute.org/projects/phytophthora_parasitica) (Table 1) with the software Geneious 5.5.9 (Biomatters, Auckland, NZ) in order to

Table 1 Genomes of Phytophthora nicotianae utilized in the present study for the design and in silico evaluation of SSRs (https://olive.broadinstitute.org/projects/phytophthora_parasitica). Isolates

Host

Origin

Mating type

INRA-310 149 PN47 364 H02 329 P1976 CJ02B3 CJ01A1 P10297 IAC01/95 CJ05E6 P1569 CHvinca01

Nicotiana tabacum Lycopersicon esculentum Capsicum annuum Theobroma cacao Vanilla spp. Nicotiana tabacum Solanum lycopersicum Nicotiana tabacum Nicotiana tabacum Dieffenbachia exotica Citrus sp. Nicotiana tabacum Citrus sp. Vinca sp.

Australia Spain Spain Cuba French Polynesia Greece California Virginia Virginia Florida Brazil Virginia California Virginia

A1 A2 N.D. A2 N.D. A2 A2 A2 A2 A2 N.D. A2 A1 N.D.

N.D. = not determined.

A. Biasi et al. / Journal of Microbiological Methods 110 (2015) 61–67 Table 2 Isolates of Phytophthora nicotianae representative of different mitochondrial haplotype clades (Mammella et al., 2011, 2013) utilized for the experimental evaluation of SSR primers. Isolates

Host

Origin

Mating type

Clade

Albicocco 9 Ceanothus Ferrara R3 TL8VP Hybiscus B

Prunus armeniaca Ceanothus sp. Citrus aurantium Lavandula sp. Hibiscus rosa-chinensis

Sicily, Italy Sicily, Italy Sicily, Italy Piedmont, Italy Calabria, Italy

A2 A2 A1 A2 A2

N1 N2 N3 N4 N5

automated genotype assays. Preliminary analyses enabled the selection of the 9 top performing loci that were tested with five representative isolates of P. nicotianae (Table 2). Forward primers for each SSR locus were labeled with two alternative fluorescent dyes (6-FAM or HEX; Integrated DNA Technologies, Coralville, Iowa) to be used in duplex analyses (Table 3). In order to evaluate the incidence of stutter peaks, amplifications were performed using reverse primers either with or without a 5′ “GTTT” PIG tail (Brownstein et al., 1996). Amplifications were conducted as described above. Fluorescent labeled PCR products were analyzed using an ABI3500 DNA Analyzer with samples initially run diluted 50, 100, 250 and 500 times in order to determine the optimal concentration for running the assays. Two microliters of diluted PCR products was mixed with 8.5 μl of Hi-Di formamide and 0.5 μl of Gene Scan 600 LIZ (Applied Biosystems) and analyzed according to the manufacturer's instructions.

3. Results 3.1. Identification and in silico evaluation of SSRs The analysis of the genome of isolate INRA-310 of P. nicotianae using the Batch Primer 3 software identified 5118 SSR loci with corresponding amplification primers designed in the flanking regions (Annex 1). Trinucleotides (51.6%) represented the most abundant microsatellites followed by tetra- (25.6%), di- (14.1%), esa- (4.6%) and pentanucleotides (4.2%) (Table 4). The most widespread motifs were AAG, detected 138 times, followed by several other trinucleotide and some dinucleotide motifs (Annex 1). SSRs (200) that were repeated at least 5, 7, 8 and 16 times for pentanucleotides, tetranucleotides, trinucleotides, and dinucleotides, respectively, were selected for further study. BLAST analysis of the loci

63

Table 4 Summarizing table of SSRs identified within the genome of Phytophthora nicotianae, isolate INRA-310, using the Batch Primer3 software. Motif length

Count

Percentage

Di Tri Tetra Penta Hexa

720 2641 1308 215 235

14.1 51.6 25.6 4.2 4.6

against the genomes of 13 different P. nicotianae isolates enabled the selection of regions having a higher level of SSR polymorphism and the absence of variation in the primer annealing sites. In an effort to reduce the potential that the markers were closely linked, only one locus per contig was selected. Based on this analysis, 17 SSRs (10 dinucleotides, 5 trinucleotides and 2 tetranucleotides) were identified that had at least 5 different SSR lengths in the 14 genomes analyzed in silico (Table 5). 3.2. DNA amplification and sequencing of selected SSRs The experimental evaluation of 17 selected SSRs using 5 isolates of P. nicotianae representative of different clades (Table 2) produced a positive amplification with all primer/isolate combinations. The cloning and sequencing of amplicons from 2 to 5 isolates for each locus, confirmed the amplification of the expected fragments for all primers and isolates. A few single nucleotide polymorphisms (SNPs) were identified in the flanking regions but since this would not interfere with data analysis these loci were retained. Sequence analysis revealed a high level of polymorphism and heterozygosity with the number of alleles ranging from 1 to 5 per locus (Table 6). 3.3. Validation of SSR primers The reliability of amplification for the 17 selected loci was evaluated using fluorescently labeled primers. In preliminary analyses all primer pairs were suitable for genotyping P. nicotianae (data not shown), however, 9 SSRs were selected for further analysis because of more robust amplification. These markers were validated in duplex PCR by genotyping 5 isolates representative of the genetic diversity within P. nicotianae (Table 7). The 100-fold dilution of PCR amplicons was found to be the most appropriate for fluorescent genotype analyses.

Table 3 List of SSRs selected in the present study along with primer sequences, fluorescent dyes and MgCl2 concentration utilized in optimized PCR reactions. Locusa

SSR motif

Amplicon length (bp)

Dye

P5(1) P15(2) P17(1) P44(5) P334(6) P493(5) P643(3) P788(3) P853(6) P1129(4) P1509(8) P1511(8) P1512(7) P2039(4) P2040(2) P2459 P4560(7)

TGTC TAC AAC TC CA CT GT GA TCTG GTA GT TG CT CGA AGT CT TC

188–224 66–114 126–162 173–223 125–159 125–173 146–206 123–137 138–210 138–168 118–182 140–172 144–178 96–120 153–165 125–165 98–136

HEX FAM FAM HEX FAM FAM HEX FAM HEX HEX FAM HEX HEX FAM HEX HEX FAM

a

Equal numbers in parenthesis indicate primers amplified in duplex reactions.

Primer sequence (5′–3′) Forward

Reverse

CAAGCCCGCTGAGGTTGAA AGCTTCTGCAGTAACGGTAA GTCCTCAGGGATCAGCACAT TTCCTCCTGACCAGACGAGT TCCGCAGTCTTCAYGAGTAA CCGATTGAGGCCATGTGAAA TTTCAATCGTTTGACCATGC GATGGCAAACCGCCCGACTT TTGAAGCTAGGGCCATTATCA CAGCCTCCAGATATGTTCAT CTAAGCCTAGCCAATCCAAAC CAACAACGTGTGTCTGGTACG GTCACCGGCATTGCTAAACT GCAGTCGGTTGGATTGATCA ACGAGTTTGGGCATCGTTTA GCTGGTCGACYTAACGTCTC AGAAGACGCTGCGTGAATTT

CTCCGAGGTCCAAATGTGAT CGATCAAAGATTACTGCAACT TGGATATCGTTCCCGTTGTT TTCCGCTGCCAAAGAAGCWCG TCACCGCAAGAATCGAGTCRT AAGAGTATGTTGGTGARCAC CAAGTCCAAACCGTCCTGTC CGAGAAGCAGCAGAAGAAGC CCAATCAACAGTCCGGAAAT TGTTAGGGGTCTCCAACTGC CCAGCTTGACGCCGGGATTA CTAGGACGTGCTCGGAAATC CAAACGGGAGTTTCGTTATCA TGAACCTTGTCCAGATTATTG ATTTTCGCACGGARGAGAT CATCGTCCCGGTAAACAAAG CACCTACAGCAGACGAGCTG

MgCl2 (mM) 2 2 2 3 2 2 2 3 2 3 2 3 2 2 3 3 3

64

A. Biasi et al. / Journal of Microbiological Methods 110 (2015) 61–67

Table 5 Number of repeats in SSRs loci selected by in silico analyses of the genome of 14 different isolates of Phytophthora nicotianae (https://olive.broadinstitute.org/projects/ phytophthora_parasitica). Locus

P5 P15 P17 P44 P334 P493 P643 P788 P853 P1129 P1509 P1511 P1512 P2039 P2040 P2459 P4560 a b

Number of repeats determined per each genomea

Allelesb

INRA-310

149

329

364

PN47

H02

CJ05E6

IAC01/95

CJ02B3

CJ01A1

P1976

Chvinca01

P10297

P1569

24 26 27 32 23 18 18 16 11 12 23 20 18 11 10 23 30

6 11 14 11 12 28 18 12 7 5 12 23 15 4 INC. 15 21

5 14 19 21 8 21 20 10 12 9 20 11 21 8 8 23 19

5 18 19 11 11 18 15 11 6 10 16 20 18 4 6 10 14

8 NF 14 10 NF INC 16 NF 6 NF NF 16 NF 4 8 10 NF

7 12 14 10 11 24 11 13 12 5 13 12 19 4 11 15 21

5 11 31 30 8 28 14 14 7 13 24 28 27 9 11 10 11

5 11 27 29 25 INC 8 8 7 5 15 23 18 10 13 INC. 14

5 11 32 24 8 26 19 14 7 9 24 22 27 5 11 21 11

5 11 30 25 18 26 19 8 7 9 24 28 16 9 11 21 11

10 12 22 11 11 10 18 14 7 10 13 28 15 9 11 27 23

7 18 27 15 NF 24 16 9 13 9 12 16 12 12 11 15 23

5 18 21 12 10 22 38 13 23 7 26 18 25 5 14 7 18

5 11 28 11 14 23 8 8 7 14 14 25 14 9 11 22 22

6 5 9 10 8 8 9 8 6 7 9 9 9 7 6 7 8

In few cases SSRs were not identified because the genome assembly was incomplete (NF) or the locus was split on two different contigs (INC). Total number of different alleles identified per each locus for the 14 analyzed genomes.

Tests were conducted using reverse primers with or without a 5′ PIG tails in order to evaluate the presence and incidence of stutter peaks. The PIG tail dramatically increased the quality of amplifications, almost completely eliminating the presence of stutter peaks. In general, stutter bands were slightly evident for SSR with a 2-bp motif, almost

completely absent for SSRs with a 3-bp motif and completely absent in the SSR with a 4-bp motif. Genotyping with the 9 selected SSRs confirmed a high level of polymorphism with a total of 46 alleles detected within the 5 representative isolates (Table 7). The number of alleles per isolate varied between 14

Table 6 Alleles (in bp) and corresponding GenBank accession numbers for sequences (last three digits in parenthesis) determined for 17 selected SSR markers from 5 representative isolates of P. nicotianae (Albicocco 9, Ceanothus, Ferrara R3, Hibiscus B, and TL8V) by cloning and sequencing of PCR fragments. Locus

SSR motif

P5

TGTC

P15

TAC

P17

AAC

P44

TC

P334

Alleles and corresponding accession numbersa Albicocco 9

Ceanothus

Ferrara r3

Hibiscus B

TL8V

188 (549) 90/93/114 (558/559/560) ND

188/212/224 (550/551/552) 84/87/96 (562/563/561) ND

188/200 (554/555) 78/90 (566/567) ND

CA

177/207/209 (580/581/582) ND

192/208 (556/557) 78/96 (568/569) 126/147 (578/579) 173/175/177 (592/593/594) ND

P493

CT

ND

P643

GT

ND

ND

P788

GT

ND

ND

P853

TCTG

164/170/172 (599/600/601) 125/135 (604/605) ND

173/175 (583/584) 133/149 (595/596) 163/177/179 (543/544/545) ND

188 (553) 66/75 (564/565) 126/132/144 (575/576/577) 199/207/209/211/213 (585/586/587/588/589) 129/159 (597/598) ND

ND

P1129

GTA

P1509

GT

P1511

TG

150/153 (615/616) 126/128 (652/653) ND

166/186 (609/610) ND

123/127/133 (606/607/608) 138/142 (611/612) ND

P1512

CT

ND

P2039

CGA

ND

P2040

AGT

ND

P2459

CT

P4560

TC

137/139 (646/647) 112/114/116 (219/220/221)

ND 146/154/164/170 (620/621/622/623) 144/172/1782) (630/631/63) 99/120 (635/636) 153/162 (642/643) 139/145/151/159 (648/649/650/651) 98/100 (222/223)

138/168 (617/618) 118 (654) ND ND 96/99/114 (637/638/639) 156/162 (644/645) ND 110/128 (224/225)

177/185 (590/591) ND ND

ND 140/146 (624/625) ND

125/167/173 (546/547/548) 162/164 (602/603) ND 142/186 (613/614) 150 (619) ND

ND

150/152/160/162 (626/627/628/629) 144/150 (633/634) 111/120 (640/641) ND

ND

ND

ND

118/134/136 (226/227/228)

ND

ND = not determined. a Accession numbers are KJ909543 to KJ909651 or KJ923219 to KJ923228 (only for locus P4560) and the last three numbers are listed for each isolate in the table. Full accession numbers for each isolate can be determined by adding numbers in parentheses to “KJ909” or “KJ923” (only for locus P4560).

A. Biasi et al. / Journal of Microbiological Methods 110 (2015) 61–67

65

Table 7 Alleles identified in 5 representative isolates of Phytophthora nicotianae (Albicocco 9, Ceanothus, Ferrara R3, Hibiscus B, and TL8V) with 9 selected SSR markers using a duplex PCR approach (primers labeled with FAM or HEX) and a Genetic Analyzer to determine the allele length (in bp). Locusa

P5(1) P15(2) P17(1) P643(3) P788(3) P1129(4) P1509 P2039(4) P2040(2) Total a

Motif

TGTC TAC AAC GT GA GTA GT CGA AGT

Number and length of alleles determined per each isolate

Total N. of different alleles

Albicocco 9

Ceanothus

Ferrara r3

Hibiscus B

TL8V

190/234 93/111 126 166/174 127/137 151/154 132 111 158 14

190/226 93/96 129/144 160/168 129 151/154 116 99/120 155/164 16

190 66/75 129/144 148/162 127/129 139 124 99/114 158/164 15

190/202 78/90 126/144 166/190 129/137 154 116 99 155/158 15

194/210 78/96 105/129 164/166 135/139 151 118/168/170 111/120 164 17

6 7 4 8 5 3 6 4 3 46

Same numbers in parenthesis indicate that amplifications were in duplex reactions.

and 17, while the number of alleles for each locus varied between 3 and 7 (Table 7). In the different primer/isolate combinations a high level of heterozygosity was revealed with two alleles detected in 67% of the combinations. Furthermore, three alleles were detected for isolate TL8V with primers targeting locus P1509. Although, cloning and sequencing were not performed for all isolate/locus combinations (Table 6) the comparison of available results with those of the genotyping assay revealed some significant differences. In general, the level of polymorphism detected by genotyping was lower suggesting that some of the alleles detected by sequencing were actually the result of the slippage of the DNA polymerase during amplification. For example the triploidy detected by sequencing locus 15 in isolates Albicocco 9 and Ceanothus was not confirmed with the fragment analysis (Tables 6, 7). Similar findings were observed with locus 643 (isolate Albicocco 9), locus P17 (isolate Ferrara R3), locus P788 (isolate Hibiscus B) and locus P2039 (isolate Ferrara R3). Most of the detected differences were in agreement with the SSR motif since they were multiple or submultiple of the motif length itself. However fragments determined by sequencing for the trinucleotide loci P5 and P2040 were 2 bp shorter as compared to genotyping (Tables 6, 7). 4. Discussion The objective of the present study was the development and validation of a panel of microsatellites for the characterization of P. nicotianae. A large number of SSRs were screened taking advantage of the recently sequenced genomes of P. nicotianae from 14 different isolates of this important plant pathogen (https://olive.broadinstitute.org/projects/ phytophthora_parasitica) and selected SSRs and flanking primers were accurately evaluated using in silico and experimental approaches. Seventeen markers proved to be valuable since they were highly polymorphic and amplifiable from genetically distant isolates. Single nucleotide polymorphisms (SNPs) were sporadically identified in the flanking regions of SSRs in some markers. However, SNPs did not hamper the amplification of the markers or data analysis since they were not localized in the target region of primers and did not affect the length of amplicons. In contrast, markers where length variation was due to indels were discarded. The presence of SNPs in the flanking regions of SSRs is already documented and was utilized to develop a SNP-based approach to characterize P. infestans (Abbott et al., 2010). Although all 17 selected markers proved to be suitable to characterize P. nicotianae, a further selection was performed according to the localization of markers, their representativeness of different SSR motifs and results of an automated genotyping assay with differentially labeled primers (FAM or HEX) to enable duplex PCR reactions. This selection yielded 9 markers with 8 of them performing well in duplex reactions. The selection process utilized for these top markers should provide a high level of reliability even with genetically distant isolates of P. nicotianae. Indeed all SSRs and flanking primers were consistent

within the genome of 14 different sequenced isolates of the pathogen (https://olive.broadinstitute.org/projects/phytophthora_parasitica) and were experimentally validated against 5 isolates representing the breadth of diversity in P. nicotianae (Mammella et al., 2011, 2013). Both in silico and experimental analyses revealed a high level of polymorphism in all selected markers with a total of 46 alleles detected within the 5 tester isolates. Furthermore, a high level of heterozygosity was revealed with two alleles detected in 67% of the primer/isolate combinations. Moreover, three different alleles where detected for a single locus/isolate combination. Although P. nicotianae is a diploid organism the presence of more than two alleles has been recently reported using a SNP approach (Mammella et al., 2013). Cases of mixed ploidy (loci with more than two alleles) have been already described for SSR analysis on other Phytophthora species (Cooke et al., 2012). The selection of nine out of 17 well performing markers for further analysis was based on pragmatic considerations, but the eight excluded markers still represent a valuable resource in future applications if evaluation of additional diversity is needed. According to recent reports focusing on other Phytophthora species nine SSR loci should be enough to accurately characterize a pathogen population, especially if, as determined in the present study, they are highly polymorphic (Brurberg et al., 2011; Schoebel et al., 2014). Furthermore, selected SSR loci were designed on different assembled contigs in an effort to reduce chances they were closely linked and ensure a representative coverage of the genome. These features contribute to make them appropriate for a number of applications, including the characterization of the genetic structure of large populations and the study of its reproductive biology. On a methodological point of view, a relevant aspect of the present study is the accurate selection and optimization of SSRs in order to avoid major drawbacks related to the use of these molecular markers. Indeed, selected markers exhibited excellent fluorescence intensity and limited presence or complete absence of stutter peaks. The presence of stutter peaks due to DNA polymerase slippage was significantly reduced by: i) selecting the best performing SSRs, ii) optimizing amplification conditions (annealing temperature and MgCl2 concentration), iii) identifying the most appropriate dilution of amplicons to detect fluorescence and iv) adding an oligo-tail to the 5′ end of the reverse primer (PIG tail; Brownstein et al., 1996). Particularly relevant was the addition of the PIG tail since it dramatically increased the quality and reliability of the analyses. This small tail can significantly decrease the formation of misalignments due to an incorrect position of the nascent strand with the template, which could generate secondary structures, such as loop, and contribute to the slippage of the DNA polymerase either in the active site of the enzyme or before the substrate binds to the enzyme (Kunkel and Bebenek, 2000). In optimized conditions stutter peaks were greatly reduced for the 2-bp SSR motifs and were irrelevant or completely absent in the electropherograms of trinucleotide and tetranucleotide markers, respectively. In agreement with our results it has been reported that the Taq polymerase slippage rate increases

66

A. Biasi et al. / Journal of Microbiological Methods 110 (2015) 61–67

with the number of repeat units but is inversely correlated with repeat unit length (Shinde et al., 2003). Stutter peaks due to Taq polymerase slippage can greatly complicate genotyping, and in extreme cases can lead to ambiguous results (Leclair et al., 2004). In the present study, the relevance of the phenomenon and the importance of its reduction were revealed by comparing analyses conducted with and without a 5′ PIG tail and by comparing alleles detected using a traditional cloning/sequencing approach with those revealed using an automated genotyping assay. Indeed, several alleles identified by sequencing were found to be the result of errors during PCR amplification, with minor products differing in size from the main product by multiples or sub-multiple of the repeat unit length. For three loci (P5, P1129 and 2040), results obtained with the two methods were not in agreement with the motif length since alleles determined by sequencing were 1 or 2 bp shorter for dinucleotide or trinucleotide motifs, respectively. According to previous reports the slightly higher length determined with the Genetic Analyzer could be due to the addition of part of the PIG tail to the sequence or to the adenylation of the 3′ end of PCR-amplified products that is greatly favored by the presence of a PIG-tail on the 5′ end (Brownstein et al., 1996; Imle, 2005). An important feature of the microsatellite panel developed in the present study is its suitability for duplex PCR reactions since it reduces time and costs of SSR analyses (Tang et al., 2003; Li et al., 2010, 2013). This technique is supported by capillary electrophoresis equipments which are able to resolve the markers individually because of the different characteristic emission spectra of each dye. In recent years the use of the multiplex PCR associated with fluorescent tags revealed to be powerful tools for many studies on both diploid and polyploidy species (Jewell et al., 2010; Raabova et al, 2010; Li et al., 2013). In conclusion, results of the present study indicate that selected markers are appropriate for the characterization of broad populations of P. nicotianae since they: i) were consistently present in the genome of all isolates of P. nicotianae that have been sequenced; ii) were distributed on different contigs so they should not be closely linked; iii) were highly polymorphic and the observed variability was the result of different numbers of repeats; iv) were easily amplified and sequenced from representative tester isolates of P. nicotianae; v) were appropriate for duplex analyses and vi) were accurately optimized to reduce potential errors due to Taq polymerase slippage. P. nicotianae is a worldwide distributed pathogen and although primarily known as the causal agent of tobacco black shank and citrus root rot and gummosis, it is also responsible for severe foliar and fruit diseases as well as root and crown rots on herbaceous and perennial plant species in more than 250 genera, including horticultural and fruit trees (Cline et al., 2008). The prominent presence of P. nicotianae in nurseries of potted ornamentals and fruit tree species makes this species an ideal model to study diffusion pathways of Phytophthora and other soilborne pathogens on a global scale (Olson and Benson, 2011). Considering the potential of SSRs in genotyping Phytophthora populations (Dobrowolski et al., 2003; Li et al., 2013; Ioos et al, 2007; Prospero et al., 2007), markers selected and optimized in the present study should represent a powerful tool for future investigations as currently available data about genetic structure, ecology and epidemiology of this important plant pathogen are based on different approaches including RAPD-PCR, AFLP and SNP analyses of mitochondrial and nuclear DNA (Zhang et al., 2001; Zhang et al., 2003; Lamour et al., 2003; Mammella et al., 2011, 2013).

Acknowledgments We thank Brett Tyler, Franck Panabieres and Carsten Russ for making available the P. parasitica genome sequences at “https://olive. broadinstitute.org/projects/phytophthora_parasitica” prior to publication. Much of this work was conducted by Antonio Biasi while visiting the Martin lab and partially supported by a grant from the California Department of Food and Agriculture (2012 Specialty Crop Block Grant

Program) (SB12051) and by grant FIRB 2010 (RBFR10PZ4N) from the Italian Ministry of Education, University and Research (MIUR).

References Abbott, C.L., Gilmore, S.R., Lewis, C.T., Chapados, J.T., Peters, R.D., Platt, H.W., Coffey, M.D., Lévesque, C.A., 2010. Development of a SNP genetic marker system based on variation in microsatellite flanking regions of Phytophthora infestans. Can. J. Plant Pathol. 32, 440–457. Bienapfl, J.C., Balci, Y., 2014. Movement of Phytophthora spp. in Maryland's nursery trade. Plant Dis. 134–144. Blankenship, S.M., May, B., Hedgecock, D., 2002. Evolution of a perfect simple sequence repeat locus in the context of its flanking sequence. Mol. Biol. Evol. 19, 1943–1951. Brownstein, M.J., Carpten, J.D., Smith, J.R., 1996. Modulation of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping. Biotechniques 20, 1004-6–1008-10. Brurberg, M.B., Elameen, A., Le, V.H., Nærstad, R., Hermansen, A., Lehtinen, A., Hannukkala, A., Nielsen, B., Hansen, J., Andersson, B., Yuen, J., 2011. Genetic analysis of Phytophthora infestans populations in the Nordic European countries reveals high genetic variability. Fungal Biol. 115, 335–342. Cacciola, S.O., Magnano di San Lio, G., 2008. Management of citrus diseases caused by Phytophthora spp. In: Ciancio, A., Mukerji, K.G. (Eds.), Integrated Management of Diseases Caused By Fungi, Phytoplasma and Bacteria. Springer Science + Business Media, pp. 61–84. Cline, E.T., Farr, D.F., Rossman, A.Y., 2008. A synopsis of Phytophthora with accurate scientific names, host range, and geographic distribution. Plant Health Prog. http://dx.doi. org/10.1094/PHP-2008-0318-01-RS. Cooke, D.E.L., Young, V., Birch, P.R.J., Toth, R., Gourlay, F., Day, J.P., Caregie, S., Duncan, J.M., 2003. Phenotypic and genotypic diversity of Phytophthora infestans populations in Scotland (1995–97). Plant Pathol. 52, 181–192. Cooke, D.E.L., Lees, A.K., Lasses, P., Gronbech-Hansen, J., 2012. Making sense of Phytophthora infestans diversity at national and international scales. PPO-Spec. Rep. 15, 37–44. Dobrowolski, M.P., Tommerup, I.C., Blakeman, H.D., O'Brien, P.A., 2002. Non-mendelian inheritance revealed in a genetic analysis of sexual progeny of Phytophthora cinnammomi with microsatellite markers. Fungal Genet. Biol. 35, 197–212. Dobrowolski, M.P., Tommerup, I.C., Shearer, B.L., O'Brien, P.A., 2003. Three clonal lineages of Phytophthora cinnamomi in Australia revealed by microsatellites. Phytopathology 93, 695–704. Ellegren, H., 2004. Microsatellites: simple sequences with complex evolution. Nat. Genet. 5, 435–445. Erwin, D.C., Ribeiro, O.K., 1996. Phytophthora diseases worldwide. APS Press, St. Paul, MN.Ferguson, L., Sakovich, N., Roose, M., 1990. California Citrus Rootstocks. University of California Division of Agriculture and Natural Resources, Oakland (Publication 21477). Estoup, A., Jarne, P., Cornuet, J.M., 2002. Homoplasy and mutation model at microsatellite loci and their consequences for population genetics analysis. Mol. Ecol. 11, 1591–1604. Guichoux, E., Lagache, L., Wagner, S., Chaumeil, P., Leger, P., Lepais, O., Lepoittevin, C., Malausa, T., Revardel, E., Salin, F., Petit, R.J., 2011. Current trends in microsatellite genotyping. Mol. Ecol. Resour. 11, 591–611. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Hu, J., Pang, Z., Bi, Y., Shao, J., Diao, Y., Guo, J., Liu, Y., Lv, H., Lamour, K., Liu, X., 2013. Genetically diverse long-lived clonal lineages of phytophthora capsici from pepper in Gansu, China. Phytopathology 103 (9), 920–926. Imle, P., 2005. Fluorescence-based fragment size analysis. Methods Mol. Biol. 311, 139–146. Ioos, R., Barrès, B., Andrieux, A., Frey, P., 2007. Characterization of microsatellite markers in the interspecific hybrid Phytophthora alni ssp. alni, and cross-amplification with related taxa. Mol. Ecol. Notes 7, 133–137. Ippolito, A., Schena, L., Nigro, F., 2002. Detection of Phytophthora nicotianae and P. citrophthora in citrus roots and soils by nested PCR. Eur. J. Plant Pathol. 108, 855–868. Ivors, K., Garbelotto, M., Vries, I.D.E., Ruyter-Spira, C., Hekkert, B.T., Rosensweig, N., Bonants, P., 2006. Microsatellite markers identify three lineages of Phytophthora ramorum in US nurseries, yet single lineages in US forest and European nursery populations. Mol. Ecol. 15, 1493–1505. Jewell, M.C., Frere, C.H., Prentis, P.J., Lambrides, C.J., Godwin, I.D., 2010. Characterization and multiplexing of EST-SSR primers in Cynodon (Poaceae) species 1. Am. J. Bot. 97 (10), e99–e101. Jones, A.G., Small, C.M., Paczolt, K.A., Ratterman, N.L., 2010. A practical guide to methods of parentage analysis. Mol. Ecol. Resour. 10, 6–30. Knapova, G., Gisi, U., 2002. Phenotypic and genotypic structure of Phytophthora infestans populations on potato and tomato in France and Switzerland. Plant Pathol. 51, 641–653. Kunkel, T.A., Bebenek, K., 2000. DNA replication fidelity. Annu. Rev. Biochem. 69, 497–529. Lamour, K.H., Daughtrey, M.L., Benson, D.M., Hwang, J., Hausbeck, M.K., 2003. Etiology of Phytophthora drechsleri and P. nicotianae (=P. parasitica) diseases affecting floriculture crops. Plant Dis. 87, 854–858. Leclair, B., Fregeau, C.J., Bowen, K.L., Fourney, R.M., 2004. Systematic analysis of stutter percentages and allele peak height and peak area ratios at heterozygous STR loci for forensic casework and database samples. J. Forensic Sci. 49 (5), 1–13.

A. Biasi et al. / Journal of Microbiological Methods 110 (2015) 61–67 Lees, A.K., Wattier, R., Shaw, D.S., Sullivan, L., Williams, N.A., Cooke, D.E.L., 2006. Novel microsatellite markers for the analysis of Phytophthora infestans populations. Plant Pathol. 55 (3), 311–319. Leonberger, A.J., Speers, C., Ruhl, G., Creswell, T., Beckerman, J.L., 2013. A survey of Phytophthora spp. in Midwest nurseries, greenhouses, and landscapes. Plant Dis. 97, 635–640. Li, M., Senda, M., Komatsu, T., Suga, H., Kageyama, K., 2010. Development of real-time PCR technique for the estimation of population density of Pythium intermedium in forest soils. Microbiol. Res. 165, 695–705. Li, Y.C., Cooke, D.E.L., Jacobsen, E., van der Lee, T., 2013. Efficient multiplex simple sequence repeat genotyping of the plant pathogen Phytophthora infestans. J. Microbiol. Methods 92, 316–322. Mammella, M.A., Cacciola, S.O., Martin, F.N., Schena, L., 2011. Genetic characterization of Phytophthora nicotianae by the analysis of polymorphic regions of the mitochondrial DNA. Fungal Biol. 115 (4–5), 432–442. Mammella, M.A., Martin, F.N., Cacciola, S.O., Coffey, M.D., Faedda, R., Schena, L., 2013. Analyses of the populaition structure in a global collection of Phytophthora nicotianae isolates inferred from mitochondrial and nuclear DNA sequences. Phytopathology 103 (6), 610–622. Mascheretti, S., Croucher, P.J.P., Vettraino, A., Prospero, S., Garbelotto, M., 2008. Reconstruction of the sudden oak death epidemic in California through microsatellite analysis of the pathogen Phytophthora ramorum. Mol. Ecol. 17, 2755–2768. Moralejo, E., Pérez-Sierra, A.M., Álvarez, L.A., Belbahri, L., Lefort, F., Descals, E., 2009. Multiple alien Phytophthora taxa discovered on diseased ornamental plants in Spain. Plant Pathol. 58, 100–110. Olson, H.A., Benson, D.M., 2011. Characterization of Phytophthora species on floriculture crops in North Carolina. Plant Dis. 95, 1013–1020. Paetkau, D., Strobeck, C., 1995. The molecular basis and evolutionary history of a microsatellite null allele in bears. Mol. Ecol. 4, 519–520. Prospero, S., Black, J.A., Winton, M.L., 2004. Isolation and characterization of microsatellite markers in Phytophthora ramorum, the causal agent of sudden oak death. Mol. Ecol. 4, 672–674. Prospero, S., Hansen, E.M., Grünwald, N.J., Winton, L.M., 2007. Population dynamics of the sudden oak death pathogen Phytophthora ramorum in Oregon from 2001 to 2004. Mol. Ecol. 16, 2958–2973. Raabova, J., Hans, G., Risterucci, A.M., Jacquemart, A.L., Raspé, O., 2010. Development and multiplexing of microsatellite markers in the polyploidy perennial herb, Menyanthes trifoliate (Menyanthaceae). Am. J. Bot. 97, 31–33.

67

Schena, L., Cardle, L., Cooke, D.E.L., 2008. Use of genome sequence data in the design and testing of SSR markers for Phytophthora species. BMC Genomics 9, 620. http://dx.doi. org/10.1186/1471-2164-9-620. Schoebel, C.N., Jung, E., Prospero, S., 2013. Development of new polymorphic microsatellite markers for three closely related plant-pathogenic Phytophthora species using 454-pyrosequencing and their potential applications. Phytopathology 103 (10), 1020–1027. Schoebel, C.N., Stewart, J., Grunwald, N.J., Rigling, D., Prospero, S., 2014. Population history and pathways of spread of the plant pathogen Phytophthora plurivora. PLoS One 9 (1), e85368. http://dx.doi.org/10.1371/journal.pone.0085368. Selkoe, K.A., Toonen, R.J., 2006. Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecol. Lett. 9, 615–629. Shinde, D., Lai, Y., Sun, F., Arnheim, N., 2003. Taq DNA polymerase slippage mutation rates measured by PCR and quasi-likelihood analysis: (CA/GT)n and (A/T)n microsatellites. Nucleic Acids Res. 31, 974–980. Stewart, S., Abeysekara, N., Robertson, A.E., 2014. Pathotype and genetic shifts in a population of Phytophthora sojae under soybean cultivar rotation. Plant Dis. 98 (5), 614–624. Tang, S., Kishore, V.K., Knapp, S.J., 2003. PCR-multiplexes for a genome-wide framework of simple sequence repeat marker loci in cultivated sunflower. Theor. Appl. Genet. 107, 6–19. Walsh, P.S., Fildes, N.J., Reynolds, R., 1996. Sequence analysis and characterization of stutter products at the tetranucleotide repeat locus vWA. Nucleic Acids Res. 2 (14), 2807–2812. You, F.M., Huo, N., Gu, Y.Q., Luo, M., Ma, Y., Hane, D., Lazo, G.R., Dvorak, J., Anderson, O.D., 2008. BatchPrimer3: a high throughput web application for PCR and sequencing primer design. BMC Bioinf. 9, 253. http://dx.doi.org/10.1186/1471-2105-9-25. Zhang, X.G., Sun, W.X., Guo, L., Yu, J.F., Chang, C.J., 2003. Genetic and pathogenic variation among tobacco black shank strains of Phytophthora parasitica var. nicotianae from the main tobacco growing in China. J. Phytopathol. 151, 259–266. Zhang, X.G., Zheng, G.S., Han, H.Y., Han, W., Shi, C.K., Chang, C.J., 2001. RAPD-PCR for diagnosis of Phytophthora parasitica var. nicotianae isolates which cause black shank on tobacco. J. Phytopathol. 149, 569–574.